Переделка панели ваз 2114: тюнинг приборного щитка и торпеды своими руками

Содержание

Панель ВАЗ-2114: возможные варианты модернизации

Тюнинг панели приборов ВАЗ 2114

Сегодня многих автолюбителей интересует тюнинг панели ВАЗ 2114. Это объясняется ее конструкцией, которая прекрасно подходит для этого занятия. 

В целом, если вести речь о 2114-ой модели, следует отметить, что она является одной из последних, хорошо продуманных и выполненных моделей авто «семейства» ВАЗ. Для большинства тюнинг ВАЗ 2114 своими руками в целом, и усовершенствования салона в частности – это всего лишь замена чехлов на сидениях.

Однако это глубокое заблуждение, в салоне есть много объектов, которые можно красиво обновить. На протяжении всей истории марки ВАЗ 2114 считалось, что тюнинг салона – это масштабный, многоуровневый комплекс работ, который состоит из множества разнообразных действий по усовершенствованию разных элементов и, конечно, в числе прочих - панель приборов.

Комплексная модернизация панели приборов ВАЗ-2114: первые шаги

Чаще всего комплекс работ по усовершенствованию приборной панели ВАЗ 2114 является важным и необходимым, но, в то же время, интересным и серьезным занятием.

Главная задача - правильно подобрать детали и красиво их оформить. Все действия, которые касаются различных обновлений, всегда лучше продумывать наперед, заблаговременно.

В последствие это позволит избежать ненужных ошибок и мешающей суеты. Правильным решением будет составление плана работ, по которому вы будете следовать и благодаря которому не сделаете ошибок, а весь процесс будет для вас сплошным удовольствием.

Тюнинг приборной панели может выполнятся в следующей последовательности:

  1. Для начала необходимо разобрать автомобильное «устройство». Как снять панель приборов ВАЗ 2114 должен знать каждый автолюбитель. Здесь нет ничего сложного, все достаточно понятно, а сам процесс не требует специальных умений или знаний.
  2. Потом необходимо выполнить доработку элементов и частей. Здесь всегда может быть множество нюансов. Они зависят от того, что вы хотите поменять и улучшить в своем авто. Все следует продумать весьма тщательно.
  3. В конце нужно провести установку переделанной, обновленной «панельки» на место.

Как легко обновить «приборку» ВАЗ 2114

Усовершенствование приборной панели модели 2114, на самом деле, не такой сложный, как может показаться сначала, процесс. Купить такой «прибор» достаточно просто. Следует рассмотреть, какие варианты можно использовать владельцам, чтобы обновить гардероб ВАЗ 2114 (примеры на фото и видео).

1. АМС. Данная модель имеет несколько особенностей.

  • для начала, стоит отметить, что заказать ее дизайн можно самостоятельно;
  • данная панель комплектована интегрированным указателем масла, который отсутствует в классическом исполнении. Появление его связано с очень настойчивыми просьбами многих автолюбителей об установке этого «компонента» в штатную комплектацию.
  • выглядит такая панель приборов интереснее вследствие цветных шкал с хромированными окантовками.

2. PRO-SPORT. Данная «приборка» выполнена как накладка для панели приборов на представленную модель. Обновленное оформление данного устройства придает им впечатляющий, совершенно новый вид. Есть два варианта ее исполнения: со светлой и темной подложкой. Подсветка панели ВАЗ 2114 имеет специальную регулировку яркости, однако присутствует только одни цвет – синий. Шкалы наклеиваются после монтажа вставки. Это придать этому элементу машины оригинальный вид.

3. АМС-2. Центровым прибором стал тахометр, который перенесли слева в центр. Белые шкалы создают в общем спортивный вид всей панели. Это позволяют быстрее считывать  с нее необходимую информацию. Подсветка переделана, используются светодиоды, с помощью которых считывать информацию в ночное время не составляет труда. Установку рекомендуется проводить квалифицированным специалистам, поскольку при ее монтаже предусмотрена значительная «перепланировка» классической модели.

 

 

 

4. STREET STORM. Главной особенностью этой модели является ее цветовое оформление. В классическом расположении приборов не стали ничего менять,

упор был сделан на цветовую гамму. «Внешность» приборной панели претерпела определенные изменения, однако, при этом, стиль ее гармонично вписывается в существующий интерьер. Следует отметить еще одну особенность данной модели – это ее подсветка. Днем она светлая с красными символами. В темное время суток спокойно можно изменять не только яркость, но и цвет.

5. «Северный ветер». Эта модель отличается внешним видом. Разработчики показали, что даже при стандартном расположении приборов вся панель выглядит динамично и ярко. В ней явно просматриваются спортивные черты. Цвет подсветки зависит от оттенка шкал вставки.

Тюнинг в свое удовольствие

Главное в процессе модернизации любого автомобиля - это эффектность. Каждому владельцу хотелось бы, чтобы его машина выглядела оригинально и, в то же время, чтобы в ней было уютно. Как ни странно, но одной из любимых деталей для любителей тюнинга считается именно панель приборов. Ее можно по-разному доработать и, таким образом, выделить собственную машину из огромного количества подобных машин.

На стартовом этапе необходимо приготовить материал для работы. Замена панели ВАЗ 2114 или ее оригинальное обновление требует демонтажа стандартной панели. Необходимо будет снять только защитное стекло спидометра. Важно его не сломать. После снятия защитного стекла, нужно «деинсталлировать» стрелки указатели.

Важно быть аккуратным, поскольку стрелки весьма хрупкие. После этого вытаскиваем стандартную вкладку. Потом нужно сменить лампочки подсветки. Стандартные имели зеленый цвет, приобретенные же будут синего оттенка. Проводим замену стандартных лампочек на купленные, потом проверяем, как они работают. После этого, устанавливаем новую вкладку.

Все это будет смотреться очень эффектно. В конце устанавливаем стрелки-указатели и защитное стекло. Если таким образом доработать свою машину, то она будет выглядеть очень красиво.

Подсветка стрелок: красиво и оригинально

Рассматривая штатную «вазовскую» подсветку 2114 приходишь в определенное уныние. Сама панель светиться зеленым, подсветка отопителя - желтым, кнопки - зеленым, а индикация вообще оранжевая. Такое не сочетание оттенков многих владельцев не устраивает, и часто они задумываются о полной измене подсветки салона автомобиля.

Ездить в ночное время, и, при этом, не видеть приборов - дело опасное и неблагодарное. В этой ситуации можно сделать каждую стрелку светящейся, используя красный светодиод. Для этого необходимо разобрать щиток приборов, поставить под стрелки по красному светодиоду и надеть на него специальную термоусадку. Это поможет не рассеивать красный свет, он будет светить прямо.

Проводы от каждого необходимо вывести наружу щитка и дальше подцепить к проводам подсветки отопителя. После этого, стрелки будут светится насыщенным ярким красным светом.

Европанель для ВАЗ-2114

 

Для начала возникает вопрос: чем она хороша? Старая панель выполнена, мягко говоря, по-быстрому: руль перекрывает часть приборов, сама «приборка» отражается на лобовом стекле ночью, превращая, таким образом, дорогу, в компьютерный квест.

Пластик, а точнее, его качество, не выдерживает никакой критики. После прохождения несколько сотен километров, весь салон заполняет навязчивый скрип и жуткий грохот. Позже начинает открываться бардачок. Вентиляция плохая, зимой внутри машины холодно. Однако все эти проблемы решаемые. Однако стоит ли покупать авто и сразу думать о его ремонте?

Другое дело - европанель. Она выглядит современно и модно. Материал мягче и богаче. Он, конечно, менее шумный. Вентиляция тоже на уровне.

Повсюду чувствуется и отечественная сборка. Рычаги управления воздушными потоками туго двигаются, не доходят до краев прорезей. Также есть и другие мелочи: где-то зазор большой, там еще что-то отваливается, бардачок иногда сам по себе открывается. Но по количеству и частоте это совершенно несравнимо со старым вариантом.

Помимо этого, душу греют несколько ящичков для мелких вещей. Европанель – это современное и оригинальное решение многих проблем, связанных с «приборками» отечественных автомобилей.

Тюнинг панели приборов ВАЗ 2114

Формирование индивидуальности отечественного транспортного средства предусматривает в итоге несколько целей. Одной из них является обеспечение комфортной эксплуатации своего железного коня. Также персонализация позволяет снизить риски угона, ведь выделяющийся среди потока автомобиль проблематичней украсть, а впоследствии легче обнаружить. Применяя тюнинг панели приборов ВАЗ 2114, автовладелец подстраивает машину максимально под свой вкус.

При подобной переделке интерьера водителю удается настроить информативную приборную доску, выделяя нужные индикаторы персональной подсветкой. Однако, стоит учитывать, что подобный декор стоит достаточно дорого. Сэкономить удастся, если выполнять все работы своими руками.

Операции по модернизации

Важно не только выбрать в интернет-магазине понравившуюся панель, но и обеспечить ее грамотный монтаж ее на предусмотренное производителями место. Действия, касающиеся сборки/разборки необходимо продумывать наперед, чтобы минимизировать проблемы с установкой.

Следует учитывать, что автомобили отлично поддаются внутреннему тюнингу, поэтому накладка на панель приборов ВАЗ 2114 от сторонних производителей обычно легко вписывается в отведенное пространство.

Схема работы в такой ситуации довольно простая:

  • Правильно разбираем заводскую панель. Рекомендуем воспользоваться для этого крепежной схемой из автомобильного атласа, выпущенного автопроизводителем. В процесс можно обойтись без каких-либо съемников, ограничившись классическими отвертками и пассатижами.
  • На следующем этапе монтируем новый информационный блок перед водителем или полностью меняем торпедо по желанию, что окажется существенно дороже, но в результате даст больше позитивного эффекта.
  • Сразу выбрасывать устаревшую панель не стоит, так как с нее могут понадобиться какие-то детали. Возможно пригодятся заглушки или элементы «родного» крепежа. Также у новичков могут некоторые элементы крепежа повредиться в процессе установки, а замену им удастся найти в старой панели.

Перед началом всех работ мастеру необходимо внимательно ознакомиться с инструкцией по установке, предлагаемой производителем. В ней обычно подробно описывается пошаговый алгоритм действий.

Легкое обновление приборного щитка

В реальности тюнинг приборки ВАЗ 2114 оказывается не таким сложным, как может показаться вначале. На рынке имеется широкий выбор моделей для преобразования интерьера, поэтому каждый водитель получает возможность изменить пространство собственного авто по своему вкусу.

AMC. Автолюбители, которые выберут эту модель, должны знать некоторые особенности о ней:

  • выбрать понравившийся дизайн у производителя можно самостоятельно;
  • в комплекте присутствует указатель уровня масла, который отсутствует в традиционном «заводском» варианте исполнения, так как его появления желало большое количество пользователей, меняющих штатную внешность на костомную;
  • особая внешность достигается подбором интересных цветовых решений и использованием хромированной окантовки на каждой шкале.

Производитель также выпускает усовершенствованный вариант AMC-2.

PRO-SPORT. Вставка для щитка приборов представлена в оригинальном исполнении. Симпатичная разноцветная подсветка помогает быстро сориентироваться по приборам. Изготовители выпускают модель в двух вариациях подложек:

  • темная;
  • светлая.

Благодаря тому, что в автомобилях ВАЗ 2114 предусмотрена возможность установления разной степени яркости, то водитель может по своему желанию настроить данную опцию. Недостатком конкретной модели является то, что предусмотрен лишь один вариант цвета ­– синий. Наклеивание шкал осуществляется после установочных работ. В результате получается симпатичная панель в спортивном стиле.

STREET STORM. Особенностью данной тюнинговой накладки является неординарное цветовое решение, при этом производители не стали вносить каких-либо изменений в «заводское» расположение приборов. Основной упор в дизайне делался на расцветку.

Также использовались вариации с подсветкой. В дневной период она представляет собой светлый вариант с красными символами, а при ночном вождении у водителя имеется возможность переключения не только яркости, но и цветов.

АМС-2. В обновленной версии полюбившихся водителям тюнинговых накладок центральное место выделено под тахометр. Его производители переместили в наиболее видимую зону. Спидометр оттеснился влево. Белое поле, установленное за стрелками, придает спортивности и позволяет легко считывать данные, не задерживая долго зрение на приборах.

В подсветке применяются светодиодные элементы. Их ровная яркость помогает в ночное и вечере время легко считывать текущие параметры. Важно учесть, что установка должна проводиться с более опытными мастерами, так как в процессе монтажа требуется существенная перепланировка части интерьера.

Северный ветер. Дизайнерская модель отличается своей внешностью от более распространенных аналогов. Специалисты, занимающиеся разработкой не стали вносить коррективы в традиционное позиционирование приборов. Однако, даже при таком подходе им удалось обеспечить динамичность внешности.

Стильно выглядят встроенные в панель часы со спортивными нотками в дизайне. Цветовое решение щитка зависит от используемых вставленных шкал.

Тюнинг с использованием европанели

Одним из кардинальных способов видоизменения интерьера 14-й модели служит монтаж европанели. Подобное решение позволяет избавиться от вазовских «болезней», к которым относятся такие факторы:

  • у руля отсутствует возможность регулировок;
  • баранка перекрывает значительную часть приборов во время управления;
  • трудности с обзорностью в ночное время связаны с отражением работающей приборки на лобовом стекле;
  • не самые качественные материалы спустя небольшой промежуток времени существенно ухудшают восприятие интерьера;
  • применяемый пластик создает множество скрипов, стуков и горохота спуся небольшой период после начала эксплуатации;
  • самопроизвольное открытие перчаточного ящичка можно связать с низким качеством замка, используемого в конструкции;
  • прохладный салон в зимнее время связан с некачественно продуманной системой вентиляции в салоне.

Монтаж в салоне новой передней панели не только создает уют, но и решает множество практических задач. К ним относятся как вопросы шумоизоляции, так успешное утепление пространства.

В процессе производства европанели применяется высококачественный пластик. Также и сборка его оказывается без особых нареканий. Водителю предоставляется больше всевозможных ящичков для мелочей и полочек для современных гаджетов.

Установка новинки занимает немного времени. Поэтому ждать авто после перепланировки нужно недолго.

Самостоятельно разрабатывать подобные дизайнерские опции с внесением изменений в конструкции не стоит. Это связано с тем, что после переделки приборы, например, спидометр или тахометр будут показывать неверные значения. Допускать этого не стоит, так как факт может негативно сказаться на эксплуатации ТС, ведь в этом случае водитель вводится в заблуждение из-за неверных показаний, способных привести в итоге к аварии.

Интересное по теме:

загрузка...

Facebook

Twitter

Вконтакте

Одноклассники

Google+

Установка комбинации приборов от ВАЗ 2110 в ВАЗ 2109

Электронная комбинация приборов, вначале устанавливаемая на ВАЗ 2110, а затем и на Лады Самары второго поколения, часто является предметом обожания владельцев ВАЗ 2109 с низкой и высокой приборной панелью. Неудивительно, новая приборка выглядит не в пример краше старой, да и ее подсветка организована изнутри, а не снаружи, как на старых комбинациях. Плюс, новой приборке не нужен тросик спидометра, который часто отказывает или начинает досаждать издаваемым шумом. В связи с этим хорошая новость: комбинацию приборов ВАЗ 2110 можно установить на ВАЗ 2109, и в этой статье будет рассмотрено, как это можно сделать своими руками.

Комбинация приборов ВАЗ 2110 имеет каталожный номер 2110-3801010-02.

Плюсы в сравнении со штатной панелью ВАЗ 2109:

  • Спидометр и тахометр расположены в центре, что более наглядно, приборы не загораживаются ободом руля.
  • Более точные приборы.
  • Лампа критического остатка топлива не моргает при колебаниях уровня топлива в баке, а загорается под управлением электроники.
  • Есть режим самодиагностики, который активируется включением зажигания при нажатой кнопке сброса счетчика суточного пробега.

Есть и минусы:

  • Нужно допиливать козырек панели приборов, размеры комбинаций отличаются.
  • Необходимость подбирать датчик уровня топлива под соответствующее сопротивление, иначе указатель будет врать.

Так или иначе, но плюсы перевешивают.

Да, еще один момент. Понадобится установка датчика скорости, именно от него работает спидометр.

Для подключения новой комбинации приборов понадобится произвести переключение проводов в колодках X1 (белая) и X2 (красная), подключаемых к ней в соответствии со следующими таблицами:

 

В результате на своих местах останутся только 3 провода.

Если нет уверенности в своих силах, чтобы все вернуть на место лучше подписать первоначальное расположение каждого провода в колодке.

Нумерация контактов в колодках в соответствии со схемой:

 

Подключение контрольной лампы уровня тормозной жидкости нужно доработать: черный провод от этой лампы переключить от корпуса («земли») к +12В, иначе контрольная лампа не будет работать.
Если на панели есть второй ЖК дисплей для указателя внешней температуры, нужно установить сам датчик (на ВАЗ 2109 его нет), и провода от него подключить в соответствии со схемой, к контактам 1 и 2 колодки X2 (красная).

Датчик скорости вкручивается на место тросика спидометра, но разводка контактов там отличается, смотрим на цифры на самом датчике. Для верного подключения нужно использовать следующую таблицу:

 

Установка.

Новая комбинация немного короче штатной, поэтому требуется переделать одно ушко крепления, а именно немного нарастить его в длину. Делается это наклеиванием пластины из полистирола. Также корректируем угол наклона приборки подклейкой дополнительных пластин на поверхность крепления. Наращивать ухо крепления лучше с левой стороны, чтобы кнопка габариты/ближний свет встала на свое место без проблем. Приклеить все можно суперклеем.

 

Козырек.

Окно в штатном козырьке панели приборов ВАЗ 2109 не совпадает по форме и размерам с комбинацией приборов ВАЗ 2110. Поэтому при помощи эпоксидки подгоняем форму окошка под новую приборку с помощью подрезания и распорок. Затем все зашкуриваем и красим козырек.

 

 

 

 

 

 

Внешний вид доработки.

 

Выглядит все это конечно здорово по сравнению со штатной приборкой, особенно в темноте:

Датчик уровня топлива.

Придется подобрать датчик указателя уровня топлива, так как штатный будет подвирать.
Вот таблица сравнения параметров различных отечественных датчиков:

 

Наиболее точно показывает уровень датчик с маркировкой 2108-3827010-01, в начале красной зоны в баке остается литров 5 топлива, а середина шкалы указателя приходится примерно на остаток в 20 литров.

Лучше перед приобретением датчика измерить его сопротивление и взять тот, который при пустом баке имеет сопротивление до 360 Ом.

Оцените статью: Поделитесь с друзьями!

Тюнинг » Рекомендации по тюнингу ВАЗ 2114: Эффектная «четырнадцатая»

Рано или поздно каждый владелец отечественного автомобиля задумывается о том, чтобы каким-то образом преобразить своего «железного друга» и сделать его оригинальным среди серой массы соплеменников той же модели. Сделать это сегодня довольно легко.

Волшебная фраза — тюнинг ВАЗ способна превратить любой автомобиль в фантастичное исполнение ваших самых сокровенных мечтаний. Внешние и внутренние изменения могут не просто преобразить ваш автомобиль до неузнаваемости, но и увеличить его эффективность в несколько раз. Не говоря уже о такой особенности тюнинга как полное перевоплощение автомобиля, его эффектный образ, который просто невозможно не заметить на дороге.

Что касается расходов, то только на первый взгляд может показаться, что расходы уж больно велики. На самом деле, если взять, например, тюнинг ВАЗ 2114, то цены здесь достаточно умеренные. Грамотное сочетание эффективных деталей, ваших мечтаний и финансовых возможностей приведет к тому, что тюнинг вам обойдется практически по-дешевке.

Рассмотрим детально тюнинг ВАЗ 2114 правильно подобранными деталями с точки зрения специалистов ВС Авто, которые не просто сделают ваш автомобиль особенным, но и в несколько раз увеличат его эффективность.

