Стенс ваз 2104: Парень построил стильный проект из ВАЗ-2104 своими руками | Автомания


Парень построил стильный проект из ВАЗ-2104 своими руками | Автомания

Какие у вас ассоциации с ВАЗовской четверкой? Автомобиль для дачника, семьянина или продавца, например, овощей. Автомобиль, про который ниже пойдет речь был куплен в 2001 году, дедушкой автора проекта, когда машина перешла во владение парня, первая его мысль: “Я не семьянин, не дачник, но и не миллионер, чтобы купить себе что-то крутое, возможно 2- местное”. В общем решено было делать из универсала, что-то крутое или стильное, первое требует много денег и не особо вяжется с ВАЗ-2104, а вот стиля добавить можно всегда.

Вот так автомобиль выглядит сейчас, но путь к этому был не прост

Вот так автомобиль выглядит сейчас, но путь к этому был не прост

Первая серьезная доработка коснулась подвески, это естественно пневма, так как планировалось хорошо занижать автомобиль, но ездить на статике это еще то удовольствие, с пневмой же все просто, надо поднялся и проехал лежачий полицейский или ямы, в обычной же ситуации опустился на комфортную высоту и красиво стелешь по городу или стоишь на парковке. Обошлось все в 55 тысяч, стоимость в общем то 4-ки, может даже на инжекторе. Но зато вид теперь совмещен с практичностью. А так как это 4-х контурная система и каждая стойка управляется отдельно, можно даже немного удивлять прохожих.

Следующим этапом был салон, стиль не спорт, поэтому нет спортивных ковшей, каркасов безопасности, а все это часто можно встретить в stance жигулях, зато был найден экспортный бежевый салон от ВАЗ-2104, который был найден в нормальном состояние, но требовал детальной чистки, с чем парни без проблем справились восстановили салон, нашли недостающие подголовники. Руль был найден на Avito за сущие копейки, но нужно было перешивать и центральную железную часть полировать.

Покупались также сиденья от 2103, но все же 4-ые с подголовниками смотрятся в этой машине лучше.

Покупались также сиденья от 2103, но все же 4-ые с подголовниками смотрятся в этой машине лучше.

Карты от экспортных ВАЗ, тоже крайне тяжело искать

Карты от экспортных ВАЗ, тоже крайне тяжело искать

Следующие поиски коснулись фар, на жигули делали интересную оптику в Чехословакии, найти их крайне сложно, но можно, обычно, когда продавец знает, что продает цена на них космос, но они намного лучше тех, что можно купить сейчас и стиля тоже добавляют, хотя половина даже не поймет в чем разница, но все же.

Вот в таком виде был куплен руль

Вот в таком виде был куплен руль

Далее бампера, полностью хром 05-ые бампера, найти кстати тоже не самая простая задача их намного больше было алюминиевых. Также для пущего стиля в багажнике был устелен ламинат, чтобы не стыдно было показывать компрессор и ресивер пневмы.

А вот процесс перегонки автомобиля в гараж после покраски, кузов засиял

А вот процесс перегонки автомобиля в гараж после покраски, кузов засиял

Следующий большой этап — это так называемый “шейвинг подкапотки”, суть в том, чтобы убрать все “лишнее”, работа крайне сложная, если ты хочешь, чтобы автомобилем можно было также пользоваться на повседневной основе. Обычно убирают бочки, акб ну и проводку, тут же убрали тормозные цилиндры, перевернув их в салон, от вакуумного усилителя тормозов пришлось отказаться, тормоза как в копейке, только цилиндр в салоне, также сделали и со сцеплением. Скажете бред, но это же проект, проекты должны быть интересными, а эта работа заслуживает уважения, сделано все крайне качественно и убрано все настолько, что мотор теперь теряется в подкапотном пространстве.

Стоит отметить, что в итоге мотор заменили на редкий ременной 1.5

Стоит отметить, что в итоге мотор заменили на редкий ременной 1.5

Аккуратный проект из ВАЗ-2104, с 4-ками кстати мало проектов, особенно достойных и не колхозных, автору однозначно респект, время и силы были потрачены не зря, да и четверка деда продолжает жить.