Тюнинг экстерьера и салона

Обвес

Для рестайлинга внешности подойдет один из самых популярных и, на наш взгляд, самых лучших - тюнинг комплект Фанат Экстрим на ВАЗ 2114. Внешний облик ВАЗ 2114 сразу привлекает внимание своим объемным передним бампером. Первое, на что бросается взгляд — это большой воздухозаборник. Расположенный в центре переднего бампера, он придает отличные аэродинамические свойства автомобилю. По бокам воздухозаборника расположены противотуманные фары, обеспечивающие отличную видимость в условиях тумана, дождя или снега. Еще более агрессивный вид автомобилю прибавляет воздухозаборник, расположенный прямо на капоте. Притягательные взгляды прохожих вам точно обеспечены. Яркий капот гармонично вписывается в общий спортивный стиль автомобиля. Передний бампер плавно продолжают пороги, которые эффективно защищают нижнюю часть автомобиля.

Ребристый задний бампер становится ярким продолжением внешнего тюнинга ВАЗ 2114, прибавляет автомобилю аэродинамических свойств. Расположенные по бокам два воздухозаборника обеспечивают плавные завихрения воздуха. Подобная комплектация позволяет легко ездить автомобилю на высоких скоростях и удерживать гибкую балансировку на крутых поворотах. Как вариант на заднем бампере можно убрать дополнительные воздухозаборники, в зависимости от желаний. Благо тюнинг позволяет экспериментировать.

Диски

Из дисков отдадим предпочтение Slik L171, которые еще больше украшают автомобиль, дополняя его образ весомостью и динамичностью.

Салон

Заглянем в салон автомобиля. Внешний образ гармонично дополнит анатомический cалон VS Дельта, изготовленный на основе пенолитья повышенной плотности, который в несколько раз продливает срок эксплуатации сидения. Ярко выраженная спинки и сидушки обеспечивают высокий комфорт при различных маневрах машины. Располагаться на таких сидениях особенно приятно, а специальная продуманная эргономика позволяет чувствовать себя расслаблено, абсолютно не напрягая мышцы шеи и поясницы.

Панель приборов

Четырнадцатую прекрасно украсит оригинальная комбинация приборов GF 616. Благодаря четкой работе, вы всегда будете в курсе о диагностических параметрах автомобиля, параметрах комбинации приборов, техобслуживании, спортивных функциях, периодические будете получать аварийные и сервисные предупреждения и прочие характеристики, которые важно знать каждому автовладельцу.

Тюнинг ходовой

Заглянем под машину. Первое на что стоит обратить особое внимание — это на стойки. Идеально подойдет комплект стоек KYB масляных в сборе ВАЗ 2108-2115. Что здесь, собственно, особенного. Амортизаторы серии DEMFI рассчитаны для занижения автомобиля на 30 мм или 50 мм в зависимости от вашего желания. Такое занижение обеспечивает наилучшую управляемость автомобиля, отличное качество позволит прослужить ходовой долгие годы, а уровень жесткости, который выше чем у заводских аналогов, обеспечит надежное сцепление колес с дорогой.

Идем далее. Вместо стандартных рычагов можно установить высокопрочные облегченные треугольные рычаги с увеличенной прочностью с полиуретановыми втулками для ВАЗ 2108-2170. Такие рычаги во много раз улучшают управляемость автомобиля и в процессе эксплуатации уменьшают увод углов подвески, а также способствуют увеличению передней части кузова.

Передвигаясь в глубь ходовой, можно поставить подрамник с защитой и рычагами ВАЗ 2108, обеспечивающий большую защиту. Заметную эффективность тормозной системы автомобиля при езде обеспечат задние дисковые тормоза Luсas R13 c ABS и передние тормозные диски Alnas Sport. Особенно они выручают при резком экстремальном торможении.

Тюнинг двигателя

В сердце автомобиля устанавливаем Впускной ресивер ФОР-МАШ 21083 8-кл. Хоть это удовольствие и обойдется достаточно дорого, но такой подход позволит в несколько раз увеличить количество воздуха подаваемого в камеры сгорания. На Х/Х уменьшится количество оборотов, улучшится работа двигателя на низких и средних оборотах, ну а при высоких оборотах вы сразу почувствуете все плюсы многодроссельной заслонки.

После увеличения мощности стоит задуматься о выпускной системе. Для наших доработок идеально подойдет паук 4-2-1 ТЕАМ 80 для 16-ти клапанного двигателя. Паук изготовлен из технической нержавеющей стали, что обеспечивает повышенную надежность системы. В качестве резонатора ставим универсальный FOX. Он также изготовлен из нержавеющей стали, а, значит, устойчив к коррозии и эффективно гасит звуковые волны.

Отличную динамику разгона автомобиля определяет коленвал с ходом 80. Он одинаково хорошо подходит как для повседневной, так и для спортивной езды. Коленвал представлен с косым сверлением, что улучшает подвод масла к шейке.

С таким двигателем вам не нужно будет тратить много времени на разгон. Автомобиль набирает необходимую скорость моментально.

Тюнинг трансмиссии

Небывалую легкость вращения мотору придает супер облегченный маховик. Такую легкость можно сравнить разве что со спортивными мотоциклами. По-мимом того, что улучшается динамика разгона автомобиля, мотор более четко откликается на открытие и закрытие дроссельной заслонки и абсолютно без рывков позволяет плавно переходить с одной передачи на другую. Все это происходит за счет уменьшения времени сброса оборотов.

Специальная дисковая блокировка дифференциала Спорт, в отличие от стандартной, позволит перераспределить крутящий момент с разгруженного колеса на более загруженное или с колеса с меньшим коэффициентом трения на колесо с хорошим сцеплением с дорогой. Мало того, что обеспечивается снижение дополнительной нагрузки на детали трансмиссии и шины, при блокировке к тому же осуществляется максимальная эффективная работа колес. Автомобиль более управляем и гибок при любых скоростях.

ВАЗ 2114 в целом достаточно легко модернизировать в эксклюзивный спортивный автомобиль. Только профессиональный тюнинг от компании "VS-AVTO" способен прибавить вашему горячо любимому авто неповторимую внешнюю динамику, лучшую мощность и безупречную тормозную систему.

Замена лампочек в приборной панели ВАЗ 2114: не горит подсветка

Если взглянуть на панели приборов автомобилей, которые были выпущены лет 60-70 назад, то можно увидеть очень простую их комбинацию. Это спидометр, указатели температуры охлаждающей жидкости, давления масла, наличия топлива в баке, амперметра и 2-3 сигнальные лампочки.

Сегодня всё кардинально изменилось. Современные автомобили оснащаются мощными двигателями, развивают высокие скорости, поэтому конструкторы оснащают машины большим количеством систем пассивной и активной безопасности. Контроль их работы осуществляется контрольными лампами, установленными на панели приборов, а на некоторых моделях светодиодами или светодиодными лентами.
Панель приборов на ВАЗ 2114, 2115, 2113

ВАЗ 2114 И ЕГО ПАНЕЛЬ ПРИБОРОВ

На этом автомобиле, так же как и на модели ВАЗ 2113, устанавливают электронную комбинацию приборов от ВАЗ 2115. В ней кроме приборов контроля работы двигателя и его систем, дополнительно установлены контрольные лампы, в количестве 12 штук и 6 лампочек, которые освещают шкалы контрольных приборов.

Сколько лампочек в приборной панели ВАЗ 2114, стало понятно, следует сказать несколько слов об их назначении:

  1. Сигнализация о включении поворотов, отдельно для левой и правой стороны;
  2. Минимальный уровень топлива в баке;
  3. Включение габаритных огней;
  4. Аварийное состояние тормозной системы;
  5. Включение дальнего света фар;
  6. Контрольная лампа о контроле двигателя;
  7. Включение аварийной сигнализации;
  8. Лампа, показывающая разряд автомобиля;
  9. Сигнализация включённого ручного тормоза;
  10. Аварийное падение давления масла;
  11. Лампа открытия воздушной заслонки, кроме моделей с электронным впрыском топлива.

Также установлены лампочки для подсветки шкал приборов. Все индикаторы, сигнализирующие об аварийном состоянии той или другой системы, имеют красные светофильтры, остальные зелёные или оранжевые. Часто можно услышать такое выражение, что не работает панель приборов на ВАЗ 2114, это неправильное определение неисправности. Такое возможно только в одном случае, когда она совсем не подключена в машине. Может отказать один или несколько приборов, могут быть перегоревшие лампы, но что-то работоспособным останется. Чаще всего перегорают лампы, вот более подробно и рассмотрим вариант с перегоревшими лампами.

НЕ ГОРИТ ОДНА ИЛИ НЕСКОЛЬКО ЛАМПОЧЕК

В этом случае может быть две ситуации:

  • Не горит подсветка панели приборов ВАЗ 2114;
  • Не работает одна или больше контрольных ламп.

Рассмотрим первый вариант неисправностей, когда не работает подсветка панели приборов ВАЗ 2114. Начинать проверку работоспособности подсветки необходимо с проверки исправности предохранителя в этой цепи.  Это относится только к случаю, когда не горят все лампы подсветки.

Блок предохранителей на этой модели, так же как и на автомобилях ВАЗ 2113 и ВАЗ 2115, находится в подкапотном пространстве со стороны водителя. Необходимо снять его крышку и отыскать предохранитель, отвечающий за подсветку, это F10. Он рассчитан на ток силой 7,5 А. Если он перегорел, замените его новым и проверьте работу лапочек подсветки.

Далее события могут развиваться следующим образом, либо всё работает, либо нет. Если подсветка приборной панели работает, проверка на этом заканчивается, в противном случае необходимо продолжить поиск неисправности. Она может заключаться в плохом контакте разъёмов или обрыве цепи питания ламп подсветки.

Для поиска и устранения этих проблем необходимо вспомнить элементарные понятия законов электротехники, и иметь автомобильный светодиодный пробник электрических цепей, тестер или вольтметр. Если нет ни того ни другого, то лучше обратиться за помощью к автоэлектрику.

Гораздо проще обстоит дело, когда не горит одна или несколько, но не все лампочки подсветки. Перегоревшие лампочки просто заменяют заведомо исправными. Из практики автоэлектриков можно сделать вывод, что в большинстве случаев перегорает предохранитель или лампочка. До поиска неисправностей с помощью приборов дело доходит редко, но иногда бывает. Следует знать о том, что в случае, когда заменяемый (новый) предохранитель перегорает неоднократно, следует искать короткое замыкание в электрической цепи.

Во втором случае поступают примерно так же, но учитывают, что предохранителей на каждую контрольную лампу нет. Пробуют заменить лампочку новой, если она снова не горит, значит, нужна проверка контактов. Как правило, этого бывает достаточно для устранения неисправностей. В противном случае, лучше попросить о помощи специалиста, потому что виновником может оказаться датчик, работающий совместно с этой контрольной лампой.
Лампы для приборной панели

СНЯТИЕ ПАНЕЛИ ПРИБОРОВ И ЗАМЕНА ЛАМПОЧЕК

Чтобы снять приборку, необходимо иметь крестообразную отвёртку и «ловкие руки». Замена лампочек в приборной панели ВАЗ 2114 возможна только при снятой панели.

Для этого снимается декоративная накладка магнитолы, которая связана с ней. Для этого используют отвёртку. Начинать необходимо с нижнего края, проделывать всё нужно очень осторожно, чтобы не повредить хрупкие пластмассовые детали. Когда она немного сдвинется с места, следует потянуть его немного на себя и можно освобождать верхнюю часть.

Далее порядок действий будет таков:

  1. Нужно отключить провод от прикуривателя;
  2. Снимается накладка панели примерно так же как у магнитолы, с той разницей, что там ещё имеется два самореза и защёлки;
  3. Снова необходимо отсоединить все провода, идущие к панели;
  4. Выкручиваются четыре самореза и панель можно вынуть со своего места. Делать это необходимо осторожно и аккуратно.

Вопрос о том, как поменять лампочки на панели приборов, не относится к числу очень сложных, справиться с этим по силу даже начинающим водителям.  Необходимо найти  перегоревшую лампочку и аккуратно извлечь её из гнезда. Она снимаются вместе с патроном. Для этого нужно его повернуть против часовой стрелки и вынуть наружу.

После замены перегоревшей лампы патрон устанавливается в гнездо, снова очень аккуратно. После этого панель можно ставить на своё место. Установка происходит в обратной последовательности. Чтобы не оказалось, что не работает приборная панель ВАЗ 2114, не забудьте подсоединить все снятые ранее провода и разъёмы на свои места.

Последнее время многие владельцы вазовских машин занимаются различным видом тюнинга, в том числе и модернизацией щитка приборов. Существует большое количество вариантов такой модернизации. Можно сделать белую подсветку панели приборов, произвести замену ламп светодиодами, поменять шкалы приборов. Встречаются и такие варианты, где подсвечены стрелки приборов, а также другие варианты переделок.

Распиновка приборной панели ВАЗ | 2 Схемы

При ремонте или замене приборной панели (щитка приборов) автомобилей ВАЗ на более удобную и современную версию VDO, выполненную на светодиодах, вам потребуются схемы подключения и распиновки раъёмов панелей. Для этого редакция 2SHEMI.RU подготовила полный сборник распиновок контактов панели для всех популярных моделей этого авто.

Основными обозначениями, которые встречаются на приборной панели абсолютно любого автомобиля семейства ВАЗ, являются: спидометр, датчик топлива, тахометр и датчики для обозначения температуры двигателя.

Распиновка приборной панели ВАЗ2105, 2106, 2107

Старая панель (с указателем давления масла)

Кроме наличия указателя давления масла стоит отметить, что в этой приборной панели отсутствует лампа индикации воздушной заслонки (подсос), а лампа аварийного давления масла находится рядом с указателем давления. За то в ней присутствуют лампы низкого уровня тормозной жидкости и противотуманных фонарей.

Белая 6-клеммовая колодка X1:

  1. Датчик уровня бензина
  2. Контрольная лампа указателей поворота
  3. Датчик заряда АКБ (вольтметр -)
  4. Контрольная лампа уровня бензина
  5. Общий плюс (+)
  6. Датчик заряда АКБ (вольтметр +)

Белая 8-клеммовая колодка X2:

  1. Контрольная лампа противотуманных фонарей
  2. Контрольная лампа дальнего света
  3. Контрольная лампа габаритов
  4. Пустой
  5. Контрольная лампа заряда АКБ
  6. Контрольная лампа уровня тормозной жидкости
  7. Пустой
  8. Контрольная лампа стояночного тормоза

Оранжевая 6-клеммовая колодка X3:

  1. Общий минус (-)
  2. Тахометр ВАЗ
  3. Подсветка приборов
  4. Датчик давления масла
  5. Контрольная лампа давления масла
  6. Датчик температуры охлаждающей жидкости

Новая панель приборов (с эконометром)

Здесь же всё наоборот — указатель давления масла отсутствует (вместо него эконометр), вместо лампы уровня тормозной жидкости — лампа подсоса (или лампа системы управления двигателем на инжекторах), а вместо лампы противотуманных фонарей — лампа давления масла.

Белая 6-клеммовая колодка X1:

  1. Датчик уровня бензина
  2. Контрольная лампа указателей поворота
  3. Датчик заряда АКБ (вольтметр -)
  4. Контрольная лампа уровля бензина
  5. Общий плюс (+)
  6. Датчик заряда АКБ (вольтметр +)

Белая 8-клеммовая колодка X2:

  1. Контрольная лампа габаритов
  2. Контрольная лампа дальнего света
  3. Контрольная лампа давления масла
  4. Пустой, но в проводке присутствует клемма, идущая к датчику уровня тормозной жидкости
  5. Контрольная лампа заряда АКБ
  6. Контрольная лампа воздушной заслонки (подсоса) или блока управления двигателем для инжекторов
  7. Пустой
  8. Контрольная лампа стояночного тормоза (ручник)

Оранжевая 6-клеммовая колодка X3:

  1. Общий минус (-)
  2. Тахометр (если данный контакт пустой, значит тахометр на контакте #4)
  3. Подсветка приборов
  4. Пустой, а если не пустой — к тахометру
  5. Пустой
  6. Датчик температуры охлаждающей жидкости

Второй вариант схемы подключения

Распиновка приборной панели ВАЗ2108, 2109, 21099

Схема соединений комбинации приборов до 1996 г.

1 — реле-прерыватель контрольной лампы стояночного тормоза; 2 — тахометр со стабилизатором напряжения; 3 — лампа освещения комбинации приборов; 4 — указатель температуры; 5 — блок управления БСК; 6 — указатель уровня топлива; 7 — резистор 50 Ом, 5 Вт; 8 — контрольная лампа «CHECK ENGINE» для системы снижения токсичности; 9 — контрольная лампа дальнего света фар; 10 — контрольная лампа габаритного света; 11 — резервная контрольная лампа; 12 — контрольная лампа не пристегнутых ремней безопасности; 13 — контрольная лампа левых указателей поворота; 14 — резистор 470 Ом, 0,25 Вт; 15 — электронный вольтметр; 16 — контрольная лампа правых указателей поворота; 17 — контрольная лампа аварийного давления масла; 18 — контрольная лампа резерва топлива; 19 — контрольная лампа воздушной заслонки карбюратора; 20 — контрольная лампа «CHECK ENGINE» для системы впрыска топлива; 21 — контрольная лампа стояночного тормоза.

Схема соединений комбинации приборов после 1996 г.

1 — тахометр; 2 — лампа освещения комбинации приборов; 3 — указатель температуры; 4 — блок управления БСК; 5 — указатель уровня топлива; 6 — контрольная лампа «CHECK ENGINE» для системы снижения токсичности; 7 — контрольная лампа дальнего света фар; 8 — контрольная лампа габаритного света; 9 — резервная контрольная лампа; 10 — контрольная лампа не пристегнутых ремней безопасности; 11 — контрольная лампа левых указателей поворота; 12 — контрольная лампа заряда аккумуляторной батареи; 13 — контрольная лампа правых указателей поворота; 14 — контрольная лампа аварийного давления масла; 15 — контрольная лампа резерва топлива; 16 — контрольная лампа воздушной заслонки карбюратора; 17 — контрольная лампа «CHECK ENGINE» для системы впрыска топлива; 18 — контрольная лампа стояночного тормоза; В1 — резистор 91 кОм; В2 — резистор 50 Ом, 5 Вт.

Цоколёвка приборной панели ВАЗ2110, 2111, 2112

  1. контрольная лампа топливного резерва;
  2. лампы освещения приборной панели;
  3. контрольная лампа правого повторителя;
  4. контрольная лампа левого повторителя;
  5. колодка штекеров ВАЗ;
  6. датчик температуры охлаждающей жидкости;
  7. контрольная лампа наружного освещения;
  8. контрольная лампа воздушной заслонки карбюратора;
  9. контрольная лампа масляного давления;
  10. контрольная лампа ручника;
  11. контрольная лампа заряда аккумулятора;
  12.  ВАЗ тахометр;
  13. контрольная лампа «CHECK ENGINE»;
  14. спидометр щитка;
  15. контрольная лампа уровня тормозной жидкости;
  16. контрольная лампа аварийной сигнализации;
  17. контрольная лампа дальнего света фар;
  18. указатель уровня топлива.
Белая колодка (Х1) Красная колодка (Х2)
1 Корпус (масса) 1 К клемме «W» датчика указателя уровня топлива
2 Тахометр (низковольтный вход с ЭБУ) 2 Предохранитель F19 + 12В питание
3 Тахометр (высоковольтный вх. с катушки) 3 Корпус (масса)
4 Const +12В от аккумулятора (через 6-й предохранитель) 4 Выключатель освещения приборов
5 Датчик температуры охлаждающей жидкости. 5 Указатель поворота ПРАВЫЙ
6 Предохранитель F1 (габаритное освещ.) 6 Указатель поворота ЛЕВЫЙ
7 Дроссельная заслонка («подсос») 7 Уровень тормозной жидкости
8 Лампа Check Engine 8 К маршрутному компьютеру
9 Предохранитель F19 + 12В питание 9 Датчик скорости
10 Предохранитель F19 + 12В питание 10 Клемма «Т» указателя топлива
11 Стояночный тормоз, клемма «ВК» 11 Предохранитель F3 (дальний свет)
12 Вывод «D» генератора 12 Выключатель аварийной сигнализации
13 Датчик давления масла 13 К клемме «50» выключателя зажигания

Распиновка приборной панели ВАЗ2113, 2114, 2115

На панели приборов ВАЗ-2114 имеется 26 контактов, каждый из которых отвечает за работу показателей этой панели. Если на панель подается плюс, то каждый контакт демонстрирует сведения о том состоянии, в котором находится в настоящий момент автомобиль.