Если согласны со мной, ставьте большой палец вверх, а также подписывайтесь на наш канал, чтобы не пропускать новые материалы, всем спасибо за внимание!

В сети появились фотографии деревенского ВАЗ-2104

Что думают пользователи сети о стэнс-проекте на базе ВАЗ-2104, из которого сделали пикап?

Тюнинг «Жигулей» — это дело не сложное, так как массовость классических моделей «АвтоВАЗ» позволила всем автолюбителям «издеваться над ними» как только душе угодно. Дешевые запчасти, простота конструкции и множество известных решений по улучшению технической составляющей сделали из «Классики» самую популярную машину для «колхоза». Но есть ли действительно стильные и красивые экземпляры?

Таковым является этот пикап, который построили на базе ВАЗ-2104. Проект выглядит как дорогой и стильный автомобиль, в который вложили очень много денег. Помимо материальных затрат, чувствуется, что мастер, который делал эту машину вложил много сил, чтобы получилась такая стильная «Жига». Весь автомобиль был продуман до мельчайших деталей и сделан просто и со вкусом.

Техническую составляющую автомобиля, скорее всего не меняли и оставили стоковый мотор. Во времена, когда «Четверка» еще выпускалась, покупатель мог выбрать между 1,5-литровым мотором мощностью 72 лошадиные силы, 1,6-литровым 74-сильным двигателем и 1,7-литровым агрегатом выдающим 79 «лошадок». Сомнительные на сегодняшний день характеристики, но на те времена это было вполне себе неплохо для легкового автомобиля.

Внешне автомобиль скорее освежили и «вдохнули вторую жизнь». Глобальных доработок дизайна кроме грузового отсека нет. Новый цвет кузова, который будет сразу привлекать к себе внимания из-за столь яркого и интересного оттенка, небольшое расширение, чтобы колёса стояли ровно и не выпирали сильно, «губа» и черные бампера делают переднюю часть более агрессивной.

Колесные диски – это самая дорогая часть в этом пикапе, так как их стоимость превышает цену самого автомобиля. Перевернутые фары, сделан с оглядкой на классические японские автомобили и грузовой отсек, пол которого выполнен из дерева. В основном, пользователи сети считают, что это очень симпатичный проект, который сразу привлекает много внимания к себе, а качество выполненной работы вызывает лишь восхищение.

Силовой каркас ваз 2104 чертеж. Описание конструкции

Возможности, которые открываются перед автовладельцем, позволяют преобразить любой автомобиль, сделать его ещё лучше, чем он был прежде. Владельцы отечественных автомобилей также активно интересуются такими возможностями и активно применяют их на практике. Сегодня мы будем рассматривать , разберём возможные варианты, которые можно применить на практике.

Преображение кузова

В процессе тюнингования известной «четвёрки» от ВАЗа наибольшее внимание уделяется изменению кузова. Его дизайн уже давно не считается привлекательным и современным, теперь эта угловатая форма смотрится устаревшей и малопривлекательной. можно в нескольких вариантах, которые отличаются по стоимости и объёму работ:

  1. лёгкий заключается в замене радиаторной решётки, тонировании стёкол, установки дисков на колёса и юбки «Вихур»;
  2. при среднем тюнинге кузова необходимо будет установить альтернативную оптику, заменить обвес, подумать над вероятностью заказа профессиональной аэрографии и шейвинга, который заключается в удалении ручек, замков и молдингов;
  3. глубокий, как несложно догадаться, является самым сложным, дорогим и длительным, поскольку требует изменения конструкции кузова, например, изменение уровня крыши, переделка в купе, установка ламбо-дверей.

Даже лёгкий вариант тюнинга позволит преобразить внешний вид авто. Сверкающий хром на кузове, солидные тонированные стёкла, раритетные или, наоборот, ультрасовременные колпаки на колёсах — и ваш автомобиль уже будет достойно смотреться на дороге.