Белая колодка (Х1)

Красная колодка (Х2)

  • Корпус (масса) — чёрный
  • К датчику температуры окружающеговоздуха — голубой-пурпурный
  • Тахометр (низковольтный вход с ЭБУ) — коричнево-пурпурный
  • Предохранитель F16 (к клемме 15 замказажигания) — оранжевый
  • Тахометр (высоковольтный вх. с катушки) — жёлтый
  • Корпус (масса) — чёрный
  • К предохранителю F3 монтажногоблока (+аккумуляторной батареи) — бело-пурпурный
  • Регулятор освещения приборов — белый
  • Датчик температуры охлаждающей жидкости. — зелёно-белый
  • Указатель поворота ПРАВЫЙ — голубой
  • К предохранителю F10 монтажного блока- коричневый
  • Указатель поворота ЛЕВЫЙ — голубой-чёрный
  • Уровень тормозной жидкости -розово-голубой
  • Лампа Check Engine к контроллеру ЭБУ — бело-пурпурный
  • К маршрутному компьютеру — коричневый
  • К контроллеру ЭБУ — розово-чёрный
  • Датчик скорости — серый и жёлтый
  • К датчику указателя уровня топлива — оранжевый
  • К датчику указателя уровня топлива — розовый
  • К выключателю стояночного тормоза- коричнево-голубой
  • Предохранитель F14 монтажного блока — зелёно-чёрный
  • Вывод «D» генератора через панель предохранителей — коричнево-белый
  • Выключатель аварийной сигнализации
  • Датчик давления масла — сине-голубой
  • К клемме «50» выключателя зажигания — пурпурный

Кроме этого, на приборном щитке установлены специальные указатели и датчики подачи сигналов, а само управление панелью производится за счет специального электронного блока. Разобрав панель приборов, можно увидеть, что внутри нее находятся две колодки: красная и белая. А все входы, выходы и предохранители соединяются со штекером. Если датчики выходят из строя, потребуется их замена. Поврежденные либо окисленные провода также лучше заменить. Контрольные лампочки, как и любые другие, иногда сгорают. Несомненно, их нужно заменить на целые. Наряду с ними нередко сгорает ламповый датчик.

Схема соединений панели приборов ВАЗ 2114

  1. выключатель обогрева заднего стекла;
  2. выключатель задних противотуманных фонарей;
  3. переключатель света фар и указателей поворота;
  4. монтажный блок;
  5. переключатель стеклоочестителей;
  6. выключатель противотуманных фар;
  7. блок индикации бортовой системы контроля;
  8. колодка жгута панели приборов к жгуту дополнительному;
  9. комбинация приборов;
  10. колодка жгута панели приборов к жгуту борткомпьютера;
  11. колодка жгута панели приборов к жгуту системы зажигания;
  12. колодка жгута панели приборов к жгуту боковых дверей;
  13. предохранитель 16 А;
  14. предохранитель 16 А;
  15. выключатель зажигания;
  16. выключатель на освещения;
  17. электродвигатель отопителя;
  18. добавочное сопротивление электродвигателя отопителя;
  19. реле разгрузки замка зажигания;
  20. реле задних противотуманных огней;
  21. реле стартера;
  22. патрон подключения переносной лампы;
  23. прикуриватель;
  24. колодка жгута панели приборов к жгуту проводов лампы освещения вещевого ящика;
  25. осветитель;
  26. осветитель;
  27. осветитель;
  28. переключатель отопителя;
  29. регулятор освещения приборов с реостатом;
  30. выключатель сигнала торможения;
  31. выключатель звукового сигнала;
  32. выключатель аварийной сигнализации;
  33. лампа подсветки пабло управления отопителем;
  34. предохранитель 16 А;
  35. реле обогрева сидений;

Другой вариант схемы цоколёвки разъёмов

  1. проверка сигнализатора уровня тормозной жидкости. Если подать +, то лампа тормозов загорится. Можно подключить к красному проводу замка зажигания, тогда также, как и на 2110/2114 лампа будет проверяться при включении стартера.
  2. лампа аварийной сигнализации, загорится при подаче +.
  3. лампа дальнего света, подключить к зелёно-чёрному проводу.
  4. указатель уровня топлива, подключить к розово-красному проводу.
  5. к датчику скорости.
  6. выход сигнала скорости на бортовой компьютер. Если он есть, то сигнал скорости брать с этого контакта.
  7. сигнализатор уровня тормозной жидкости, подключить к розово-синему проводу у лампы над прикуривателем. У ВАЗ-2107 лампа работает наоборот: датчик соединяет лампу с массой и она горит. Придётся или оставить лампу там, где она есть, или в новой приборке перепаять лампу к + и поменять местами диоды (при этом для проверки лампы контакт 1 нужно соединять с массой, например к лампе ручника), или у датчика на бачке чёрный провод убрать, и подключить вместо него оранжевый от блока ЭПХХ, или синий от катушки зажигания, при этом диод в проводке (между бородой и бардачком) обязательно отключить, если этого не сделать, то будет короткое замыкание.
  8. лампа левого поворота, подключить к сине-чёрному проводу колодки подрулевого переключателя.
  9. лампа правого поворота, подключить к синему проводу колодки подрулевого переключателя.
  10. подсветка приборов, подключить к белому проводу.
  11. масса, подключить к чёрному проводу.
  12. питание приборов, подключить к оранжевому проводу.
  13. если приборка простая (без микросхем и т.п.), то подключить к сине-красному проводу (лампа резерва топлива), если под тахометром есть дисплей, то подключить к датчику температуры (брать от ВАЗ-2114, один контакт к приборке, другой на массу, поставить или в салоне или в моторном отсеке но чтобы далеко от двигателя и чтобы ветер не дул).
  14. масса, подключить к бело-чёрному проводу.
  15. низковольтный вход тахометра (от ЭСУД), подключить к коричнево-синему проводу.
  16. высоковольтный вход тахометра (от катушки), подключить к коричнево-синему проводу.
  17. если под спидометром есть дисплей, то подключить к красно-белому проводу у выключателя стоп-сигналов.
  18. указатель температуры охлаждающей жидкости, подключить к зелёно-белому проводу.
  19. лампа наружного освещения, подключить к жёлтому проводу.
  20. лампа прикрытия воздушной заслонки карбюратора, подключить к серо-оранжевому проводу.
  21. идут к лампе ЭСУД. Если машина инжекторная, то один из контактов подключить к оранжевому проводу, а другой к оставшемуся.
  22. идут к лампе ЭСУД. Если машина инжекторная, то один из контактов подключить к оранжевому проводу, а другой к оставшемуся.
  23. питание приборов, подключить к оранжево-синему проводу.
  24. лампа ручного тормоза, подключить к коричневому проводу.
  25. лампа заряда аккумулятора, подключить к коричнево-белому проводу.
  26. лампа низкого давления масла, подключить к серо-синему проводу.

Панели приборов VAZ VDO (светодиодная)

Можно поставить более красивую и удобную панель на LED индикаторах, так называемую VDO панель. Здесь VDO — это производитель панели.

Подключение VDO на автомобиле «Калина»
1 Розово-белый К электроусилителю руля
2 Голубой с белым К контрольному сигнализатору аварийной сигнализации
3 Серо-голубой К датчику аварийного давления масла
4 Коричнево-голубой К выключателю стояночного тормоза
5 Желто-голубой К блоку управления иммобилизатора
6 Черный К блоку управления подушкой безопасности
7 Желтый К выключателю наружного освещения
8 Голубой К переключателю указателя поворота правому
9 Голубой с черным К переключателю указателя поворота левому
10 Бело-голубой К ЭБУ
11 . К датчику износа тормозных колодок
12 . К датчику ремней безопасности
13 Черный К блоку управления противобуксовочной системы
14 Красно-голубой Клавиша «RESET» на подрулевом переключателе
15 Розово-голубой К датчику уровня тормозной жидкости
16 Черный К ABS
17 Зеленый К выключателю дальнего света фар
18 Белый К регулятору освещения комбинации приборов
19 Коричневый Масса панели
20 Бело-красный Клемма «30»
21 Оранжевый Клемма «15»
22 Желто-красный К датчику расхода топлива
23 Оранжево-белый Клавиша МК «вперед»
24 Бело-черный Клавиша МК «назад»
25 Черно-белый Датчик наружной температуры (-)
26 Желто-зеленый Датчик наружной температуры (+)
27 Розовый Датчик уровня топлива
28 Серый Датчик скорости
29 Зелено-белый Датчик температуры ОЖ
30 Коричнево-красный Тахометр (низковольтный)
31 . Служебный. Диагностика панели.
32 Коричнево-белый Клемма «L» реле-регулятора генератора

Индикаторы панели приборов ВАЗ — расшифровка

  1.  указатель температуры охлаждающей жидкости.
  2. тахометр;
  3. контрольная лампа левых указателей поворота;
  4. контрольная лампа правых указателей поворота;
  5. спидометр;
  6. указатель уровня топлива;
  7. контрольная лампа резерва топлива;
  8. контрольная лампа габаритного света;
  9. контрольная лампа рабочей тормозной системы;
  10. контрольная лампа дальнего света фар;
  11. кнопка сброса показаний;
  12. индикатор пробега;
  13. контрольная лампа включения аварийной сигнализации;
  14. контрольная лампа «проверьте двигатель»;
  15. индикатор времени и температуры;
  16. контрольная лампа заряда аккумуляторной батареи или лампа аккумулятора;
  17. контрольная лампа стояночного тормоза;
  18. контрольная лампа давления масла;
  19. резерв.

Индикаторы приборной панели ВАЗ играют важную роль в осведомлении пользователя о неисправностях. Они помогают предотвратить ошибки в работе системы, поэтому важно знать, какой индикатор что означает. Как работает панель? Если возникает какая-то неполадка, датчик сразу высылает информацию на панель, и водитель увидит загоревшийся сигнал оранжевого цвета.

Панель приборов более ранней версии имела еще некоторые обозначения, например, аварийное давление масла, включенный ручной тормоз, сигнал проверки двигателя Chek Engine и несколько других, обозначающих мелкие ошибки в работе, но которые сейчас не используются.

Ремонт или замена приборной панели ВАЗ

Если на автомобиле на щитке приборов не работает ни один из установленных на нём указателей (спидометр, одометр, тахометр, указатели уровня топлива и температуры охлаждающей жидкости), то первое, что придётся сделать водителю, это проверить целостность предохранителя F3, который находится в монтажном блоке. Если он сгорел, то прежде, чем его заменить, нужно найти причину, из-за которой он перегорел, иначе у вновь поставленного нового предохранителя будет та же участь, что и у предыдущего. Наиболее часто, предохранители горят, в результате короткого замыкания.

Если даже предохранитель цел, то не поленитесь достать его и проверить состояние контактов. Бывают случаи, когда контакты окисляются, а электрическая цепь в этом месте, прерывается. Убедившись в целостности предохранителя, следующим шагом будет проверка реле зажигания, которое находится в салоне автомобиля слева от рулевой колонки. Оно закреплено на шпильке «вниз головой». В колодке, куда вставляется это реле, при помощи перемычки можно попытаться замкнуть силовые провода. Если при этом щиток приборов оживёт, то реле зажигания придётся заменить.

При исправности реле зажигания, вероятных причин не рабочего состояния щитка приборов, остаётся только две: замок зажигания и монтажный блок. До установки на автомобиле ВАЗ-2109 реле зажигания, контакты замка, подгорали часто, и их приходилось зачищать, отсоединяя контактную группу от самого замка. После внесения изменений, в принцип подачи напряжения на замок зажигания, его контакты стали подгорать очень редко, но вероятность этого явления, все же осталась. На монтажном блоке, в его плате, могут перегорать дорожки, для того чтобы это увидеть монтажный блок придётся снять с автомобиля.

Кроме выше перечисленных причин, которые могут привести к отказу в работе щитка приборов, необходимо ещё и проверять надёжность крепления массового провода. Наиболее распространенные проблемы:

  • перегорание ламп накаливания или выход из строя светодиодной группы;
  • окисление разъемов;
  • неисправность электропроводки;
  • выход из строя блока предохранителей;
  • повреждение общей контактной платы;
  • отсутствие массы на кузов (минуса) или поврежденности системы габаритов.

Для поиска неисправности необходимо применить диагностическое оборудование, тестер или вольтметр. При нахождении поломки можно приступать к ремонту.

Снятие приборной панели авто

  1. при помощи крестообразной отвертки снять три самореза, которые крепят центральную консоль;
  2. снять накладку, находящийся внизу выступ, вывести выступ из кронштейна;
  3. насадкой отвернуть пять саморезов, размещенных в консоли справа, снять экран;
  4. отсоединить клемму со знаком (-) от батареи аккумулятора. Если имеется радиоприемник, его нужно снять, достать заглушку из щитка;
  5. провода, идущие от прикуривателя, отсоединить, достать патрон;
  6. при помощи узкой отвертки снять рукоятку с рычагов;
  7. потянув на себя, у отопительного и вентиляторного выключателя снять рукоятку;
  8. открутить два самореза над панелью и два, находящиеся под ней при помощи отвертки;
  9. открутить саморез, находящийся за панелью;
  10. два самореза, крепящих накладку, также открутить;
  11. отсоединить колодки жгута и проводов. Чтобы при установке панели не было замешательства, следует пометить порядок их подсоединения;
  12. отвинтить болты крепления;
  13. открутить два самореза, те, что крепят нижний кронштейн при помощи ключа на 8;
  14. открутить саморез, крепящий световод и снять его;
  15. саморезы, крепящие отопительный блок также открутить;
  16. снять ламповые патроны;
  17. после снятия внешних деталей, вынуть декоративную вставку;
  18. открутить все гайки ключом на 21;
  19. гидрокорректор, вынуть его лампу;
  20. открутить саморезы, которые крепятся к поперечине, находящейся слева.
  21. В конце снимается сама панель. Сборка панели проводится, соответственно, в обратной последовательности.

В общем работа по ремонту вполне выполнима даже своими руками, но прежде чем начинать демонтажные работы, нужна хотя бы условно нанесенная на бумагу распиновка, иначе придется трудно: нужно будет «проследить» каждый провод и каждое соединение, которое находится на «пути следования» от приборов до кнопки включения.


Доработка салона, тюнинг салона Ваз 2114, Ваз 2115, Ваз 2113, Лада Самара 2

ВАЗ

/

2113, 2114, 2115

/

тюнинг

/

салона

Доработка салона, тюнинг салона Ваз 2114, Ваз 2115, Ваз 2113, Лада Самара 2

. Тюнинг салона ваз 2115 своими руками, внутренний тюнинг ваз 2114, советы по доработке салона ваз 2113, ваз 2115, ваз 2114. Тюнинг - это улучшение заводских характеристик. Несмотря на то что автомобили Лада Самара 2 являются удачными, в этих машинах все равно присутствуют недостатки, поэтому автовладельцы очень часто прибегают к тюнингу ваз своими руками. В наших разделах вы можете ознакомится с некоторыми доработками своими силами. Все материалы разбиты по категориям и содержат развернутые инструкции по доработке основных узлов автомобиля ваз 2115: тюнинг двигателя, тюнинг кузова, тюнинг салона, тюнинг коробки передач, тюнинг подвески и тормозов, а также найдете разделы по тюнингу ваз с фото. Добро пожаловать в разделы тюнинга и доработок ваз 2113.

Самым безопасным является рулевое колесо, установленное на автомобиль заводом-изготовителем. Именно оно было разработано специально для данной модели автомобиля, прошло необходимые испытания и соответствует действующим нормативам. «Самары» последних лет выпуска комплектуются рулевыми колесами от «десятки» — удобными, «ухватистыми», признанно безопасными. Владельцы автомобилей, выпущенных раньше,

Блокираторы рулевого вала относятся к механическим противоугонным системам или попросту замкам. Надежность и полезность механических систем очевидна и не нуждается в дополнительной рекламе. Механические «противоугонки» можно с успехом применять как в сочетании с электронными противоугонными системами, так и по отдельности. Для преодоления преграды, каковой является блокиратор рулевого вала,

Стеклоподъемники с электрическим приводом — одна из любимых опций тюнингистов. Сегодня «электростеклами» уже никого не удивишь, некоторые модификации «самар» комплектуются ими даже на конвейере. Но все же чаще в руки потребителей попадают автомобили с ручными стеклоподъемниками. Между тем в продаже встречаются несколько моделей электростеклоподъемников. Однако все они разные и редко подходят для

На автомобилях семейства «Самара», заводом-изготовителем может быть установлена система блокировки замков дверей. Она одновременно блокирует замки всех дверей при запирании ключом замка левой передней двери, а также при нажатии на кнопку блокировки замка левой передней двери. Таким образом, эта система блокировки представляет собой так называемый «центральный замок», который в заводском исполнении

Ситуацию, когда открыть багажный отсек автомобиля ваз 2113 необходимо при работающем двигателе, представить нетрудно. Например, вы решили загрузить багажник, пока прогревается двигатель. Однако при работе двигателя ключ от замка крышки багажника или двери задка обычно находится на связке вместе с ключом зажигания (а тот «занят», он в замке!), и требуется немалая ловкость пальцев, чтобы снять его со связки.

Система помощи при парковке обнаруживает препятствие при помощи ультразвуковых датчиков и определяет расстояние до возможного препятствия при движении вперед или задним ходом. Системой особенно удобно пользоваться на автомобиле с тонированными стеклами и с кузовом «хэтчбек» при невозможности обзора через стекло двери задка при перевозке в машине крупногабаритного груза. Система помощи при парковке

Для изменения угла наклона пучка света фар в зависимости от загрузки на автомобиле применяется гидрокорректор фар, состоящий из главного цилиндра, закрепленного на панели приборов, и рабочих цилиндров, установленных на корпусах фар и связанных с главным соединительными трубками. Цилиндры и трубки заполнены специальной жидкостью с низкой температурой замерзания и не сообщаются с атмосферой.

На панели приборов автомобиля ВАЗ 2115 предусмотрено специальное гнездо для установки маршрутного компьютера, закрытое заглушкой. Мы решили использовать это место по назначению. Маршрутный или, как его еще называют, бортовой или маршрутно-диагностический компьютер представляет собой электронное устройство, позволяющее водителю получать информацию о режиме движения автомобиля, расходе топлива,

В продаже имеется широкий выбор головных аудиоустройств. Все они оснащены радиоприемником и отличаются друг от друга типом используемого носителя звукового сигнала (компакт-кассета или компакт-диск), а также наличием возможности подключения дополнительного звуковоспроизводящего оборудования (внешние усилители, фильтры, CD-чейнджеры и т.п.) и характеристиками собственного усилителя. Материалы,

Установку динамиков показываем на автомобиле ВАЗ-2115, так как в автомобилях семейства «Самара» динамики устанавливаются под облицовками панели приборов, и такая работа проста. В автомобилях «Самара-2» передние динамики устанавливаются в окна внутренних панелей передних дверей. Диаметр окон — 130 мм. Для крепления динамика саморезами к внутренней панели двери предусмотрены четыре отверстия. При

Задние динамики устанавливаем на места, предусмотренные производителем автомобиля в правой и левой опорах полки багажника ваз 2114. Диаметр задних динамиков такой же, как и передних — 130 мм. Спинку заднего сиденья для удобства можно снять. Длины проводов, входящих в установочный комплект динамиков, как правило, недостаточно. Поэтому перед установкой необходимо приобрести провода нужной длины. В продаже

Всех уже достали эти противные сверчки. Давайте их лечить в месте. 1) СКРЕЖЕТ СКРИП В РУЛЕВОЙ КОЛОНКЕ! изначально был скрежет-скрип (с железным призвуком), как мне казалось где-то в районе рулевой колонки. Был он как бы в "послесловии" после кочек. Как будто что-то в подвешенном состоянии и появлялся звук после кочки в момент раскачки машины! Как оказалось это трубки металлические тормозные, терлись они о

Первый опыт смены подсветки был еще пол года назад. Смысл был в замене штатных лампочек накаливания, 10-ти мм светодиоды белого свечения; стирание с вставки зеленного светофильтра обычным лезвием и наклеивание синей пленки с обратной стороны. Но после установки сразу увидел что панель освещается не равномерно над лампочками ярко а в других местах тусклее. Такая панель меня раздражала и поездив, решил



Эпигенетическая модуляция иммунных синаптических и цитоскелетных сетей усиливает опосредованную γδ Т-клетками цитотоксичность при раке легких

Резюме

γδ Т-клетки представляют собой отдельную подгруппу Т-клеток, которые связывают врожденную и адаптивную иммунную системы и могут атаковать раковые клетки в MHC -неограниченная манера. Испытания адоптивного переноса γδ Т-клеток в солидных опухолях имели ограниченный успех. Здесь мы показываем, что ингибиторы ДНК-метилтрансферазы (DNMTis) активируют поверхностные молекулы на раковых клетках, связанные с активацией γδ Т-клеток, с использованием количественной поверхностной протеомики.Лечение рака легких человека с помощью DNMTi усиливает лизис опухоли за счет увеличения ex vivo Vδ1-обогащенных γδ Т-клеток. Механически DNMTi усиливает образование иммунных синапсов и опосредует реорганизацию цитоскелета посредством скоординированных изменений метилирования ДНК и доступности хроматина. Генетическое истощение молекул адгезии или фармакологическое ингибирование полимеризации актина отменяет потенцирующий эффект DNMTi. Клинически сигнатура цитоскелета, связанная с DNMTi, прогностически стратифицирует пациентов с раком легких.Эти результаты подтверждают комбинаторную стратегию иммунотерапии на основе DNMTis и γδ Т-лимфоцитов при лечении рака легких.