Изменение кузовной конструкции

А если более серьёзно подойти к преображению отечественной машины и решиться на «усекновение» кузова, то можно получить малогабаритное авто, на котором можно ловко дрифтовать и легко маневрировать. Для получения такого мощного малыша необходимо убрать часть пассажирского отделения и уменьшить длину карданного вала. Надеяться на существенную экономию топлива не стоит, расход уменьшится, но не так существенно, как хотелось бы. Теперь необходимо заняться электропроводкой, переложить тормозные магистрали, всё аккуратно закрыть и перекрасить . Ещё одно кардинальное решение заключается в перемещении запаски на крышку багажника. Но такой дизайн, как говорится, на любителя.

Конструкция кузова может меняться не только в длину, но и в высоту. Обычно занижается высота салона максимум на 15 см. Достичь такого результата можно за счёт обрезания стоек, изменения переднего бампера, а также заднего освещения. Экстерьер в этом случае меняется кардинальным образом. Привыкнуть к таким габаритам автомобиля будет непросто.

Если вам повезло кататься по идеальному асфальту, то можно свой ВАЗ-2104 преобразить в редком стиле Stance. Его суть заключается в установке коротких пружин и дисков небольшого диаметра. Автомобиль с такими изменениями встречается довольно редко, поэтому ваш ВАЗ-2104 может стать уникальным экземпляром. Более популярным видом тюнинга является кузовной лифтинг, который является противоположностью Stance. Такой автомобиль сможет легко преодолевать плохие участки дороги и даже бездорожье.

Спорный момент заключается в необходимости усиления опорных кузовных площадок. Этот момент нельзя назвать обязательным, но всё же лучше если он будет реализован. Хуже от этого точно никому не будет. Установка жёстких пружин, которая предусматривается в процессе тюнинга, требует наличия усиленного металла. Для передней подвески можно выбрать пружины с Волги, а задние амортизаторы забрать у газелевского передка.

Серьёзно нужно подумать над установкой пневмоподушек, которые не позволят кузову раскачиваться, и ход сделает более мягким. Пневмоподушки устанавливаются внутри пружин. Подобный элемент можно добавлять к лифтованному и стандартному кузову, его работа от этого не изменится.


Окрашивание кузова — важный элемент в любом тюнинге. Всё-таки этот параметр больше всего бросается в глаза и способен выделить любой автомобиль. Есть несколько способов решения этой проблемы. Можно пойти стандартным путём и покрыть кузов обычной краской с интересным эффектом (металлик, хамелеон, матовый, глянцевый). Одно из новых решений — жидкая резина. Такое окрашивание не только позволит сделать тюнингованный автомобиль выразительным, но и защитит кузов от внешних воздействий. Аэрография может использоваться не только на дорогих иномарках, но и на моделях отечественного автопрома. Такое окрашивание лучше доверить специалистам, которые обладают большим опытом в этой области и смогут перенести любую фантазию на металл. Аэрография требует соответствия заявленному статусу и если уж вы выбрали такой способ преображения, то неуклюжий багажник на крыше, старые диски или ржавенький прицеп сделают автомобиль нелепым и безвкусным.

Внутренние изменения

Внутри автомобиля потребуется выполнить не меньше работы, чем снаружи. Под мы подразумеваем прокачку двигателя, замены тормозной системы и видоизменения салона. Но обо всём по порядку.

Двигатель и тормоза

Тюнинг отечественных автомобилей воплощается не только во внешних изменениях, но также и во внутренних. Поверьте, под капотом множество деталей нуждаются в реорганизации или полной замене. Главный элемент любого автомобиля — двигатель — в первую очередь подлежит тюнингу. Если в вашем автомобиле стоит родной силовой агрегат, который верой и правдой отработал свой положенный срок, то его лучше отправить на заслуженный отдых, т. е. на металлолом. Всё-таки металл порядком устал, да ещё и физическая изношенность имеет место — эти факторы не позволяют говорить о дальнейшей доработке и форсировании. Вывод один — старый двигатель, который открутил несколько кругов спидометра, подлежит замене, а над более новыми агрегатами можно ещё поработать.

Достойной заменой старому двигателю послужит мощный агрегат, взятый от ВАЗ-21213, его объём будет составлять 1900 см3. Его мощность можно увеличить с 79 до 120 лошадей, но для этого потребуется приложить некоторые усилия и расстаться со своими кровно заработанными. Процесс форсирования заключается в расточке каналов, шлифовке впускного коллектора, установке литых поршней с диаметром 82 мм. Для изменения фазы газораспределения необходимо будет приобрести новый распредвал, с которым будет возможен подъём клапанов до 10,8 мм.

При использовании спортивного коленвала на 88 мм и увеличении уровня подъёма поршней можно увеличить объём силового агрегата и облегчить съём повышенного усилия, которое возникает при сгорании топливно-воздушной смеси.

Установка облегчённого маховика позволит добиться снижения потерей мощности, которая тратится на раскрутку мотора. В результате автомобиль будет за короткое время набирать необходимую скорость.

Выхлоп и система питания также нуждаются в модернизации, которая заключается в установке воздушного фильтра, спортивного выпускного коллектора и прямоточного глушителя.

Осталось модернизировать тормоза, которые отвечают за безопасность водителя, его пассажиров и других участников дорожного движения. Барабанные тормоза, которые имеются на заднем мосту в ВАЗ-2104, сложные в эксплуатации, да ещё и недостаточно эффективные. Их замена обязательна, для этого хорошо подойдут вентилируемые дисковые тормоза на 13 дюймов.

Изменение салона

Эффект от всех внешних изменений, которые произошли с ВАЗ-2104, будет безвозвратно испорчен устаревшим салоном. является не менее важным, чем модернизация двигателя и работа над кузовом. Здесь всё может быть очень просто. Если сидения находятся в хорошем состоянии, но выглядят потрёпанными, можно заменить обивку. При достаточном финансировании для обивки можно выбрать кожаный материал, но любой другой также будет хорошо смотреться. Декор из карбона — отличный способ усилить эффект от тюнинга и придать салону дороговизны.

Любой автомобиль можно восстановить, преобразить и улучшить его прежние характеристики. Особенно это актуально для отечественных моделей, например, ВАЗ-2104, тюнинг своими руками хоть и требует вложения денег и финансов, но результат того стоит.

Автомобиль ВАЗ 2107 уже давно стал легендой отечественного автопрома. Всем знаком его знаменитый кузов классического цвета с простой геометрией. Являясь люкс-версией машины ВАЗ 2105, он выпускался с 1982 года по 2012 в нескольких модификациях, имел различные комплектации, включая кузов пикап.

Что такое кузов

Кузов — это один из самых важных элементов конструкции автомобиля. Его крепят к раме, но бывают также и безрамочные конструкции. Предназначен кузов для размещения в нем пассажиров и груза. Существуют также конструкции, предназначенные для транспортировки лабораторного, медицинского или другого специального оборудования.

В зависимости от устройства, кузовы бывают каркасными, бескаркасными и полукаркасными.

Кузов автомобиля

Кузов машины ВАЗ 2107 представляет собой заднеприводный четырехдверный седан. Схема сборки его каркаса стандартна и имеет следующие элементы:

  • Передние части;
  • Передние крылья с усилителями;
  • Крыши с рамами стекол;
  • Пол с усилителями и панелью задней части;
  • Боковые части;
  • Задние крылья.

Каждый элемент отлит из малоуглеродистой стали. Для каждой детали предусмотрена не только свой номер, схема отливки, но и своя толщина. Например, для крыши 0,9 мм, а для арок задних колес – 1,0 мм.

Большинство деталей соединяется с помощью бесконтактной сварки, но детали, на которые приходится большая нагрузка, дополнительно укреплены дуговой сваркой.

Среди навесных частей стоит выделить:

  1. капот;
  2. двери;
  3. крышку багажника;
  4. бамперы.

Схема подробного устройства машины

Элементы бампера сделаны из пластмассы, прикрепляются кронштейнами, имеют накладки из хрома.

Внутри автомобиля довольно просторно. Передние сиденья имеют регулировку наклона спинки и продольного положения. Заднее сиденье – трехместное.

Все стекла имеют безопасный тип, а продуманное строение автомобиля обеспечит снижение удара при ДТП.

Размеры и характеристики

Вне зависимости от комплектации ВАЗ 2107 имеет следующие размеры:

— длину – 4126,

— ширину – 1620,

— высоту – 1435.