Тематические термины: Иммунология опухолей, Т-клетки гаммадельта, эпигенетика, рак легких

Введение

Иммунная терапия стала многообещающей стратегией в лечении рака легких. Тем не менее, только небольшая группа пациентов реагирует на текущую терапию блокадой контрольных точек. Следовательно, адоптивный перенос иммунных клеток, нацеленных на опухолевые клетки, стал привлекательной терапевтической возможностью. 1 - 3 .γδ Т-клетки, отдельная подгруппа Т-клеток, которые воспринимают сигналы молекулярного стресса от инфицированных патогеном или трансформированных клеток, могут проявлять широкие возможности нацеливания на опухоль в независимом от главного комплекса гистосовместимости (MHC) образом 4 . Эти клетки предоставляют потенциальные терапевтические возможности для пациентов, которые по своей природе не реагируют на блокировку контрольных точек из-за низкой мутационной нагрузки или имеют приобретенные дефекты вдоль оси TCR-MHC. Однако адаптивный перенос аутологичных или аллогенных γδ Т-клеток в более ранних клинических испытаниях показал ограниченную эффективность 5 - 7 .Таким образом, для достижения максимальной терапевтической эффективности иммунотерапии на основе γδ Т необходимо лучшее понимание опухолевых литических взаимодействий между γδ T и раковыми клетками.

Ингибиторы

ДНК-метилтрансферазы (DNMTis) были одобрены FDA США для лечения гематологических злокачественных новообразований. Тем не менее терапевтическая эффективность этих препаратов, используемых в качестве единственного средства при солидных опухолях, была менее чем удовлетворительной. Неопровержимые доказательства указывают на иммуномодулирующие эффекты DNMTis, которые нацелены на ось MHC и Т-клеточного рецептора (TCR) 8 - 12 .С другой стороны, мало что известно о том, может ли и каким образом DNMTis изменять поверхностные белки раковых клеток для облегчения распознавания без ограничения MHC и лизиса опухоли при клеточной иммунотерапии. Более того, молекулярные характеристики пациентов, которым потенциально может помочь этот вид иммуномодуляции, не определены.

Здесь мы показываем, что DNMT заметно изменяет поверхностный протеом клеток рака легких с использованием мечения стабильных изотопов аминокислотами в количественной протеомике на основе клеточной культуры (SILAC).Эти эксперименты показывают активацию множества молекул иммунного распознавания, не ограниченных MHC, после временного лечения DNMTi в низких дозах. Анализ генной онтологии индуцированного DNMTi поверхностного протеома показывает высокую ассоциацию с активацией γδ Т-клеток. Мы демонстрируем, что обработка DNMTi раковых клеток усиливает образование иммунных синапсов между ex vivo увеличенными аллогенными γδ Т-клетками и раковыми клетками и усиливает противоопухолевый иммунитет посредством γδ T-клеток. Комбинированный полногеномный анализ ДНК-метилома, мРНК-seq и Omni-ATAC-seq выявляет скоординированные эпигенетические регуляторные паттерны иммунных синаптических сетей цитоскелета.Кроме того, ткани первичного рака легкого могут быть стратифицированы по образцам иммунного цитоскелета, указывающим на ответы на γδ T-опосредованную цитотоксичность, что может помочь в выборе пациентов в будущих клинических испытаниях для прецизионной иммунотерапии. Эти данные подтверждают широкую применимость DNMTis в ремоделировании цитоскелета раковых клеток для терапии на основе γδ Т-клеток, не ограниченных MHC.

Результаты

DNMTi активирует поверхностные молекулы, связанные с активацией γδ Т-клеток

Два одобренных FDA DNMTis, децитабин (Dacogen, DAC) и азацитидин (Vidaza, AZA) являются аналогами цитидина, которые включаются в ДНК / РНК и истощают DNMT посредством необратимое связывание ферментов с последующей деградацией протеасом 13 .Было показано, что DNMT модулирует пути, связанные с процессингом / презентацией антигена, человеческими лейкоцитарными антигенами (HLA) и интерфероновыми ответами при различных типах рака на транскриптомном уровне 11 , 12 .

Тем не менее, эти транскриптомные изменения могут не полностью отражать изменения поверхностных белков, которые определяют чувствительность к иммунотерапии. Таким образом, мы стремились получить полный профиль поверхностных белков, измененных децитабином (DAC), путем выделения белков клеточной поверхности из клеток рака легкого человека A549 до и после лечения DAC с использованием метода биотинилирования с использованием EZ-link Sulfo-NHS-SS-биотин. , за которым следует подход количественной протеомики на основе SILAC (рис.) 14 . Мы использовали протокол лечения низкими дозами, установленный в нашем предыдущем исследовании, чтобы продемонстрировать эпигенетические эффекты препарата над цитотоксичностью 15 . Во-первых, клетки рака легких были дифференцированно помечены путем выращивания в среде для культивирования клеток, содержащей тяжелый аргинин (L-аргинин- 13 C 6 ) / лизин (L-лизин- 13 C 6 ,) или нормальный аргинин / лизин. Меченые SILAC клетки (тяжелые) и немеченые клетки (светлые) обрабатывали фосфатно-солевым буфером и 100 нМ DAC, соответственно, в течение трех дней подряд (D3) и выращивали в среде без лекарств еще в течение трех дней (D3R3 ) (Рисунок.). После биотинилирования белков клеточной поверхности общие клеточные лизаты DAC-обработанных клеток в D3 и D3R3 смешивали в соотношении 1: 1 с их соответствующими аналогами, обработанными ложно, и подвергали выделению поверхностных белков с последующей количественной протеомикой. Мы идентифицировали 666 и 831 поверхностных белков, аннотированных онтологией генов (GO) (соответствующих 8791 и 11 898 уникальным пептидам) в клетках A549 в D3 и D3R3, соответственно. (Рис. И дополнительный рис. 1a ). Продолжающееся увеличение идентифицированных поверхностных белков после отмены лекарства согласуется с нашим предыдущим отчетом об эффектах эпигенетической памяти после временного воздействия лекарства 15 .Среди всех идентифицированных белков мы сосредоточились на 314 белках, которые показали устойчивую повышающую регуляцию при лечении DAC, по крайней мере, в 1,4 раза как для D3, так и для D3R3, поскольку их продолжающаяся индукция после отмены препарата предполагала возможную эпигенетическую регуляцию (рис.). Многие из них связаны с иммунитетом. В дополнение к молекулам MHC и определенным белкам иммунных контрольных точек, которые, как ранее было известно, активируются с помощью DAC 11 , 12 , мы обнаружили множество белков, которые участвуют в врожденном иммунитете или иммунитете без ограничений MHC, таких как класс MHC. I, родственные полипептиду последовательности A и B (т.е.е., MICA, MICB), которые являются лигандами NKG2D на γδ T- и NK-клетках (рис.) 16 , 17 . DAC также активирует UL16-связывающие белки 2 и 3 (т.е. ULBP2 и ULBP3), другую группу лигандов NKG2D, которые экспрессируются при многих формах рака и в стрессированных / поврежденных тканях (рис.) 18 - 20 . Эти молекулы были идентифицированы в качестве мишеней для иммунного надзора за опухолями со стороны врожденной иммунной системы и могут вызывать противоопухолевый иммунитет без необходимости в обычной презентации антигена, ограниченной MHC. 21 .Кроме того, два рецептора смерти (например, TRAIL-R1 и TRAIL-R2) для TNF-связанного лиганда, индуцирующего апоптоз (TRAIL), которые индуцируют апоптоз рака в рамках иммунного надзора 22 , были значительно активированы на D3R3 (фиг. .).

Децитабин активирует поверхностные иммунные молекулы, связанные с активацией γδ Т-клеток.

a Экспериментальная диаграмма количественного мечения стабильных изотопов с аминокислотами в культуре клеток (SILAC) на биотинилированных поверхностных белках в псевдообработанных vs.обработанные децитабином (DAC) клетки рака легкого. Электрофорез в полиакриламидном геле с додецилсульфатом натрия в SDS-PAGE, жидкостная хроматография LC-MS / MS-тандемная масс-спектрометрия. b Схема лечения DAC в дозе 100 нМ ежедневно в течение 72 часов (D3) с последующей отменой препарата в течение 3 дней (D3R3). c Диаграмма Венна, показывающая количество поверхностных белков, идентифицированных в D3 и D3R3 в клетках A549. d Диаграмма разброса белков, активированных по D3 и D3R3 в клетках A549 после обработки децитабином. e Тепловая карта, показывающая log2-кратные изменения иммунных поверхностных молекул в DAC-обработанных клетках A549 по сравнению с имитационно обработанными в D3 и D3R3. f Диаграмма Венна, показывающая количество поверхностных белков, обычно идентифицируемых в D3R3 в клетках A549, h2299 и CL1-0. г Гистограммы, показывающие относительное содержание белков выбранных поверхностных белков, связанных с врожденным иммунитетом, в поверхностных протеомах клеток A549, h2299 и CL1-0 после обработки децитабином в D3R3 по сравнению с имитационно обработанными клетками. n = 1 для каждой обработки отдельных клеточных линий. ч. Анализ списка генов PANTHER по иммунным путям для белков, активируемых децитабином в D3R3. Частота ложного обнаружения FDR.

Интересно, что анализ поверхностных сомов на основе SILAC в других двух линиях клеток рака легких человека, h2299 и CL1-0, выявил очень похожие профили DAC-индуцированных поверхностных белков. DAC обычно активирует 431 белок во всех трех клеточных линиях рака легких для D3R3 (рис.и дополнительный рисунок 1b ). Участие DAC-индуцированных поверхностных молекул во врожденном иммунном ответе очевидно, и мы сопоставили эти белки с интерактомами врожденного иммунитета из InnateDB, тщательно контролируемой базы данных путей и взаимодействий врожденного иммунитета 23 . Мы обнаружили DAC-опосредованные молекулы врожденного иммунитета, которые участвуют в адгезии / межклеточных взаимодействиях (например, CD97 и ICAM-1), цитоскелет (например, ARPC2 и VASP), ответы белков теплового шока, интегрин-ассоциированные пути и различные сигналы. трансдукционные сети (рис.). Затем мы выполнили обогащение терминов онтологии генов (GO) с помощью инструментов анализа списка генов PANTHER 24 на DAC-индуцированном поверхностном протеоме для поиска соответствующих иммунных путей. Примечательно, что активация γδ Т-клеток была основным обогащенным путем среди всех связанных с иммунитетом процессов, за которым следует иммунитет, опосредованный естественными клетками-киллерами (NK) - два ключевых типа иммунных клеток, участвующих в врожденных иммунных ответах против рака (рис.) 7 , 25 .

Ex vivo экспансия человеческих Vδ1 γδ Т-клеток с противоопухолевыми функциями

Основываясь на DAC-опосредованных поверхностных данных, мы пришли к выводу, что эпигенетическая терапия может усилить атаку опухоли γδ Т-клетками.Чтобы провести доклинические функциональные исследования с использованием γδ Т-клеток на предмет их терапевтического потенциала, наша группа дополнительно оптимизировала протокол последовательной стимуляции цитокинов в присутствии γδ TCR / CD3-агонистических антител для ex vivo клинической экспансии γδ Т-клеток, предпочтительно обогащенных Vδ1 +. подмножество «Delta One T» (клетки DOT) 26 из периферической крови здоровых доноров. Процесс не требовал стадии начальной очистки γδ Т-клеток и истощения αβ Т-клеток, показанных в предыдущих отчетах 26 - 28 .В течение 21 дня процент от общего количества Т-клеток γδ в популяции клеток CD3 + увеличился с менее чем 10% до более чем 90%, в то время как Vδ1 + Т-клетки составляли примерно 70% всех γδ Т-клеток (рис. И дополнительный рис. . ). Соответственно, мы наблюдали 1571–14245-кратное увеличение Т-клеток Vδ1 (21-й день / 0-й день), но только от 3 до 59-кратное увеличение Vδ2-Т-клеток у других пяти здоровых доноров, используя тот же протокол (дополнительный рис. c ). Чтобы оценить иммунофенотипы увеличенных γδ Т-клеток, мы выполнили одноклеточный анализ PBMC на исходном уровне и после размножения ex vivo с использованием масс-цитометрии с панелью антител, разработанной для характеристики Т-клеток и рецепторов, не ограниченных МНС, связанных с иммунитетом.Мы использовали t-распределенное стохастическое встраивание соседей (t-SNE) для исследования различий и клеточной гетерогенности внутри Т-клеток до и после экспансии ex vivo. Было отмечено преимущественное обогащение субпопуляции Vδ1 + из периферической крови после 14 дней распространения (рис. И дополнительный рис. 3a, b ). Внутри расширенного подмножества Vδ1 + мы наблюдали дифференциальную экспрессию рецепторов, связанных с иммунитетом без ограничения MHC, включая NKG2D, CD226, CD244, NTB, CRACC и NKp30, и уровни экспрессии этих рецепторов сильно коррелировали (рис.). Кроме того, наши ex vivo увеличенные γδ Т-клетки экспрессируют маркеры цитолитической дегрануляции (например, CD107a), а также секретируют противоопухолевые эффекторные цитокины (например, TNF и IFN-γ). С другой стороны, увеличившиеся γδ Т-клетки почти не секретируют проопухолевые или негативные регуляторные цитокины, такие как IL-17A и IL-10, а также они не экспрессируют PD-1, иммунную контрольную точку, связанную с состоянием истощения (рис. Рис. 3б, в ). что исключает опасения, что постоянная стимуляция цитокинов в протоколе экспансии ex vivo приводит к преждевременному истощению γδ Т-клеток.Данные показывают, что увеличенные DOT-подобные клетки (для простоты называемые ниже γδ Т-клетками) находятся на активированной и пролиферативной стадии с противоопухолевым фенотипом, подходящим для потенциальных терапевтических применений.

Децитабин усиливает опосредованный γδ Т-клетками цитолиз клеток рака легкого.

a Столбчатые диаграммы, показывающие процентное соотношение подмножеств γδ Т-клеток в популяции CD3 + из периферической крови здорового донора после размножения ex vivo. Данные представлены как среднее значение ± стандартная ошибка среднего (SEM). n = 3, независимые эксперименты. b Наложение карт tSNE CD3 + Т-клеток из PBMC на исходном уровне и после размножения ex vivo, проанализированных с помощью масс-цитометрии. Каждая точка представляет одну ячейку. Цвет представляет уровень экспрессии указанных маркеров. Красный - высокий, синий - низкий. c Корреляция по Пирсону маркеров, экспрессируемых в ex vivo увеличенных γδ Т-клетках, проанализированных методом массовой цитометрии. d Репрезентативный проточный цитометрический анализ апоптоза аннексина V и пропидия йодида (PI) в линиях клеток рака легких человека при лечении только 100 нМ децитабином (DAC), только γδ Т-клетками или комбинацией DAC / γδ Т-клеток.Отношение эффектора к цели (E: T) составляет 3: 1. Стратегии стробирования показаны на дополнительном рисунке 16 . e Точечные графики, показывающие три биологических повтора (среднее ± SEM) анализов апоптоза, описанных в d . f Анализы апоптоза аннексина V и йодида пропидия в клеточной линии рака легкого, полученной пациентом из злокачественного плеврального выпота, PD # 0899 (среднее ± SEM, n = 3, независимые эксперименты). г Анализы трансвелл-миграции γδ Т-клеток (верхняя камера) в направлении ложных или DAC-обработанных клеток рака легких (нижняя камера).Количество γδ Т-клеток в нижних камерах подсчитывается на поле высокой мощности. Показаны репрезентативные изображения γδ Т-клеток (помеченные Hoechst 33342; зеленые) и клеток рака легких (удерживаемые кальцеином; красные) в нижних камерах. Данные представлены в виде среднего значения ± стандартное отклонение (SD). n = 15 полей большой мощности в трех независимых экспериментах. Масштабная линейка: 100 мкм. Значение p рассчитывается с помощью одностороннего дисперсионного анализа с помощью теста множественного сравнения Тьюки (панели , , e и f ) или двустороннего критерия Манна-Уитни ( g ).

DNMTi усиливает опосредованный γδ Т-клетками цитолиз клеток рака легких

Впоследствии мы исследовали, может ли предварительная обработка низкими дозами DAC усиливать восприимчивость клеток рака легких к атаке γδ-Т-клетками. Во-первых, мы обнаружили, что совместное культивирование in vitro нелеченого рака легкого и γδ Т-клеток при соотношении эффектор-мишень (E: T) 3: 1 вызывало цитолиз только 20–30% клеток рака легкого человека A549 (дополнительный рис. 4a). ). Примечательно, что 72-часовая ежедневная обработка 100 нМ DAC на раковых клетках легких человека (т.е.например, клетки HCC827, h2299 и A549) значительно усиливает гибель клеток рака легких γδ Т-клетками при том же соотношении E: T. С другой стороны, любое лечение само по себе приводило к минимальной или умеренной гибели клеток с использованием анализов апоптоза аннексина V и йодида пропидия (рис.). Мы наблюдали аналогичные потенцирующие эффекты в нескольких других клеточных линиях рака легких, включая h3981, PC9, PC9-IR (устойчивый к Iressa), h257, CL1-0 и CL1-5, а также клетки рака легкого, полученные от пациентов из злокачественной плевры. эффузия, PDC # 0899 (рис.и дополнительный рисунок 4b ). Мы также отслеживали усиливающий эффект DAC на уничтожение γδ Т-клеток с помощью системы измерения импеданса электрических клеток и субстратов (ECIS), биофизического подхода для мониторинга в реальном времени процесса уничтожения γδ Т-клеток. Цитолиз, опосредованный γδ Т-клетками, обычно происходит в течение от 30 минут до нескольких часов. Эффект может быть усилен предварительной обработкой DAC в дозе, которая не вызывает значительной цитотоксичности (дополнительный рисунок 4c ). Примечательно, что этот потенцирующий эффект можно наблюдать при других типах опухолей, таких как клетки рака толстой кишки HCT116 (дополнительный рис. 4d ). С другой стороны, мы не наблюдали значительного увеличения цитотоксичности PBMC от здоровых доноров при комбинированном лечении DAC и ex vivo размноженными γδ Т-клетками; Дополнительный рис. 4e ), который предполагает, что этот эффект потенцирования может сохранить нормальные клетки.

В дополнение к цитотоксическому пути, зависящему от экзоцитоза гранул посредством прямого контакта, активированные γδ Т-клетки могут также вызывать смерть от рака из-за бесконтактной цитотоксичности, секретируя TRAIL, которые взаимодействуют с рецепторами TRAIL и последующим путем апоптоза 29 , 30 .Чтобы оценить значимость секреторного TRAIL-опосредованного апоптоза в потенцирующем эффекте DAC, мы использовали систему трансвелл, которая позволяет диффузию TRAIL, секретируемых γδ Т-клетками, достигать раковых клеток без прямого контакта с клетками. По прошествии 24 часов не наблюдалось значительной гибели раковых клеток (дополнительный рисунок 5 ), что позволяет предположить, что прямой контакт с клетками необходим для DAC-потенцированного уничтожения γδ Т-клеток. Кроме того, мы оценили, усиливает ли DAC хемотаксис γδ Т-клеток, используя трансвеллентную систему сокультивирования, которая позволяет γδ T-клеткам проходить через мембрану, и не было значительной разницы между количеством γδ T-клеток, мигрирующих в легкие, обработанные ложным или DAC. раковые клетки в нижних лунках.Данные свидетельствуют о том, что потенцирующий эффект DAC не зависит от увеличения хемоаттракции γδ Т-клеток раковыми клетками, примированными DAC (рис.).