— снаряженную массу (сколько составляет вес авто с оборудованием и материалами) – 1030 кг,

— полную массу (сколько весит снаряженное авто с пассажирами и грузом)– 1430 кг

Автомобилисту необходимо знать не только стандартные параметры своей машины, но еще и контрольные размеры.

Контрольные размеры (точки) обычно необходимы при восстановлении автомобиля после аварии. Если вы покупаете авто с пробегом, зная такие контрольные размеры, вы сможете легко узнать, попадала ли машина в ДТП. Такая геометрия поможет при восстановлении кузова, а также других важных деталей.

Основные контрольные размеры подробно расписывает схема ниже:

Линейные размеры наглядно определяет следующая схема:

Идентификационные данные

Авто ВАЗ 2107, как и любая другая машина, имеет специфические паспортные данные, печень которых указан в таблице, расположенной под капотом на коробке воздухопривода.

В табличке содержатся сведения о модели машины, номер двигателя и номер кузова, данные массы и номер запасных частей. Над ней находится идентификационнный номер авто – VIN.

— Первые 3 буквы отвечают за код завода-изготовителя;

— 6 последующих цифр являются расшифровкой модели авто;

— Буква или цифра латинского алфавита говорят о годе выпуска модели ВАЗ 2107;

— Последние 7 цифр – это и есть искомый номер кузова.

Точно такой же номер вы найдете в багажнике.

Комплектации и модификации

Для покупателей ВАЗ 2107 был доступен в следующих комплектациях:

— в комплектации «стандарт»;

— в комплектации «норма»;

— в комплектации «люкс».

Автомобиль всегда производился в 10 модификациях как для России, так и для зарубежных стран.

Знаменитый пикап

Для тех, кто искал просторный удобный вариант, на базе ВАЗ 2107 была выпущена машина в кузове пикап любого цвета. Он носит название пикап ВИС – 2345, но уже тоже не производится. Но, несмотря на это, пользуется популярностью до сих пор.

Этот малолитражный пикап легок в управлении, предоставляя широкие возможности, чтобы перевозить столько вещей, сколько вам необходимо. В широкую изотермическую будку поместится даже холодильник.

Двухместный пикап имеет инжекторный двигатель. Он развивает скорость до 110 км/ч. Из-за удобства и оригинального дизайна такой тип кузова очень распространен в Америке и Европе – поэтому очень жаль, что производство этой модели было остановлено.

Замена кузова

Автомобиль ВАЗ 2107 в кузовах седан или пикап уже не выпускается несколько лет, но водители до сих пор могут при необходимости приобрести кузовы для своих машин. Если вдруг вы попали в ДТП, либо кузов вашей машины находится в аварийном состоянии, вы с легкостью можете заказать новый.

Схема действий проста. Для начала вам надо будет определиться с необходимой комплектацией, а также какой тип кузова вам необходим.

Одна комплектация подразумевает новый «кузов в сборе», которая включает электроприборы, проводку, стекла, передний и задний бамперы;

Другая же комплектация называется «кузов в металле». В нее входит новый, окрашенный краской нужного цвета кузов, обработанный антикоррозийными препаратами.

Заводом были предусмотрены разнообразные цвета для автомобиля ВАЗ 2107. Каждый из них имеет свое название. Например, бледно-желтый – «дыня», классический красный – «калина», а болотный зеленый – «сочи».

Заказывая кузов в третьей комплектации, вы можете сделать его любого цвета. Возможно, это займет больше времени, чем, если бы вы остановились на простой белой краске. Но автомобиль яркого заметного цвета всегда будет доставлять удовольствие при вождении.

Полка акустическая в Ваз 2104

Акустическая полка Ваз 2104 обязательно нужна, если владелец автомобиля задумывается о нормальном звуке в салоне. Сделать ее можно спокойно и своими руками.
Акустическая полка на Ваз 2104 даст не только возможность слушать хорошую музыку на высоком уровне, но и придаст интерьеру стильный внешний вид.


Акустика в автомобиле и ее установка – это целое искусство, которое надо изучить. Дело в том, что если владелец авто задумал обзавестись только динамиками и хорошей, дорогой магнитолой, да еще и прикупил мощный сабвуфер(см.), этого мало. Кроме того, нужно определиться и с тем, куда монтировать акустики – в штатные места или нет.