DNMTi способствует образованию синапсов между раком и γδ Т-клетками

Поскольку эффективный лизис раковых клеток иммунными клетками зависит от функциональных иммунных синапсов для облегчения направленной и скоординированной доставки литических гранул 31 , мы исследовали эффективность иммунных синапсов образование между γδ Т-клетками и раковыми клетками, предварительно обработанными DAC, путем иммунофлуоресцентного окрашивания фосфотирозина (pTyr), маркера иммунных синапсов с активной передачей сигналов 32 .Мы наблюдали гораздо большее количество иммунных синапсов, образованных между γδ T и DAC-обработанными клетками рака легкого h2299, чем обработанными ложно клетками (рис.). В поисках ключевых молекул, участвующих в синаптическом взаимодействии, мы сравнили DAC-индуцированные поверхностные протеомы двух линий клеток рака легкого человека - h2299 и A549, обе из которых показали усиленное уничтожение γδ Т-клеток после обработки DAC. Среди идентифицированных белков молекула межклеточной адгезии 1 (ICAM-1) была сильно активирована в обеих клеточных линиях (рис.). Вестерн-блоттинг подтвердил, что DAC может значительно активировать белки ICAM-1 во многих клеточных линиях рака легкого, а также в клеточной линии рака легкого, полученной от пациента, из злокачественного плеврального выпота, PDC # 062 (рис.). ICAM-1 представляет собой поверхностный гликопротеин и член суперсемейства иммуноглобулинов. Он присутствует в иммунных клетках, эндотелиальных клетках и эпителиальных клетках в виде общей адгезионной молекулы. Мы продемонстрировали, что ICAM-1 локализован в иммунном синапсе рака-γδ Т вместе с другими классическими белками иммунного синапса, включая LFA-1 и линкер для активации Т-клеток (LAT; рис.). Интересно, что нокаут ICAM1 (KO- ICAM1 ) с помощью технологии CRISPR (дополнительный рис. 6a, b ) в клетках рака легкого (т.е. A549, h2299 и CL1-0) в конечном итоге уменьшил потенцирующие эффекты DAC. для уничтожения γδ Т-клеток во всех трех протестированных клеточных линиях (рис.). С другой стороны, сверхэкспрессия ICAM1 (OV- ICAM1 ) в клеточных линиях рака легких с системой Tet-On (дополнительный рисунок 6b ) заметно усиливала опосредованную γδ Т-клетками цитотоксичность в отношении клеток рака легких человека, имитируя эффект предварительной обработки DAC (рис.). Как и ожидалось, обработка DAC нокаутных клеток ICAM1 не способствовала усилению образования иммунных синапсов между раком легкого и γδ Т-клетками (рис.). В совокупности данные предполагают, что ICAM-1-опосредованная адгезия и стабилизация синаптической структуры имеют решающее значение для потенцирующего действия DAC на противоопухолевый иммунитет γδ Т-клеток.

Децитабин способствует образованию иммунных синапсов между раком легких и γδ Т-клетками.

a Иммунофлуоресцентная визуализация иммунных синапсов между раком легкого h2299 и γδ Т-клетками путем окрашивания фосфотирозином (pTyr).Количественные оценки иммунных синапсов на раковые клетки на восьми произвольно выбранных полях с высоким увеличением для каждого лечения показаны на точечных графиках (среднее значение ± стандартное отклонение). Масштабная линейка: 100 мкм. DAPI: 4 ', 6-диамидино-2-фенилиндол. b Диаграмма рассеяния индуцированных децитабином (DAC) поверхностных протеомов в клетках h2299 и A549 в D3R3. c Репрезентативный вестерн-блоттинг экспрессии ICAM-1 в клетках рака легкого человека, обработанных ложным по сравнению с DAC. β-актин: контроль нагрузки. Было проведено два независимых эксперимента. d Иммунофлуоресцентное окрашивание ICAM-1 в иммунных синапсах между γδ T и DAC-обработанными клетками рака легкого h2299. Масштабная линейка: 10 мкм. e Анализы апоптоза клеток рака легкого h2299 с CRISPR-нокаутом ICAM1 (KO- ICAM1 ), подвергнутых уничтожению γδ Т-клеток в течение 2 часов. Клетки рака легкого обрабатывают ложными, только DAC, только γδ Т-клетками или комбинацией DAC и γδ Т-клеток. f Гистограммы, показывающие гибель клеток трех клеточных линий рака легкого человека (KO- ICAM1 ), подвергнутых уничтожению γδ Т-клеток в течение 2 часов.Данные были суммированы для двух независимых клонов с нокаутом для каждой клеточной линии (среднее значение ± стандартная ошибка среднего). г Анализы апоптоза клеток рака легкого h2299 с системой экспрессии Tet-on ICAM1 (OV- ICAM1 ) при уничтожении γδ Т-клеток в течение 2 часов. ч Столбчатые диаграммы, показывающие гибель клеток линий рака легких человека со сверхэкспрессией ICAM1 , при условии уничтожения γδ Т-клеток в течение 2 часов. Данные были суммированы для двух независимых клонов со сверхэкспрессией для каждой клеточной линии (среднее значение ± стандартная ошибка среднего). i Иммунофлуоресцентная визуализация иммунных синапсов между клетками h2299 KO- ICAM1 и γδ Т-клетками. Масштабная линейка: 100 мкм. Количественные оценки иммунных синапсов на раковые клетки на шести случайно выбранных полях с высоким увеличением для каждого лечения показаны на точечных графиках (среднее значение ± стандартное отклонение). Значение p вычисляется с помощью двустороннего критерия Манна – Уитни ( a , i ) или одностороннего теста ANOVA ( f , h ). Стратегии стробирования для панелей e и g показаны на дополнительном рис. 16 .

В то время как клетки Vδ1 являются основной клеточной субпопуляцией в расширенных ex vivo γδ Т-клетках, клеточные препараты могут содержать минорные подмножества клеток Vδ2 и CD8 Т-клеток (рис. И дополнительный рис. 2 ). Чтобы дополнительно проанализировать потенциальный вклад каждой клеточной субпопуляции в формирование иммунных синапсов и литическую активность опухоли, мы выделили отдельные клеточные субпопуляции (например, Vδ1, Vδ2 и CD8 Т-клетки) с помощью сортировки клеток с активацией флуоресценции (FACS) для проведения экспериментов по совместному культивированию. с клетками рака легкого h2299.Примечательно, что клетки Vδ1 экспрессировали более высокие уровни CD107a и проявляли более сильную цитолитическую способность, чем Vδ2 или CD8 Т-клетки (дополнительный рисунок 7a, b ). Мы также наблюдали большее количество иммунных синапсов, образованных между раковыми клетками и клетками Vδ1, чем Vδ2 или CD8 T-клетки (дополнительный рис. 7c ). Данные показывают, что клетки Vδ1, вероятно, были основным игроком в противоопухолевых ответах, опосредованных γδ Т-клетками, поскольку они доминировали по количеству клеток, а также по функциональным возможностям. Соответственно, стоит отметить, что предполагаемые лиганды для γδ TCR на клетках, отличных от Vδ1 (например,g., Vδ2 клетки), включая BTN2A1 33 , 34 , BTN3A 35 и другие 36 , не всегда активируются DAC во всех линиях раковых клеток из нашей поверхностной протеомики. исследование (дополнительный рис. 8a ), а также BTNL3 37 , лиганд для Vγ4Vδ1 TCRs. Таким образом, в данном контексте такие лиганды могут не иметь существенного значения для цитолитической активности Т-лимфоцитов.

Кроме того, мы выполнили анализы блокирования γδ TCR и NKG2D, чтобы определить, может ли DAC-опосредованная активация ICAM-1 преобладать над обычными механизмами распознавания опухоли через γδ TCR или NKG2D на границе между γδ T-клетками и клетками рака легкого, предварительно обработанными DAC.Примечательно, что блокирование NKG2D ослабляет γδ T-опосредованный цитолиз клеток рака легкого, предварительно обработанных DAC (дополнительный рис. 8b ), что предполагает, что ось рецептор-лиганд NKG2D также важна для иммунного распознавания γδ T-клетками и индукции ICAM-1 от DNMTi дополнительно усиливает межклеточное взаимодействие, необходимое для успешного лизиса опухоли.

DNMTi стабилизирует синаптические щели путем перестройки цитоскелета

По мере того, как мы далее расшифровывали, как DAC влияет на синаптическую структуру, вызывая цитотоксичность, не ограниченную MHC, мы наблюдали заметное накопление нитевидного актина (F-актина) на мембране раковой клетки вблизи области иммунных синапсов (рис.). Когда мы нокаутировали ICAM1 в клетках рака легкого h2299, наблюдалось существенное снижение DAC-индуцированного накопления F-актина в иммунных синапсах (рис. И дополнительный рис. 9a ), что было связано со значительным снижением синаптических ширина расщелины (рис.). Напротив, клетки рака легкого, обработанные DAC, с нормальной экспрессией ICAM-1 создали иммунные синапсы с заметной синаптической щелью между раком и γδ Т-клетками (рис.). Примечательно, что фармакологическое нарушение полимеризации актина цитохалазином B (Cyto B) устраняет DAC-индуцированную кластеризацию F-актина и передачу сигналов pTyr в иммунных синапсах, но, по-видимому, оказывает минимальное влияние на экспрессию ICAM-1 (рис.и дополнительный рисунок 9b ). Кроме того, цитохалазин B также уменьшал эффекты DAC на ширину синаптической щели (дополнительный рисунок 9c, d ). Кроме того, цитохалазин B значительно противодействовал усиливающему эффекту DAC на формирование иммунных синапсов (рис.). Поскольку накопление F-актина и большие размеры синаптических щелей являются характеристиками активации, а не подавления иммунных синапсов 38 , наши данные предполагают, что DAC ремоделирует актиновый цитоскелет для облегчения образования активирующих иммунных синапсов между раком и γδ Т-клетками. .

Децитабин стабилизирует иммунную синаптическую щель, укрепляя актиновый цитоскелет.

a Иммунофлуоресцентное окрашивание F-актина (красный), ICAM-1 (зеленый), pTyr (фосфотирозин, белый) в иммунных синапсах между γδ Т-клетками и клетками рака легких h2299, предварительно обработанными DAC, в D3R3. DAPI: 4 ', 6-диамидино-2-фенилиндол. Масштабная линейка: 10 мкм. Было проведено три независимых эксперимента. b Иммунофлуоресцентные изображения границ раздела между γδ Т-клетками и клетками рака легкого h2299 (родительские vs. ICAM1 нокаут (КО- ICAM1 )). Сигналы F-актина (красный) на периферии раковых клеток h2299 показаны на нижних панелях на двумерных (2.5D) изображениях. Масштабная линейка: 10 мкм. Было проведено три независимых эксперимента. c Точечные графики интенсивности сигналов F-актина и ICAM-1 от пяти pTry-положительных иммунных синапсов между γδ Т-клетками и клетками рака легкого h2299 (родительскими или KO- ICAM1 ) из трех независимых экспериментов (среднее ± стандартное отклонение) . d Иммунофлуоресцентные изображения иммунных синапсов между γδ Т-клетками (отмечены T) и клетками рака легкого h2299 (отмечены C), окрашенными на ICAM-1, F-актин и pTyr. Было проведено три независимых эксперимента. e Точечные графики интенсивности сигнала F-актина в иммунных синапсах между γδ Т-клетками и клетками h2299. Клетки h2299 предварительно обрабатывают PBS (Mock), только DAC или комбинацией предварительной обработки DAC (D3R3) и 1 мкг / мл Cyto B (цитохалазин B) в течение 1,5 ч перед совместным культивированием с γδ Т-клетками (среднее значение ± стандартное отклонение). n = 13–20 иммунных синапсов в трех независимых экспериментах. f Иммунофлуоресцентные изображения иммунных синапсов между клетками γδ T и h2299, предварительно обработанными PBS (Mock), только DAC и комбинацией DAC и Cyto B. Увеличенные изображения квадратных областей для каждой обработки показаны на нижних панелях. Стрелки обозначают иммунные синапсы между клетками γδ T и h2299. Шкала: 100 мкм (верхняя) и 20 мкм (нижняя панели). Было проведено два независимых эксперимента. г Точечные графики, показывающие количество иммунных синапсов на раковую клетку на восьми произвольно выбранных полях с высоким увеличением для клеток h2299, предварительно обработанных PBS (Mock), DAC и комбинацией DAC и Cyto B (среднее ± стандартное отклонение).Значение p вычисляется с помощью двустороннего дисперсионного анализа ( c ) или одностороннего дисперсионного анализа с помощью теста множественных сравнений Тьюки ( e , g ).

Истощение DNMTs индуцирует γδ T-чувствительные паттерны генов цитоскелета

Правильная динамика и расположение цитоскелета в иммунных клетках имеют решающее значение для удовлетворительных иммунных ответов. Тем не менее, паттерны экспрессии цитоскелета на стороне раковых клеток иммунного синапса, их регуляция и связанные с ними функциональные последствия остаются не совсем понятными.В свете наших наблюдений за DAC-индуцированной реорганизацией актинового цитоскелета (Fig.), Мы предполагаем, что может иметь место скоординированная регуляция связанных с иммунитетом генных сетей цитоскелета путем нарушения DNMTs. Действительно, полногеномные данные mRNA-seq пяти клеточных линий рака легких (то есть A549, CL1-0, CL1-5, PC9 и h2299) после обработки DAC показали значительную индукцию генов / ферментов, участвующих в динамике и реорганизации цитоскелета , в том числе CORO1A 39 , HCLS1 40 , FES 41 и другие (рис.). Анализ обогащения набора генов (GSEA) также выявил поразительное обогащение наборов генов, связанных с реорганизацией актинового цитоскелета, а также с процессами на основе промежуточных филаментов. Напротив, наборы генов, относящиеся к микротрубочкам, по-видимому, подавлены (рис.). Аналогичным образом, генетическое истощение DNMT воспроизводит аналогичные профили экспрессии генов цитоскелета, поскольку мы проанализировали транскриптомные данные клеточных линий рака толстой кишки (например, HCT116 и DLD1), на которые нацелена shRNA DNMT s 42 (рис.). Таким образом, данные указывают на то, что конкретный паттерн ремоделирования цитоскелета зависит от DNMT.

Истощение DNMT индуцирует экспрессию γδ T-чувствительного гена цитоскелета в раковых клетках.

a График вулкана, показывающий дифференциально экспрессируемые гены в клетках рака легких человека, обработанных DAC, и обработанных ложным способом (т.е. A549, CL1-0, CL1-5, PC9 и h2299). Ось Y обозначает статистическую значимость (-log10 значения p ), а ось x отображает значения log2-кратного изменения между группами, получавшими DAC, и группами, получавшими фиктивную обработку.Гены, относящиеся к актиновому цитоскелету, промежуточным филаментам, микротрубочкам, отмечены красным, синим и зеленым цветом соответственно. b Анализ обогащения набора генов (GSEA) данных мРНК-seq в пяти линиях клеток рака легкого, обработанных DAC - A549, CL1-0, CL1-5, PC9 и h2299. Показаны наборы генов, относящиеся к реорганизации актина-цитоскелета, процессу на основе промежуточных филаментов и генным модулям, связанным с микротрубочками. Нормализованная оценка обогащения NES, генная онтология GO. c Тепловая карта, показывающая экспрессию мРНК основных обогащающих генов актинового цитоскелета, промежуточных филаментов и связанных с микротрубочками процессов в DAC-обработанных и ложно обработанных клетках рака легкого человека, измеренная с помощью mRNA-seq.Фрагментов FPKM на килобаз транскрипта на миллион отображенных считываний. d Анализ обогащения набора генов (GSEA) данных мРНК-seq в линиях клеток колоректального рака человека HCT116 и DLD1, подвергнутых нокдауну shRNA ДНК-метилтрансферазы 1 (DNMT1). Показаны наборы генов, относящиеся к реорганизации актина-цитоскелета, процессу на основе промежуточных филаментов и генным модулям, связанным с микротрубочками. Нормализованная оценка обогащения NES. e Коробчатые диаграммы, показывающие статус метилирования промотора генов в генных модулях актинового цитоскелета, промежуточных филаментов и микротрубочек в клетках рака легких человека, обработанных 100 нМ DAC в течение трех дней с последующим 3-дневным культивированием без лекарств (D3R3).Поле обозначает 25-й процентиль, медианное значение и 75-й процентиль. Усы указывают минимальное и максимальное значения. Данные по метилированию анализируются с помощью массивов Infinium MethylationEPIC. n = 1 для каждой обработки отдельных клеточных линий. M обработано имитацией, D обработано DAC. f Относительная доступность хроматина вокруг TSS генов (от -3 до +3 т.п.н.) в реорганизации актин-цитоскелет, процессах на основе промежуточных филаментов и связанных с микротрубочками модулях в линиях клеток рака легких, обработанных DAC, по сравнению с имитацией обработанных.Сайт начала транскрипции TSS.

Более того, эпигенетическая регуляция этих генов цитоскелета после лечения DAC, по-видимому, является высоко скоординированным процессом. Когда мы исследовали статус метилирования промоторной ДНК генов в трех модулях цитоскелета - актиновом цитоскелете, промежуточных филаментах и ​​микротрубочках - в клетках рака легких человека с помощью чипов Infinium MethylationEPIC BeadChips, мы обнаружили, что гены в модуле актина имеют более высокое метилирование промоторной ДНК. на исходном уровне и стал деметилированным при лечении DAC.Напротив, гены в модуле микротрубочек имели тенденцию иметь низкие базовые уровни метилирования, которые были минимально изменены DAC (рис.). Мы выполнили Omni-ATAC-seq 43 , чтобы исследовать, как доступность хроматина участвует в регуляции транскрипции DAC модулей цитоскелета. Как правило, гены с высокими уровнями метилирования промоторной ДНК на исходном уровне имели тенденцию иметь недоступный хроматин, который приобрел скромную, но критическую доступность после обработки DAC. Интересно, что гены с низким метилированием ДНК базального промотора, которые активируются DAC, имеют предварительно доступный хроматин в TSS, который остается доступным после обработки DAC (дополнительный рис. 10 ). Когда мы тщательно исследовали паттерны хроматина в генах, связанных с цитоскелетом, мы наблюдали умеренные изменения хроматина в промоторах генов в актиновых или связанных с промежуточными филаментами процессах (Рис.). Напротив, наблюдалось заметное снижение доступности промоторного хроматина в генах, связанных с микротрубочками, подавляемых с помощью DAC (рис.). Скоординированные регуляторные паттерны могут быть проиллюстрированы отдельными генами в каждом из цитоскелетных модулей - EVPLL , TUBE1 и DAPK3 (дополнительный рис. 11 ).

TP53 является центром для синаптического цитоскелета и эпигенетических белков

Для дальнейшего выяснения взаимосвязей между эпигенетическими белками и иммунным синаптическим цитоскелетом мы провели анализ генной сети транскриптомов DAC в клеточных линиях рака легких с помощью анализа пути изобретательности (IPA), которые выявили тесную взаимосвязь между иммунными синаптическими молекулами, цитоскелетом и эпигенетическими белками (дополнительный рис. 12a ). Как показано в сети, мы обнаружили общее подавление генов, участвующих в организации микротрубочек (т.е.е., TUBG1 , DCTN1 и PLK1 ). Напротив, гены, участвующие в динамике актина и промежуточных филаментов (т.е. CORO1A , GFAP и DES ), были активированы. ICAM1 связывает поверхностные иммунные рецепторы / молекулы HLA с цитоскелетом в цитоплазме, который связывается с TP53 и другими эпигенетическими модификаторами (например, DNMT s, HDAC s и SMARCA4 ) в ядре (Supplementary). Инжир. 12а ). Дальнейший анализ вышестоящих регуляторов показал, что эффекторные цитокины Т-клеток, такие как IFNG и TNF , могут усиливать DAC-индуцированный паттерн экспрессии иммунных поверхностных молекул, включая ICAM1 , ICOSLG и HLA s (дополнительный Рис. 12b ). Кроме того, TP53 , по-видимому, является геном-концентратором, опосредующим скоординированные изменения молекул иммунной поверхности и цитоскелета в ответ на эпигенетические модификации, что означает, что функциональная сеть TP53 необходима для эффективного иммунного потенцирующего действия DAC (дополнительный рис. 12c ).

DNMTi модулирует функциональные подмножества γδ Т-клеток

Чтобы оценить, как DAC может одновременно влиять на γδ Т-клетки, как это происходит в клинических сценариях, мы использовали массовую цитометрию для профилирования фенотипических и функциональных иммунных параметров расширенных γδ Т-клеток с или без Лечение DAC. Данные из обеих групп клеток были сгруппированы вместе с помощью алгоритма x-сдвига, и была рассчитана частота каждой субпопуляции в необработанных и обработанных DAC расширенных γδ Т-клетках.Как показано на дополнительном рисунке 13a , было выявлено четырнадцать кластеров внутри CD3 + Т-клеток (обозначенных T1-T14, ранжированных по разнице частот между необработанными и обработанными DAC группами), каждый из которых имеет различные фенотипические и функциональные эффекторные сигнатуры. Важно отметить, что два верхних кластера клеток, индуцированные обработкой DAC, соответствуют Vδ1 и экспрессируют более высокие уровни CD226, CD244, CD2 и CRACC вместе с более сильными функциональными эффекторами, включая CD107A, TNF, гранзим B, IL-2 и IFN-γ, чем экспрессируемые кластерами, частота клеток уменьшилась после обработки DAC (дополнительная фигура 13b ).Результат был подтвержден Т-клетками Vδ1, размноженными еще у пяти здоровых людей, получавших 10 нМ DAC. Мы наблюдали тенденцию к увеличению продукции эффекторных противоопухолевых цитокинов, таких как IFN-γ и TNF (дополнительная фигура 13c ). Более того, после лечения DAC наблюдалось заметное увеличение процента полифункциональных клеток Vδ1 +, коэкспрессирующих два или более эффекторных цитокина, у трех из пяти индивидуумов (доноры №1, №3 и №5; дополнительный рисунок 13d ). .Поскольку полифункциональные Т-клетки часто считаются отличительным признаком защитного иммунитета 44 - 46 , данные о том, что DAC увеличивает полифункциональность γδ Т-клеток, еще больше усиливают обоснованность комбинированной терапии с использованием DAC и адоптивного переноса γδ Т-клеток.

Комбинированное лечение DNMTi и γδ Т-клеток продлевает выживаемость у мышей

Впоследствии мы исследовали in vivo эффекты комбинированной терапии с DAC (внутрибрюшинная инъекция) с последующим адоптивным переносом ex vivo увеличенных человеческих γδ Т-клеток (внутривенная инъекция) в NSG с ослабленным иммунитетом (NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ) мышей, несущих ксенотрансплантаты рака легких человека h2299 (рис.). У мышей в группе комбинированной терапии были меньшие опухоли и значительно лучшая общая выживаемость, чем у мышей, получавших физиологический раствор или подвергавшихся одному лечению (рис.). Патологически опухолевые ткани в комбинированной группе были не только меньше, но также имели рыхлую структуру и выраженный фиброз. Напротив, опухолевые ткани в контрольной группе оказались гиперклеточными, с участками кровоизлияния и некроза (рис.). Примечательно, что визуализация транспорта γδ Т-клеток in vivo показала повышенную способность самонаведения и значительную внутриопухолевую инфильтрацию γδ Т-клеток в группе мышей, получавших DAC, у мышей NSG, несущих ксенотрансплантаты рака легкого, через несколько часов после внутривенной инъекции γδ Т-клеток, тогда как внутриопухолевая инфильтрация В контрольной группе отмечали γδ Т-лимфоциты (рис.). Эти данные демонстрируют перспективность сочетания DAC с адоптивным переносом γδ Т-клеток при лечении рака легких in vivo.

Децитабин в сочетании с адоптивным переносом γδ Т-клеток продлевает выживаемость мышей с ксенотрансплантатами рака легких.

a Эксперимент in vivo на мышах NOD-scid IL2rg null (NSG), несущих ксенотрансплантаты рака легких человека h2299, обработанных DAC, адоптивным переносом γδ T человека или обоими способами. Для каждого цикла лекарственного лечения DAC вводят внутрибрюшинно в течение трех последовательных дней с последующей внутривенной инъекцией ex vivo увеличенных γδ Т-клеток на 5-й и 12-й день. Мышей умерщвляют через день после инъекции γδ Т-клеток после 3-го цикла введения. лечение. Опухоль была удалена хирургическим путем и измерен вес.Статистический результат был определен с помощью однофакторного дисперсионного анализа с тестом множественного сравнения Тьюки. n = 9 мышей из двух независимых экспериментов (среднее ± SEM). s.c. подкожно. b Показана кривая выживаемости Каплана-Мейера для мышей NSG в каждой группе лечения. Значение p рассчитывается с помощью теста Мантеля-Кокса (односторонний). c Окрашивание репрезентативных опухолей мышей в каждой группе лечения матоксилином и эозином (H&E). Изображение всей опухоли создается с помощью цифрового слайд-сканера. d In vivo визуализация трафика γδ Т-клеток в мышиной модели ксенотрансплантата рака легкого. Размноженные ex vivo γδ Т-клетки предварительно окрашивали долговременным индикатором клеток CYTO-ID Red. Мышам NSG, несущим ксенотрансплантаты рака легкого h2299, вводили DAC (0,2 мг / кг массы тела) или физиологический раствор внутрибрюшинно в течение трех дней подряд (день 1-3) с последующей инъекцией в хвостовую вену предварительно окрашенных γδ Т-клеток на 5 день и день. 12. Изображения были получены через 2 и 4 часа после инъекции γδ T с использованием IVIS Spectrum (Ex570, Em640) на 12 день.Эксперименты проводились в двух экземплярах. Типичные изображения показаны здесь. BF светлое поле, область опухоли белого круга.

Сигнатуры генов цитоскелета предсказывают выживаемость пациентов с раком легких

Правильный отбор пациентов имеет решающее значение для терапевтического успеха при планировании клинических испытаний. Чтобы выяснить, могут ли DAC-индуцированные сигнатуры цитоскелета потенциально стратифицировать пациентов по их общей иммунореактивности и / или в пользу терапии эпигенетически примированных γδ Т-клеток, мы изучили данные РНК-seq из тканей первичного рака легких в госпитале Национального Тайваньского университета и портал TCGA.Неконтролируемая кластеризация тканей первичной аденокарциномы легкого на основе основных генов обогащения из генных модулей, связанных с актином, промежуточными филаментами и микротрубочками (рис.), Позволила выявить три группы: иммуночувствительные, промежуточные иммунные и нечувствительные к иммунитету (рис. .). Соответственно, более высокая экспрессия генов γδ TCR была также обнаружена в опухолевых тканях иммуночувствительных и иммуно-промежуточных групп (дополнительный рисунок 14 ). Для дальнейшего изучения взаимосвязи между сигнатурой цитоскелета и иммунной реактивностью мы выполнили вычислительную деконволюцию транскриптомных данных из тканей рака легкого TCGA с использованием матрицы сигнатур эталонного гена CIBERSORT-LM7, созданной с помощью модифицированного алгоритма CIBERSORT 47 .Мы обнаружили, что, помимо γδ Т-клеток, сигнатуры генов для других типов иммунных клеток, включая CD4 и CD8 Т-клетки, В-клетки, гранулоциты, моноциты и NK-клетки, также были обогащены в иммуночувствительной группе по сравнению с таковыми в иммунной группе. -Промежуточные и иммунно-нечувствительные группы (дополнительный рис. 15 ). Примечательно, что мы наблюдали лучшую общую выживаемость у пациентов с иммунно-чувствительной сигнатурой, соответствующей DAC-индуцированному иммунному ответному паттерну, идентифицированному в клеточных линиях рака легкого (актин и промежуточные модули филаментов активированы, а модуль микротрубочек подавлены; рис.). Напротив, сигнатура, нечувствительная к иммунным клеткам, была связана с наихудшим прогнозом как в когортах NTUH, так и в когортах TCGA (рис.). Эти данные подчеркивают важность эпигенетической реорганизации цитоскелета как клинического индикатора результатов лечения пациентов и могут быть использованы для отбора пациентов, чтобы максимизировать преимущества терапии на основе γδ Т-клеток у пациентов с раком легких.

Стратификация пациентов с раком легких по сигнатуре гена иммунного цитоскелета.

a Тепловые карты сигнатуры гена иммунного цитоскелета, полученные из данных мРНК-seq первичных опухолевых тканей аденокарциномы легкого у пациентов в Национальной больнице Тайваньского университета (NTUH, вверху) и из Атласа генома рака (TCGA, внизу). b Общий анализ выживаемости когорт пациентов с аденокарциномой легких NTUH (верхний) и TCGA (нижний), стратифицированных по сигнатурам генов иммунного цитоскелета, связанных с различной чувствительностью к γδ T. Значение p рассчитывается с помощью теста Мантеля-Кокса (односторонний).

Обсуждение

Ингибиторы ДНК-метилтрансферазы являются универсальными иммуномодуляторами 8 , 48 , помимо их противоопухолевого действия 49 .Эти препараты не только могут повышать иммуногенность раковых клеток 9 , 12 , 50 , 51 , но также, как было показано, модулируют решения о судьбе, дифференцировке и истощении αβ Т-клеток 52 , 53 . Несмотря на предполагаемые потенцирующие эффекты DNMTis на ингибиторы контрольных точек 8 , потребность в опухолях с высокой мутационной нагрузкой для запуска обычных иммунных ответов, управляемых αβ TCR и ограниченных MHC, ограничивает дополнительные терапевтические преимущества этого подхода 54 .С другой стороны, клинический интерес к клеточной иммунотерапии, которая не полагается на MHC-зависимое распознавание рака, растет. 55 , 56 . Используя подход количественной поверхностной протеомики в сочетании с эпигеномным / транскриптомным анализом, мы обнаружили иммуномодулирующий эффект DNMTis для облегчения цитолиза опухоли с помощью терапии на основе γδ Т-клеток без ограничения MHC за счет активации молекул адгезии и реорганизации сетей иммуносинаптического цитоскелета для усиления взаимодействия. между раком и γδ Т-клетками.

γδ Т-клетки представляют собой отдельную подгруппу Т-клеток, которые сочетают в себе адаптивные характеристики и быстрые, врожденные реакции. Два основных подмножества γδ Т-клеток человека, Vδ1 + и Vδ2 +, определены на основе рекомбинации γ- и δ-цепей TCR. Vδ1 + Т-клетки преимущественно расположены в периферических тканях и обладают сильной противораковой способностью без потребности в опсонизирующих антителах, как это делают Vδ2 + Т-клетки 57 - 59 . Тем не менее, клиническое использование Vδ1 + Т-клеток ограничено отсутствием надежного протокола распространения.Вместо этого Vδ2 + Т-клетки, которые можно легко увеличить с помощью амино-бисфосфонатов (например, золедроновой кислоты) или фосфоантигенов, используются в большинстве клинических испытаний с ограниченной клинической эффективностью против солидных опухолей 5 , 6 . Более того, некоторые подмножества γδ T могут обладать функциями опухоли 7 ; поэтому следует соблюдать осторожность в процессе размножения клеток в терапевтических целях. В свете последних достижений в протоколе для генерации DOT-клеток 26 - 28 , наш модифицированный протокол расширения устраняет необходимость в истощении αβ T и обогащает Vδ1 + T-клетки противоопухолевым иммунитетом вместо продуцирующих опухоль IL-17 Подмножества γδ T, которые, как было показано, способствуют прогрессированию опухоли 60 , 61 .Этот протокол распространения клинического уровня для клеток Vδ1 + может способствовать совершенствованию текущей терапии γδ Т-лимфоцитами, а также развитию человеческих γδ T-клеток (CAR-γδ T-клеток) с двойным функционалом, сконструированных с помощью рецепторов химерного антигена (CAR-γδ T-клетки), которые реагируют на оба стресса. сигналы и специфические раковые антигены 62 , 63 .

Примечательно, что мы показываем, что DNMTis может ремоделировать иммунный цитоскелет раковых клеток или активировать общие молекулы адгезии, такие как ICAM-1. Эти структурные компоненты играют важную роль в нормальной физиологии и также присутствуют в нормальных клетках.Тем не менее, мы не наблюдали значительной токсичности или повреждений нормальных тканей in vitro или in vivo. Вероятно, что потенцирующий эффект DNMTi основан на существующей способности γδ Т-клеток распознавать опухоли. И препарат действует, чтобы усилить взаимодействие между γδ T и раковыми клетками после первого контакта. Фактически, мы продемонстрировали, что блокирование NKG2D ослабляет γδ T-опосредованный цитолиз предварительно обработанных DAC клеток рака легкого h2299 (дополнительный рис. 8b ), что предполагает, что традиционные механизмы распознавания опухоли γδ T-клетками, такие как взаимодействия NKG2D / NKG2DL , частично способствуют уничтожению γδ T DAC-обработанных клеток 64 .С другой стороны, эпигенетическая регуляция NKG2DL на раковых клетках не может быть единственным фактором, определяющим потенцирующие эффекты DNMTi. Как показано в наших протеомных данных по различным клеточным линиям рака легких, индуцированная DNMTi повышающая регуляция γδ TCR или лигандов NKG2D происходит в некоторых, но не во всех клеточных линиях, в которых наблюдается потенцирующий эффект DNMTis. Кроме того, каждый подтип γδ TCR, по-видимому, имеет свои собственные специфические целевые лиганды. Маловероятно, что один специфический поверхностный лиганд объясняет общие потенцирующие эффекты DNMTis на γδ T-опосредованное уничтожение.Таким образом, наше открытие DNMTi-опосредованной реорганизации цитоскелета посредством скоординированного эпигенетического процесса обеспечивает недостающее звено для повышения эффективности терапии на основе γδT.

Кроме того, наши данные об иммунных синаптических-цитоскелетных сетях на стороне клетки-мишени иммунного синапса имеют очень важное клиническое значение. Поразительно, что ткани первичного рака легких человека в двух независимых когортах пациентов могут быть четко разделены на основе этой эпигенетической сигнатуры гена цитоскелета.Это означает, что структура цитоскелета является неотъемлемой особенностью раковых клеток и может служить маркером для отбора пациентов, которые, вероятно, будут напрямую отвечать на клеточную иммунотерапию или получить пользу от дополнительного эпигенетического ремоделирования. Таким образом, возможность эпигенетического преобразования иммунорезистентного паттерна цитоскелета в иммуночувствительный паттерн может обеспечить потенциальную терапевтическую стратегию для максимизации клинических преимуществ клеточной иммунотерапии.

Кроме того, наш целостный протеомный подход к характеристике поверхностного иммунома клеток рака легких выявляет сети как врожденных, так и адаптивных иммунных белков, которые могут быть изменены DAC, и проливает свет на многогранный иммуномодулирующий потенциал препарата в сочетании с различными типами иммунотерапии, включая γδ Т- и NK-клетки, в том числе 64 - 67 .Мы также демонстрируем, что DAC может усиливать полифункциональность подтипа Vδ1 для обеспечения противоопухолевого иммунитета. Это открытие отличается от предыдущего сообщения, показывающего, что DAC может активировать ингибирующий рецептор KIR2DL2 / 3 на ex vivo увеличенных Vδ2 T-клетках и ингибировать их пролиферацию и эффекторные функции 68 . Это несоответствие может быть связано с различными подмножествами γδ Т-клеток, условиями размножения или режимами дозирования DAC.

Аналогичным образом, безопасность и эффективность комбинированного лечения DNMTi и ex vivo увеличенных клеток Vδ1 может зависеть от контекста.В частности, несмотря на то, что мы наблюдали небольшую токсичность на нормальных PBMC (дополнительный рисунок 4e ), это открытие не отменяет потенциального нецелевого воздействия на другие нормальные типы клеток или тканей, что следует принимать во внимание при разработке клинических испытаний. Кроме того, хотя мы продемонстрировали потенцирующий эффект DNMTi на γδ T-опосредованный лизис опухоли на модели мыши с ослабленным иммунитетом с небольшим вмешательством других типов иммунных клеток, модель ограничена в повторении сложных взаимодействий между раковыми клетками и интактным иммунным микроокружением.Поскольку ICAM-1 является общей молекулой адгезии и может распознаваться другими подтипами Т-клеток, такими как αβ Т-клетки, возможно, что аналогичный ICAM-1-зависимый механизм может участвовать во взаимодействии между раком и αβ Т-клетками в способом, ограниченным MHC. Это может потенциально повысить эффективность иммунотерапии за счет вовлечения большего количества Т-клеток с цитолитическими функциями. Наблюдаемый нами умеренный эффект потенцирования DAC на CD8 Т-клетки (дополнительный рис. 7 ), вероятно, обусловлен аллореактивным распознаванием.Необходимы дальнейшие исследования роли αβ T и других типов иммунных клеток в терапии γδ T, усиленной DNMTi.

Таким образом, наши результаты указывают на терапевтический потенциал DAC в сочетании с адоптивной иммунотерапией с использованием γδ Т-клеток у пациентов с раком легких, которые не реагируют на ингибиторы контрольных точек или не имеют целевых мутаций / специфических раковых антигенов. В частности, те, у кого опухоли с низкой экспрессией ICAM-1 или неблагоприятные сигнатуры генов цитоскелета, могут извлечь выгоду из эпигенетического репрограммирования для повышения терапевтической эффективности γδ Т-клеток.Это исследование также обеспечивает молекулярную основу для фармакологической модуляции иммунных синаптических-цитоскелетных сетей для достижения эффективного противоопухолевого иммунитета, который может поддерживать тонкий дизайн клинических испытаний и способствовать разработке терапевтических стратегий для лечения рака легких в эпоху точной иммуноонкологии.

Методы

Линии раковых клеток и лекарственное лечение

Клеточные линии рака легких человека, A549, h2299, HCC827, PC-9, PC-9-IR, h3981, h257, h2792, h3170 и линия клеток колоректального рака, HCT116 , были получены из Американской коллекции типовых культур (АТСС).Клеточные линии аденокарциномы легких человека CL1-0 и CL1-5 были любезно предоставлены профессором Пан-Чир Янгом из Медицинского колледжа Национального Тайваньского университета 69 (дополнительная таблица 1 ). Клетки выращивали в среде HyClone PRMI (Sh40027.02, GE Healthcare) с добавлением 10% диализованного GIBCO FBS (26140-079, Life Technologies), 1% l-глутамина (A29168-01, Life Technologies) и 1% пенициллина. стрептомицин (15140-122, Life Technologies). Аутентификация всех клеточных линий, использованных в этом исследовании, была проведена с использованием анализа коротких тандемных повторов (STR).Для экспериментов по лечению лекарственными препаратами клетки культивировали с 100 нМ децитабина (DAC; A3656, Sigma-Aldrich) в течение 3 дней с ежедневной сменой полной среды и пополнением лекарственного средства с последующими 3–4 днями восстановления клеток в среде без децитабина. Чтобы заблокировать влияние DAC на формирование иммунных синапсов посредством реорганизации актинового цитоскелета, клетки, предварительно обработанные DAC (D3R3), обрабатывали 1 мкг / мл цитохалазина B (Cyto B; C6762, Sigma-Aldrich) в течение 1,5 ч перед совместным культивированием с γδ T клетки.

Маркировка SILAC

Для количественного масс-спектрометрического анализа клетки рака легких культивировали по крайней мере для семи удвоений клеток в среде SILAC RPMI (88365, Thermo Fisher Scientific) с добавлением 10% FBS и тяжелых изотопно-меченых аминокислот (l-лизин). 13C6, l-аргинин 13C6; CLM-2247-H-1, CLM-2265-H-1, Cambridge Isotope Laboratories).Клетки, обработанные DAC, выращенные в обычной среде, считались легкими аналогами SILAC.