Примечание. Как правило, у штатных мест имеются некоторые преимущества. В первую очередь, это нулевая стоимость установки, а во-вторых, сам автомобиль не претерпевает никаких конструктивных изменений.

С другой стороны, если оставить все как есть, ничего толкового из этого не выйдет. Самый прекрасный динамик будет играть неважно, ведь штатные места обычно размещены не в самых правильных местах.
Сабвуфер также не будет играть нормально, если не будет ничего сделано дополнительного.

Штатная задняя полка и ее доработка

На Ваз 2104 есть штатная полка, но она не акустическая. Доработав ее как следует, можно превратить этот элемент в настоящую акустическую полку.

Преимущества доработки


  • Доработка штатной имеет преимущества перед самодельной полкой. В первую очередь, это связано с временем, которое в данном случае уходит в два раза меньше.
  • При доработке не надо будет придумывать конфигурации креплений, так как все будет на готовом.

Что касается недостатков, то главная заключается в том, что в этом случае невозможно проявить никакой дизайнерской мысли.

Важные составляющие проведения доработки


  • В первую очередь, для изготовления такой полки придется найти или приобрести специальный материал, составляющий основу основ. Это фанера, которая в большинстве случаев (как советуют умельцы), должна быть толщиною в 20 мм.

Примечание. Фанера утяжеляет штатную полку и такой метод является не единственным способом доработать полку. Так, можно просто перетянуть штатную полку шумоизоляционным материалом и эффект опять будет, хотя и не такой явный.

Утяжелить заводскую полку можно не только с помощью фанеры, но и с помощью виброматериала. К примеру, это может быть вибропласт либо битопласт или акцент. Такие легко крепятся с помощью фена и твердого валика.

  • Штатная полка в Ваз сделана из материала, схожего с пластиком. Надо в процессе доработки отрезать часть полки, в том месте, где устанавливаются динамики. Используем острый нож.
  • Контур полки, схожий с заводской, вырезаем из фанеры лобзиком и обрабатываем эпоксидкой. Теперь это надо приклеить с обратной стороны.

Совет. Закрепить куски фанеры только клеем неэффективно. Вот одновременное использование саморезов будет тем, что надо.

Примечание. На данном этапе доработки может наблюдаться перепад добавленной фанеры в 2 мм от заводской полки. Чтобы такого не случилось, рекомендуется вырезать кусок фанеры опять же толщиной в 2 мм по контуру и приклеить на штатную.

  • Различные швы и неровности надо будет скрыть. Для этого используем акриловую шпатлевку по дереву, а затем поверхности обрабатываем мелкой наждачной бумагой.
  • Карпет – идеальный материал для перетяжки акустической полки. Его и используем.

Примечание. В ходе такой переделки можно поступить иначе. Фанеру приклеить не снизу штатной, а сверху. Получится то же самое. Как говорится, от перестановки слагаемых сумма не меняется – она остается та же.

Акустическая полка с нуля

  • Саморезы на 41 мм в количестве 10 штук. Они нужны для ребра жесткости, которое на акустической полке должно присутствовать.
  • Степлер строительный со скобами на 8 мм. Они должны быть обязательно калеными, чтобы заходили в дерево.
  • Морилка – уникальная краска, впитываемая деревом. Благодаря морилке, фанера сохраняет свою красивую структуру. Если была бы использована краска, то такого бы не наблюдалось.
  • Электрический лобзик или пила.
  • Две петли, желательно самые качественные и размера среднего.
  • Болгарка с шлифовальным кругом.
  • Скотч малярный.
  • Электрический рубанок.
  • Шуруповерт хорошего качества.
  • Ножницы и канцелярский нож.
  • Карандаш и металлическая линейка.

Алгоритм проведения процесса изготовления самодельной полки

С материалами и инструментами определились. Теперь приступим к изготовлению.


Эти элементы могут быть сделаны самостоятельно, с учетом собственных предпочтений, а могут быть взяты из каких-либо источников готовыми.
Делаем шаблон:

  • Берем кусок плотного картона.
  • Берем карандаш и отмечаем точки, по которым можно будет провести контуры будущей формы.