Биотинилирование и выделение белков клеточной поверхности

Раковые клетки (~ 1,5 × 10 7 клеток) выращивали в 15-сантиметровой культуральной чашке и промывали ледяным PBS (21040 см, Corning) перед маркировкой. Всего 5 мг мембранонепроницаемого сульфосукцинимидил-6- (биотин-амидо) гексаноатного реагента в концентрации 0,3 мг / мл (EZ-link sulfo-NHS-SS-biotin; 21331, Thermo Fisher Scientific) было нанесено на клетки при осторожном встряхивании при 4 ° C в течение 30 мин.Реакцию гасили 20 мМ глицином (G8790, Sigma-Aldrich) в PBS в течение 10 мин. Затем биотинилированные клетки собирали соскабливанием в PBS, содержащем 100 мкМ окисленного глутатиона (G4376, Sigma-Aldrich), чтобы предотвратить восстановление дисульфидного мостика в молекуле-метке. После центрифугирования при 500 × g в течение 3 минут осадок клеток подвергали стадии замораживания-оттаивания и ресуспендировали в буфере для лизиса [2% Nonidet P40 (NP40; 11332473001, Roche), 0,2% SDS (75746, Sigma- Aldrich), 100 мкМ окисленного глутатиона и 1X смесь ингибиторов протеазы Halt (87786, Thermo Fisher Scientific) в PBS)] в течение 30 мин на льду.Затем лизат подвергали ультразвуковой обработке с пятью 15-секундными импульсами и центрифугировали при 14000 × g в течение 5 минут при 4 ° C для удаления нерастворимых материалов. Концентрацию белка в супернатантах определяли с использованием набора реагентов для анализа белков Pierce 660 нм (22660, Thermo Fisher Scientific) с добавлением реагента для совместимости с ионными детергентами (22663, Thermo Fisher Scientific). Биотинилированные белковые экстракты немеченых и меченых SILAC-тяжелых раковых клеток смешивали в соотношении 1: 1 (мас. / Мас.), И смесь подвергали биотин-аффинной очистке.Суспензию Pierce NeutrAvidin-агарозы (29200, Thermo Fisher Scientific) в 200 мкл / мг общих белков кондиционировали тремя промывками в буфере A (1% NP40 и 0,1% SDS в PBS). Связывание биотинилированных белков проводили на вращающемся смесителе при 4 ° C в течение ночи. Затем шарики дважды промывали буфером A, дважды буфером B [0,1% NP40, 10,3 M NaCl (4058-01, JT Baker) в PBS] и дважды буфером C (50 мМ в PBS, pH 7,8). Белки элюировали дважды по 30 минут каждый при 58 ° C 150 мМ дитиотреитолом (DTT; D0632, Sigma-Aldrich), 1% SDS, 50 мМ Tris-HCl в PBS (pH 7.8). Затем к образцу добавляли 150 мМ йодацетамида (IAA; I6125, Sigma-Aldrich) с последующей инкубацией в течение 30 минут при комнатной температуре в темноте для алкилирования восстановленных остатков цистеина в белках. Чтобы сконцентрировать белки и уменьшить количество детергентов в элюате с высоким содержанием мембран, мы очистили элюат с помощью центрифугирования Amicon MWCO-10K (UFC501096, Millipore) с обменным буфером [0,5% SDS в 50 мМ NH 4 HCO 3 (09830, Sigma-Aldrich) водный раствор].Затем образец, оставшийся в обменном буфере, извлекали для последующих анализов 70 .

Расщепление в геле и масс-спектрометрия

Очищенные белки с биотинилированной поверхностью фракционировали с использованием SDS-PAGE с последующим расщеплением трипсином в геле 71 . Трипсинизированные пептиды сушили в вакууме и солюбилизировали в 0,1% трифторуксусной кислоте (TFA; 299537, Sigma-Aldrich). Затем образец обессоливали с помощью C18 Ziptip (ZTC18S960, Millipore) в соответствии с протоколом производителя.Сбор массы пептидов выполняли на системе Ultimate system 3000 nanoLC, подключенной к масс-спектрометру Orbitrap Fusion Lumos, оборудованному источником ионов NanoSpray Flex (Thermo Fisher Scientific). После загрузки пептидов в прибор для ВЭЖХ пептиды концентрировали с помощью обращенно-фазовой ловушки C18 Acclaim PepMap NanoLC длиной 25 см и внутренним диаметром 75 мкм, содержащей частицы C18 размером 2 мкм с размером пор 100 Å ( 164941, Thermo Fisher Scientific). Водный растворитель подвижной фазы A (0.1% муравьиная кислота; 33015, Sigma-Aldrich) и органический растворитель B [0,1% муравьиной кислоты в ацетонитриле (9829, JT Baker)] смешивали для получения линейного градиента от 2% до 40% растворителя B для фракционированного элюирования пептидов. Масс-спектры были получены в результате одного полного сканирования МС с последующим зависимым от данных МС / МС наиболее интенсивных ионов за 3 с. Полное сканирование МС было записано с разрешением 120 000 на м / z 200. Для спектров МС / МС выбранные родительские ионы в пределах окна изоляции 1,4 Да были фрагментированы высокоэнергетической диссоциацией, активируемой столкновением (HCD) с зарядовым статусом. от 2+ до 7+.Продолжительность динамического исключения родительских ионов была установлена ​​на уровне 180 с с подсчетом повторов. Масс-спектры записывали с помощью инструмента Xcalibur версии 4.1 (Thermo Fisher Scientific).

Анализ данных ЖХ-МС / МС и количественный анализ белков на основе SILAC

Полученные файлы Thermo RAW анализировали с помощью MaxQuant v1.6.0.16 72 . Спектры МС / МС искали в поисковой системе пептидов Andromeda по базе данных протеома человека UniProtKB / Swiss-Prot, а также по обратному аналогу в качестве базы данных-приманок.При поиске использовался список распространенных загрязняющих веществ, предоставленный программой MaxQuant. Рассматривались пептиды с минимум шестью аминокислотами и максимум трипсином пропущенных отщеплений. Настройка переменных модификаций включает окисление метионина, N-концевое ацетилирование белка, дезамидирование аспарагина / глутамина и связь EZ на первичных аминах после восстановления сульфгидрила и алкилирования с помощью IAA (EZ-IAA, +145,020 Да) 73 . Карбамидометилцистеин применялся как фиксированная модификация.Исходный родительский пептид и толерантность к массе фрагмента были установлены равными 20 м.д. и 0,5 Да, соответственно. Фильтрация ложной скорости обнаружения (FDR) совпадения пептидного спектра и отнесения белков использовалась при 0,05 и 0,01, соответственно. Наконец, белки, идентифицированные как обратная ловушка, сопоставленные только с одним уникальным пептидом и как обычные загрязнения, были исключены перед дальнейшим анализом.

Клетки рака легких, полученные от пациентов из злокачественных плевральных выпотов

Злокачественные плевральные выпоты от пациентов с раком легких центрифугировали при 1800 × g в течение 5 минут для сбора осадка клеток.Осадки клеток ресуспендировали в 4 мл PBS и подвергали центрифугированию в градиенте плотности с Ficoll-Paque PLUS (17144002, GE Healthcare) в соответствии с инструкциями производителя. Вкратце, ресуспендированные клетки осторожно загружали в 3 мл Ficoll-Paque PLUS в центрифужной пробирке на 15 мл и наслаивали центрифугированием при 1800 × g в течение 20 минут при комнатной температуре. Ядерные клетки, обогащенные на границе раздела, собирали и промывали, по крайней мере, тремя объемами PBS. Затем клетки осаждали центрифугированием при 300 × g в течение 5 мин.Эритроциты (RBC) в клеточном осадке лизировали буфером для лизиса RBC [155 мМ NH 4 Cl (11209, Sigma-Aldrich), 10 мМ KHCO 3 (2940-01, JT Baker) и 0,1 мМ EDTA. (34550, Honeywell Fluka) в деионизированной воде] и выбрасывали после центрифугирования образца при 300 × g в течение 3 мин. Осадок клеток, наконец, дважды промывали PBS и центрифугировали при 300 × g в течение 3 минут. Собранные клетки выращивали в среде DMEM / F-12 (1: 1 по объему; 11330, Thermo Fisher Scientific) с добавлением 5% FBS, 2% пенициллин-стрептомицин, 0.4 мкг / мл гидрокортизона (H088, Sigma-Aldrich), 5 мкг / мл инсулина (I2643, Sigma-Aldrich), 10 нг / мл эпидермального фактора роста (PHG0311L, Invitrogen), 24 мкг / мл аденина (A2786, Sigma-Aldrich). ) и 6 мкМ Y-27632 (ALX-270-333, Enzo Life Sciences). Плавающие лимфоциты в первичной культуре удаляли промыванием PBS перед отделением прикрепленных клеток трипсином-EDTA (25200072, Thermo Fisher Scientific) в концентрации 0,25% в PBS во время каждого пассажа. Удаление фибробластов было достигнуто благодаря их более быстрой адгезии к культуральной чашке, чем опухолевые клетки.Мы перенесли суспензию трипсинизированных клеток в новую чашку для культивирования и дали ей постоять при 37 ° C, пока два типа клеток не были отделены друг от друга. После повторных пересевов чистоту популяции опухолевых клеток подтверждали измерением поверхностной экспрессии ЕрСАМ методом проточной цитометрии 74 .

Выделение и размножение ex vivo γδ Т-клеток

1 × 10 7 Мононуклеарные клетки периферической крови (PBMC), полученные от здоровых доноров, высевали в каждую лунку, покрытую антителом против TCR PAN γ / δ (клон IMMU510), используя 6-луночный культуральный планшет.Культуральная среда содержала Optimizer CTS T-Cell Expansion SFM (A1048501, Thermo Fisher), 15 нг / мл IL-1β (AF-200-01B), 100 нг / мл IL-4 (AF-200-04), 7 нг. / мл IL-21 (AF-200-21) и 70 нг / мл IFN-γ (AF-300-02, Peprotech). Через семь дней среду заменили на среду Optimizer CTS, 5% лизат тромбоцитов человека (PLS1, Compass Biomedical), 70 нг / мл IL-15 (AF-200-15, Peprotech) и 30 нг / мл IFN-γ. . Эти клетки собирали на 21 день для последующих экспериментов, включая исследования цитотоксичности in vitro и эксперименты на животных.Мы соблюдаем все этические нормы. Информированное согласие было получено от отдельных здоровых доноров до включения в исследование. Исследование было одобрено институциональным наблюдательным советом (IRB) Национальной университетской больницы Тайваня.

Иммунофенотипический и функциональный анализ γδ Т-клеток

Ex vivo-размноженные γδ Т-клетки дважды промывали PBS и окрашивали иммунофлуоресцентными антителами, нацеленными на поверхностные маркеры, включая γδTCR Vδ1, γδTCR Vδ2, CD27, CD69, NKG2D, TGF-β1, и CD107a (дополнительная таблица 2 ).Затем γδ Т-клетки фиксировали и повышали проницаемость с использованием раствора Cytofix / Cytoperm (554714, BD Biosciences) в течение 20 минут при 4 ° C для внутриклеточного окрашивания цитокинов, включая IL-2, IL-10, IL-17A, IFN-γ, и TNF (дополнительная таблица 2 ). Окрашивание проводили при 4 ° C в течение 30 мин в темноте. Образцы промывали и фиксировали 100 мкл фиксирующего раствора 1X IOTest3 (A07800, BECKMAN COULTER) на лунку в течение не менее 10 минут при 4 ° C. Затем клетки ресуспендировали в 300 мкл PBS и анализировали с использованием проточной цитометрии BD LSR Fortessa (BD Biosciences).Полученные данные анализировали с помощью программного обеспечения FlowJo (Tree Star). Стратегии стробирования представлены на рисунке или на дополнительном рисунке 16 . Для измерения полифункционального ответа γδ Т-клетки стимулировали 30 нг / мл форбол 12-миристат 13-ацетата (PMA; P1585, Sigma-Aldrich) и 1 мкг / мл иономицина (I9657, Sigma-Aldrich) в присутствии монензина ( 00-4505-51, eBioscience) и брефельдин A (420601, BioLegend) в течение 4 ч при 37 ° C. После стимуляции γδ Т-клетки переносили в 96-луночные планшеты с v-образным дном и окрашивали на поверхностные маркеры и внутриклеточные цитокины, как описано выше.В качестве неактивированного контроля γδ Т-клетки инкубировали только с диметилсульфоксидом (ДМСО; D2650, Sigma-Aldrich), монензином и брефельдином А перед окрашиванием.

Массовая цитометрия единичных клеток

Образцы обрабатывали, как описано с небольшими изменениями 75 . Вкратце, образцы клеток сначала окрашивали на жизнеспособность цисплатином (201064, Fluidigm), а затем фиксировали 1,5% параформальдегидом (15710, Electron Microscopy Sciences) при комнатной температуре в течение 10 минут с последующими двумя промываниями средой для окрашивания клеток (CSM) [PBS содержащий 0.5% бычий сывороточный альбумин (BSA; A3059, Sigma-Aldrich) и 0,02% азид натрия (S2002, Sigma-Aldrich)]. Затем образцы клеток, фиксированные формальдегидом, подвергали предварительной проницаемости палладиевому штрих-кодированию 76 . Образцы со штрих-кодом сначала инкубировали с анти-TCR Vδ 1-FITC в течение 30 минут на льду, один раз промывали CSM, а затем окрашивали металл-конъюгированными антителами против поверхностных маркеров в течение 1 часа. После инкубации образцы промывали один раз CSM, повышали проницаемость с помощью 1x буфера для пермеабилизации eBioscience (00-8333-56, Thermo Fisher Scientific) на льду в течение 10 минут, а затем инкубировали с металл-конъюгированными антителами против внутриклеточных молекул в течение 1 часа.Клетки промывали один раз с помощью 1x буфера для пермеабилизации eBioscience, а затем инкубировали при комнатной температуре в течение 20 мин с иридий-содержащим интеркалятором ДНК (201192 A, Fluidigm) в PBS, содержащем 1,5% параформальдегида. После интеркаляции / фиксации образцы клеток промывали один раз CSM и дважды водой перед измерением на массовом цитометре (Fluidigm). Проведена нормализация чувствительности детектора 77 . После измерения и нормализации индивидуальные файлы были отключены от кода 76 и стробированы в соответствии с дополнительным рис.. Карты viSNE были созданы с использованием программных инструментов, доступных на https://www.cytobank.org/. Для конъюгирования антител антитела в PBS без носителя конъюгировали с металл-хелатными полимерами (дополнительная таблица 3 ) в соответствии с протоколом производителя. Конъюгацию антител к висмуту проводили, как описано ранее 78 .

Анализ данных массовой цитометрии

Для сравнения ex vivo расширенных γδ Т-клеток с обработкой DAC и без нее, по 50000 клеток из каждой группы были случайным образом отобраны образцы и объединены вместе для кластеризации с использованием X -двиг 79 , метод кластеризации на основе плотности.Все маркеры, кроме используемых для стробирования, были выбраны для кластеризации. Кластеры, разделенные расстоянием Махаланобиса <2,0, были объединены. Оптимальный параметр ближайшего соседа, K , был определен как 20 с использованием метода локтя. Уровень экспрессии и частота клеток в каждом кластере были экспортированы и представлены тепловыми картами и круговыми диаграммами с использованием R. Для корреляции между уровнями экспрессии маркеров в CD3 + Т-клетках на исходном уровне и после размножения ex vivo рассчитывались парные коэффициенты корреляции Пирсона.Тепловая карта была сгенерирована и сгруппирована на основе иерархической кластеризации коэффициентов корреляции Пирсона с помощью R.

Анализы цитотоксичности, опосредованной γδ Т-клетками

Раковые клетки были совместно культивированы с γδ Т-клетками при соотношении эффектора к мишени (E: T) 3: 1 при 37 ° C в течение 2 часов. После сокультивирования гибель клеток оценивали с помощью проточного цитометрического анализа с использованием набора для обнаружения апоптоза FITC Annexin V Apoptosis Kit I (556547, BD Biosciences). Кроме того, мы выполнили мониторинг в реальном времени γδ T-опосредованного уничтожения раковых клеток с использованием системы мониторинга Electric Cell-Substrate Impedance Sensing (ECIS) с камерой для культивирования 8W10E + (Applied Biophysics).Раковые клетки, обработанные имитатором или DAC, культивировали в камере при 37 ° C в течение ночи до тех пор, пока раковые клетки полностью не прикрепились к дну лунок. После добавления γδ Т-клеток отделение раковых клеток, указывающее на гибель клеток, регистрировалось в режиме реального времени с использованием многочастотного захвата с помощью программного обеспечения ECIS. Относительную зависимость во время добавления γδ Т-клеток использовали для нормализации между образцами. Для бесконтактных экспериментов по уничтожению раковые клетки высевали в нижние лунки 24-луночной системы Transwell в течение ночи с последующим добавлением γδ Т-клеток в верхние 0.Вставки мембраны с порами 4 мкм, непроницаемые для клеток (353095, Falcon). Совместное культивирование проводили при соотношении Е: Т 10: 1 при 37 ° С в течение ночи. Гибель раковых клеток в нижних лунках оценивали с помощью проточного цитометрического анализа с использованием набора для обнаружения апоптоза FITC Annexin V I.

Анализ хемотаксиса Т-клеток γδ

Раковые клетки культивировали совместно с γδ Т-клетками в системе Transwell с размером пор 3 мкм. мембранная вставка (3415, Falcon), которая позволяет проходить Т-клеткам γδ. Перед сокультивированием раковые и γδ Т-клетки окрашивали витальными красителями, Calcein AM (1755, BioVision) и Hoechst 33342 (h4570, Thermo Fisher Scientific), соответственно.После сокультивирования в течение 2 ч Т-клетки γδ (положительные по Hoechst 33342), которые мигрировали в нижнюю камеру, были визуализированы под флуоресцентным микроскопом и количественно определены с помощью ImageJ.

Иммунофлуоресцентная визуализация иммунных синапсов

Раковые и γδ Т-клетки центрифугировали на покрытых поли-l-лизином покровных стеклах с помощью настольной цитофуги Cyto-Tek при 500 об / мин в течение 5 минут (Sakura Scientific) перед фиксацией льдом. холодный метанол или 4% (мас. / об.) параформальдегид в PBS в течение 10 мин. Фиксированные образцы блокировали в блокирующем растворе, не содержащем детергента [1% нормальной ослиной сыворотки (ab7475, abcam) и 3% BSA в PBS], без повышения проницаемости мембраны детергентами.Затем клетки инкубировали с первичными антителами, разведенными в блокирующем растворе, в течение 1 ч во влажной камере при комнатной температуре и промывали PBS. Мечение флуоресцентных вторичных антител при разведении 1: 200 в PBS проводили в блокирующем буфере в течение 1 ч при комнатной температуре. После отмывки PBS ядра клеток окрашивали Hoechst 33342 или DAPI (62248, Thermo Fisher Scientific) в PBS. Наконец, образцы были промыты PBS и помещены на предметные стекла. Все слайды исследовали под эпифлуоресцентным микроскопом EVOS FLc (Invitrogen), а изображения анализировали с помощью программного обеспечения ImageJ.Для визуализации иммунных синаптических белков клетки визуализировали с помощью конфокального микроскопа высокого разрешения (LSM780, Zeiss) с масляным объективом × 63 и анализировали с помощью конфокального программного обеспечения ZEN (Zeiss). Антитела, использованные в исследовании, перечислены в дополнительной таблице 2 .

Эксперименты со сверхэкспрессией и нокаутом гена CRISPR / Cas9

В экспериментах по сверхэкспрессии был создан доксициклин-индуцибельный вектор сверхэкспрессии ICAM1 путем клонирования полноразмерной кДНК ICAM1 в лентивирусную плазмиду Tet-On (Tet-On) pLVX- 632162, Clontech).Вектор, экспрессирующий ген, и вектор-регулятор (pLVX-Tet-On Advanced) были упакованы с лентивирусными частицами псевдотипа VSV-G в 293 Т-клетках. После котрансфекции двух лентивирусных частиц в клетки рака легкого клетки затем выращивали в селекционной среде, содержащей G418 (10131035, Thermo Fisher Scientific) и пуромицин (A1113803, Thermo Fisher Scientific) в надлежащих концентрациях для удержания обеих плазмид. . В экспериментах с нокаутом редактирование локуса генома ICAM1 на клетках h2299 было достигнуто за счет коэкспрессии белка Cas9 с направляющими РНК (гРНК), направленными на экзон 2 ICAM1 в последовательностях 5'-TCAAAAGTCATCCTGCCCCG -3 'и 5'. - GTGACCAGCCCAAGTTGTTG -3 ′.Линии нулевых клеток ICAM1 были созданы путем клонального размножения из одиночных клеток. Сверхэкспрессия и потеря белка ICAM-1 были подтверждены проточной цитометрией с использованием антитела против ICAM1 (BBA20, R&D Systems). Кроме того, отредактированные паттерны генома в локусе ICAM1 вокруг сайтов нацеливания на gRNA линий, нокаутированных по ICAM1, были подтверждены секвенированием по Сэнгеру после амплификации ПЦР (см. Дополнительную таблицу 4 для пар праймеров ПЦР). Анализ результатов секвенирования локуса генома ICAM1 под редакцией CRISPR / Cas9 выполняется с использованием инструмента множественного выравнивания последовательностей (ClustalO) в программном обеспечении QIAGEN CLC Genomics Workbench (v20.0,2).

Подготовка РНК и анализ мРНК-seq

Общую РНК экстрагировали с помощью набора PureLink RNA Mini Kit в соответствии с инструкциями производителя (12183018A, Invitrogen). Качество РНК оценивали с помощью Bioanalyzer 2100 с набором RNA 6000 Nano LabChip (5067-1511, Agilent Technologies). Библиотеки мРНК-seq получали с использованием набора TruSeq Stranded mRNA Library Prep Kit (RS-122-2101, Illumina) и секвенировали с использованием системы HiSeq 4000. Необработанные чтения были обработаны с обрезкой адаптера и фильтрацией качества с использованием Trimmomatic с настройками по умолчанию 80 .Очищенные считывания были сопоставлены с геномом UCSC hg19 человека с использованием инструмента RSEM с выравнивателем bowtie2 81 , 82 . Картированные чтения были подсчитаны для каждого гена с использованием пакетов R GenomicFeatures (v1.36.4) и GenomicAlignments (v1.20.1) в соответствии с аннотацией GENCODE human GRCh47 (https://www.gencodegenes.org/human/release_25lift37.html) 83 . Наконец, FPKM-нормализация необработанных подсчетов была выполнена с использованием DESeq2 (v1.24.0) 84 .Гистограммы и точечные диаграммы данных RNA-seq были созданы с помощью ggplot2 (v3.2.1). Анализ сетей и вышестоящих регуляторов был проведен с помощью Ingenuity Pathway Analysis (IPA; версия 01-16, Qiagen).

Онтология генов и анализ обогащения набора генов

Поверхностные белки, активированные более чем в 1,4 раза при обработке DAC в количественном протеомном анализе мембран, были подвергнуты анализу онтологии генов (GO) с использованием веб-инструмента AmiGO 2, PANTHER (v2.5.12) ), с точным критерием Фишера.Для анализа обогащения набора генов (GSEA) мы использовали данные последовательности мРНК линий раковых клеток с обработкой DAC и без нее, чтобы идентифицировать наборы генов, обогащенные в образцах, обработанных DAC (FDR <0,25 и номинальное значение p <0,05). Связанные с цитоскелетом наборы генов извлекаются из базы данных молекулярных сигнатур (MSigDB, v6.2).

Анализ метилирования ДНК по всему геному

Геномную ДНК раковых клеток экстрагировали с помощью мини-набора QIAamp DNA (51304, QIAGEN) в соответствии с инструкциями производителя.Концентрацию и качество ДНК оценивали с помощью NanoDrop 2000 (Thermo) и электрофореза в 0,8% агарозном геле соответственно. Бисульфитную конверсию 1 мкг геномной ДНК проводили с использованием набора для метилирования ДНК EZ (D5001, Zymo Research). Образцы ДНК, преобразованные бисульфитом, подвергали полногеномному анализу метилирования с использованием чипов Illumina Infinium MethylationEPIC BeadChips. Необработанные данные об интенсивности были получены в виде файлов IDAT и обработаны с использованием пакета R minfi v1.30.0 85 с пакетом аннотаций датчиков для массива Illumina EPIC (IlluminaHumanMethylationEPICanno.ilm10b4.hg19). Данные были нормализованы по квантилю с использованием функции preprocessQuantile minfi. Мы удалили зонды низкого качества с обнаружением P -значение> 0,01, а также зонды, описанные как однонуклеотидные полиморфизмы (SNP), перекрестно-реактивные и генетические варианты 86 , 87 . Наконец, для дальнейшего анализа было использовано 692 476 зондов.

Анализ доступности хроматина по всему геному

Доступность хроматина для клеток рака легкого до и после лечения DAC анализировали с использованием протокола Omni-ATAC 43 с модификациями.После сбора клеток с трипсином / EDTA всего 1 × 10 5 клеток ресуспендировали в 1 мл холодного буфера для ресуспендирования ATAC [ATAC-RSB; 10 мМ трис-HCl pH 7,4, 10 мМ NaCl и 3 мМ MgCl 2 (AM9530G, Thermo Fisher Scientific) в воде] с добавлением 0,1% твин-20 (P2287, Sigma-Aldrich). Клетки центрифугировали при 650 × g в течение 5 минут при 4 ° C для удаления буфера и лизировали в 50 мкл ATAC-RSB, содержащего 0,1% NP40, 0,1% Tween-20 и 0,01% дигитонина (G9441, Promega) на лед в течение 3 мин.Затем лизат промывали 1 мл ATAC-RSB, содержащего 0,1% Tween-20, и супернатант удаляли после центрифугирования при 650 × g в течение 10 минут при 4 ° C для осаждения ядер клеток. Затем ядерную фракцию ресуспендировали в 50 мкл 1: 1 (об. / Об.) Премикса 2X Tagmentation DNA (TD) буфера [20 мМ Трис-HCl, 10 мМ MgCl 2 , 10% диметилформамида (D4551, Sigma- Aldrich), pH 7,6] и буфер для транспозиции [2 мкл адаптеров Illumina, несущих транспозазу Tn5 (FC-121-1030, Illumina), 0.02% дигитонина и 0,2% твин-20 в PBS]. Образец инкубировали при 37 ° C в течение 30 минут на водяной бане и встряхивали каждые 5 минут для облегчения реакции транспозиции. В конце реакции транспонированные фрагменты ДНК собирали и очищали с помощью набора Zymo DNA Clean and Concentrator-5 (D4011, Zymo Research). Библиотеки индексировали и амплифицировали с индексирующими праймерами Illumina i5 / i7 (FC-121-1011, Illumina) с помощью реакции ПЦР для достижения целевой концентрации 4 нМ в 20 мкл. Качество библиотеки проверяли на биоанализаторе Agilent 2100 с набором высокочувствительной ДНК (5067-4626, Agilent Technologies).Образец секвенировали на платформе Illumina HiSeq X Ten с секвенированием парных концов 151 п.н., в среднем 60 миллионов необработанных считываний на образец.

Биоинформатический анализ данных Omni-ATAC-seq

Последовательность адаптера Nextera (5’-CTGTCTCTTATACACATCT-3 ’) была вырезана из необработанных считываний с использованием CutAdapt v2.7 88 . Урезанные чтения каждого образца были сопоставлены с построением эталонного генома человека UCSC hg19 с использованием BWA mem v0.7.17-r1188 89 с параметром -M по умолчанию и максимальной длиной фрагмента 2000.Дублированные чтения ПЦР были помечены с помощью Picard (v2.21.4, http://broadinstitute.github.io/picard/). Дальнейшую качественную фильтрацию выполняли с помощью SAMtools (v1.9, PMC2723002) для удаления несопоставленных считываний, несвязанных спариваний, дублированных считываний ПЦР, неспаренных выравниваний и считываний, сопоставленных с митохондриальной ДНК. Распределение размеров отфильтрованных чтений и частота занятости нуклеосом оценивались с помощью ATACseqQC v1.8.5 90 . Области широких пиков ATAC-seq были вызваны с использованием MACS2 v2.2.5 91 с параметрами: --nomodel --shift -75 --extsize 150 --keep-dup all --broad --broad-cutoff 0.1. Аннотации пиков и расстояние от каждого пика до ближайшего TSS определялись с помощью ChIPseeker v1.20.0 92 . Файлы bam постфильтрации выравнивания считывания из образцов, обработанных имитацией и DAC, были одновременно нормализованы с использованием подхода чтения на геномное содержимое (RPGC) с помощью --effectiveGenomeSize 2827437033, а соотношение log2 DAC / макет на ячейку было сообщено с помощью deepTools v3. .3,1 93 .

Транскриптомные данные тканей первичного рака легкого

Данные об экспрессии генов по всему геному с помощью mRNA-seq были получены из двух когорт аденокарциномы легких, Национальной больницы Тайваньского университета (NTUH) и из базы данных Атласа генома рака (TCGA). Данные NTUH были созданы нашей лабораторией и депонированы в базе данных Gene Expression Omnibus (GEO) с регистрационным номером {"type": "entrez-geo", "attrs": {"text": "GSE120622", "term_id" ":" 120622 "}} GSE120622.Данные нормализованной экспрессии генов (RNASeq2GeneNorm) и клиническая информация из курируемого TCGA аденокарциномы легкого (LUAD) и клиническая информация были получены с использованием пакета R, curatedTCGAData v1.6.0 94 . Тепловые карты уровня экспрессии Z-трансформированных генов выбранных генов NTUH и TCGA-данных мРНК-seq были созданы с использованием пакета R pheatmap (v1.0.12).

Комбинированная терапия DAC и γδ Т-клеток в модели ксенотрансплантата мыши

Шестинедельные самцы мышей NOD.Cg-PrkdcscidIl2rgtm1Wjl / SzJ (NSG) были приобретены в Национальном центре лабораторных животных (Тайвань) и содержались в соответствии со стандартом. состояние, свободное от патогенов.Всех мышей содержали в аккредитованном AAALAC помещении для животных с 12-часовым циклом темнота / свет (с 8:00 до 20:00) при температуре от 20 до 24 ° C и влажности от 50 до 70%. Клетки рака легких h2299 вводили мышам подкожно (1 × 10 7 / мышь). Терапия была начата через семь дней после инъекции. Для каждого двухнедельного цикла лечения мышей с опухолями обрабатывали DAC (0,2 мг / кг массы тела) путем внутрибрюшинной инъекции на 1, 2 и 3 дни. Человеческие γδ Т-клетки (1 × 10 7 / мышь) обрабатывали. внутривенно через хвостовую вену на 5 и 10 дни.За мышами наблюдали один раз в неделю и измеряли размеры опухолей цифровым штангенциркулем. Эксперименты прекращали, когда размер опухоли достигал 20 мм или наблюдалась потеря веса на 20% или более в соответствии с этическим советом учреждения. Регистрировали время выживания отдельных мышей в каждой экспериментальной группе. Выживших мышей на 42 день после инъекции опухоли умерщвляли для получения опухолей для патологического исследования и окрашивания гематоксилином и эозином (H&E). Для визуализации транспорта γδ Т-клеток in vivo, γδ Т-клетки (1 × 10 6 клеток) были предварительно окрашены долговременным индикатором клеток CYTO-ID Red (Enzo Life Sciences, Фармингдейл, Нью-Йорк).Клетки рака легких h2299 вводили мышам NSG подкожно. Через неделю мышей с опухолью обрабатывали DAC (0,2 мг / кг массы тела) путем внутрибрюшинной инъекции в течение 3 дней подряд (дни 1-3) с последующей инъекцией в хвостовую вену предварительно окрашенных γδ Т-клеток (1 × 10 7). / мышь) на 5-й и 12-й день. Изображения были получены через 2 и 4 часа после инъекции γδ T с использованием IVIS Spectrum (Ex570, Em640) на 12-й день. Все эксперименты на мышах были одобрены Медицинским колледжем NTU. Комитет по уходу и использованию (IACUC; Протокол № 20180077) и мы соблюдаем все этические нормы при испытаниях и исследованиях на животных.

Статистический анализ

Статистический анализ проводился с использованием GraphPad Prism 8 и вычислительной среды R. Двусторонние тесты Манна – Уитни или непарные t -тесты использовались для сравнения средних значений между двумя группами, тогда как односторонний дисперсионный анализ ANOVA с множеством Тьюки Сравнения использовались для сравнения средних значений трех или более групп. Общий анализ выживаемости для когорт аденокарциномы легких NTUH и TCGA был выполнен с использованием регрессионной модели Кокса, а также метода Каплана-Мейера.Расчет и построение кривой выживаемости были выполнены с использованием пакетов R выживания (v3.1-8) и Survminer (v0.4.6), соответственно. Тепловые карты уровня экспрессии Z-трансформированного гена данных мРНК-seq были созданы с использованием пакета R pheatmap (v1.0.12). Гистограммы и точечные диаграммы, представляющие ß-значение метилирования и RNA-seq FPKM, были созданы с помощью ggplot2 (v3.2.1). Все программы, использованные в этом исследовании, перечислены в дополнительной таблице 5 .

Произошла ошибка при настройке пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности.Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались.Чтобы принять файлы cookie с этого сайта, используйте кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie.Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в файле cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

Нуклеоцитоплазматический транспорт | SpringerLink

Об этих разбирательствах

Ключевые слова

биохимия биология рак исследование рака клетка ядро ​​ген молекулярная биология

Редакторы и сотрудники

  • Райнер Петерс
  • Майкл Тренделенбург
  1. 1.Институт биофизики им. Макса Планка, Франкфурт 70, Германия
  2. 2. Deutsches KrebsforschungszentrumHeidelberg, Германия

Библиографическая информация

  • Заголовок книги Нуклеоцитоплазматический транспорт
  • Редакторы Райнер Петерс
    Майкл Тренделенбург
  • DOI https: // doi.org / 10.1007 / 978-3-642-71565-5
  • Информация об авторских правах Springer-Verlag Berlin Heidelberg 1986
  • Имя издателя Шпрингер, Берлин, Гейдельберг
  • электронные книги Архив книг Springer
  • ISBN в твердом переплете 978-3-540-17050-1
  • ISBN в мягкой обложке 978-3-642-71567-9
  • электронная книга ISBN 978-3-642-71565-5
  • Номер издания 1
  • Количество страниц Х, 300
  • Количество иллюстраций 0 ч / б иллюстраций, 0 цветных иллюстраций
  • Темы Клеточная биология
    Биохимия, общая
  • Купить эту книгу на сайте издателя

69698938

% PDF-1.4 % 1 0 объект > эндобдж 4 0 obj > поток 2021-06-22T18: 01: 20-07: 002018-08-23T11: 30: 53-07: 002021-06-22T18: 01: 20-07: 00Appligent AppendPDF Pro 5.5uuid: b8dc976a-a96e-11b2-0a00- 782dad000000uuid: 5216121c-1dd2-11b2-0a00-380048aeb0ffapplication / pdf

  • 69698938
  • Администратор
  • Acrobat Distiller 8.1.0 (Windows) AppendPDF Pro 5.5 Ядро Linux 2.6 64-битная 2 октября 2014 Библиотека 10.1.0 конечный поток эндобдж 2 0 obj > эндобдж 3 0 obj > эндобдж 5 0 obj > эндобдж 6 0 obj > эндобдж 13 0 объект > эндобдж 14 0 объект > эндобдж 15 0 объект > эндобдж 16 0 объект > эндобдж 17 0 объект > эндобдж 71 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Type / Page >> эндобдж 72 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Type / Page >> эндобдж 73 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Type / Page >> эндобдж 74 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Type / Page >> эндобдж 75 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Type / Page >> эндобдж 76 0 объект > / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Type / Page >> эндобдж 77 0 объект > / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Type / Page >> эндобдж 78 0 объект > / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Type / Page >> эндобдж 79 0 объект > / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Type / Page >> эндобдж 80 0 объект > / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Type / Page >> эндобдж 323 0 объект [325 0 R 326 0 R] эндобдж 324 0 объект > поток q 1621 0 0 1267 0 0 см / Im0 Do Q BT / T1_0 1 Тс 8 0 0 8 375.12793 763,99994 тм (.) Tj 0 0 1 рг -17.50398 0 Тд (CC-BY-NC-ND 4.0 Международная лицензия) Tj 0 г -0,556 0 Тд (а) Tj -22.20596 1 тд (подтверждено экспертной оценкой \) является автором / спонсором, предоставившим bioRxiv \ бессрочную лицензию на показ препринта. Он доступен u \ nder) Tj 39,74296 1,00001 тд (Правообладатель этого препринта \ (которого не было) Tj -16.45399 0 Тд (эта версия опубликована 23 августа 2018 г.) Tj -0,556 0 Тд (;) Tj 0 0 1 рг -13.56499 0 Тд (https://doi.org/10.1101/399139)Tj 0 г -1.89 0 тд (DOI 🙂 Tj -7.22398 0 Тд (препринт bioRxiv) Tj ET конечный поток эндобдж 205 0 объект > поток

    Влияние материнского Tdap на реакцию младенцев на серию первичной вакцинации цельноклеточной коклюшной вакциной в Сан-Паулу, Бразилия

    Основные моменты

    Высокие уровни антител, полученные от материнского Tdap, могут защитить младенцев до 2 месяцев.

    Снижение анти-PT IgG в возрасте 7 месяцев указывает на возможное притупление иммунного ответа.

    Эпиднадзор за младенцами поможет определить, влияет ли притупление на прививочный иммунитет.

    Реферат

    Предпосылки

    Материнская вакцинация против столбняка, дифтерии и бесклеточного коклюша (Tdap) обеспечивает передачу антител новорожденным и может повлиять на их антителный ответ на серию первичной вакцинации. Это исследование было направлено на оценку влияния вакцинации Tdap во время беременности на реакцию младенцев на первичную серию цельноклеточного коклюша (DTwP).

    Методы

    Плазма у 318 беременных женщин (243 вакцинированных Tdap и 75 невакцинированных) и их младенцев (пуповинная кровь) была собрана при родах; Кровь младенца снова собирали через 2 и 7 месяцев до и после их первичной серии АКДС. Антитела IgG против коклюшного токсина (PT), пертактина (PRN), нитчатого гемагглютинина (FHA), фимбрий 2/3 (FIM) и токсина аденилатциклазы (ACT) количественно определялись с помощью микросферного анализа множественного захвата антител и анти-PT. нейтрализующие антитела с помощью системы анализа клеток в реальном времени.

    Результаты

    Средние геометрические концентрации (GMC) IgG анти-Tdap антигенов были значительно выше (p <0,001) среди вакцинированных Tdap (PT: 57,22 МЕ / мл; PRN: 464,86 МЕ / мл; FHA: 424,0 МЕ / мл) по сравнению с невакцинированной группой (4 МЕ / мл, 15,43 МЕ / мл, 31,99 МЕ / мл, соответственно) при родах. GMC анти-FIM и ACT были одинаковыми в двух группах. В возрасте 2 месяцев GMC анти-PT, PRN и FHA оставались выше (p <0,001) в группе, вакцинированной Tdap (12,64 МЕ / мл; 108.76 МЕ / мл; 87,41 МЕ / мл соответственно), чем невакцинированная группа (1,02 МЕ / мл; 4,46 МЕ / мл; 6,89 МЕ / мл). Однако через 7 месяцев после получения третьей дозы DTwP GMC против PT был выше (p = 0,016) в невакцинированной группе (7,91 МЕ / мл) по сравнению с вакцинированной группой (2,27 МЕ / мл), но без различий. для GMC анти-PRN, FHA, FIM и ACT.

    Заключение

    Повышенные уровни антител предполагают, что вакцинация материнской вакцины Tdap может защитить младенцев до 2-месячного возраста. Снижение уровня анти-PT к 7 месяцам указывает на возможное притупление иммунного ответа у младенцев.Эпиднадзор поможет определить, влияет ли притупление на иммунитет к вакцинам и на профилактику коклюша у младенцев.

    Ключевые слова

    Коклюш

    Материнские антитела

    Tdap

    Вакцинация младенцев

    DTwP

    Тупой

    Рекомендуемые статьиЦитирующие статьи (0)

    © 2021 Авторы. Опубликовано Elsevier Ltd.

    Рекомендуемые статьи

    Цитирующие статьи

    Перейти к основному содержанию Поиск