Примечание. Сегодня у человека с творческим мышлением появляется уникальная возможность использовать различные компьютерные программы, собирающие шаблон в соответствие с индивидуальными предпочтениями.

Хотя сегодня из различных источников можно скачать и готовые шаблоны, которых настолько много, что вряд ли кому не понравится.

Основной этап

С шаблоном определились: он может быть сделан сам или его мы откуда-то скачали, большого значения не имеет.
Пора теперь приступить к самой сложной части работы:

  • Берем лист фанеры и ставим его на ровный стол. Желательно, чтобы это был специальный распилочный стол, на котором можно было бы спокойно заняться вырезанием. На крайний случай, можно воспользоваться козлами, верстаком или табуреткой, в конце концов.
  • Ставим на фанеру шаблон. Выпиливаем полку, делая одновременно отверстия под динамики.

Примечание. В процессе проведения работ, не забываем обработать края под изгибы задних стоек авто и про резинку заднего стекла.

  • Готовим теперь вторую, открывающуюся часть полки. Вырезаем ее с шаблона и прикручиваем к ней ребро жесткости.
  • Берем морилку и покрываем ею все детали. Ждем пока высохнет.
  • Прикручиваем теперь петли.

Примечание. Петли можно сделать и как на фото.

  • Карпет расстилаем на изделии, а затем отмеряем, сколько надо. Не забываем про припуски с каждой стороны. Около 4 см будет вполне достаточно.
  • Материал вырезаем.
  • Наносим клей, а затем равномерно прикладываем карпет на основную и откидную части нашего изделия.
  • Тщательно наносим клей и на углы материалы. Здесь даже рекомендуется обернуть фанеру какой-нибудь грубой, не слишком толстой мешковиной, а уже затем сверху карпет положить. Куски мешковины просто вырезаются по длине сторон фанеры и оклеиваются.
  • Малярный скотч нужен для защиты от измазывания клеем.
  • Берем степлер и прибиваем карпет. Над петлями рекомендуется оставить припуск, чтобы их не было видно снаружи вообще.
  • Устанавливаем готовое изделие в автомобиль.

Описанная выше инструкция дает ценные практические знания. Но этого мало для полного понимания всего процесса.
Поэтому рекомендуется посмотреть также фото и видео – материалы. Цена на такую установку, проведенную своими руками, не будет высокой, ведь потратиться придется только на расходные материалы, такие как фанера, карпет и т.д.

фотография ВАЗ-2104 «Универсал»

ВАЗ 2104 — советский легковой автомобиль с типом кузова универсал, разработанный на заводе ВАЗ. Серийно выпускался с 1984 по 2012 год. Модель разрабатывалась как замена устаревшему универсалу 2102. Некоторое время 2102 и 2104 выпускались на заводе параллельно. При создании новой модели на заводе пошли по пути наименьших затрат и использовали в качестве базовой модели ВАЗ 2105. Все запчасти подверглись максимальной унификации. Для придания жесткости, на крыше новой модели появились выштамповки. В отличие от модели 2102, на «четверку» в базовой комплектации устанавливался обогрев заднего стекла. С середины 1990-х в базовую комплектацию войдет задний стеклоочиститель. Базовая модель получила салон от модели 2105. Грузоподъемность универсала составила 455 кг, что почти вдвое превышает максимальную грузоподъемность 2102. Модель унаследовала конструкцию задней двери от своего предшественника. Её кромка совпадала с уровнем пола, что облегчало погрузку и выгрузку багажа. Заднее сидение складывалось, образуя огромную погрузочную площадку.

фотография багажник ВАЗ-2104

Модификации ВАЗ-2104

Выпускались следующте модели: — 21041, 21043 и 21043-07, отличающиеся моторами 1,2 литра, 1,5 литра и «семерочным» салоном соответственно. В 1994 году ВАЗ-2104 с двигателем рабочим объемом 1,3 л снята с производства. Сегодня базовой моделью стала ВАЗ 21043 с двигателем рабочим объемом 1,5 л и пятиступенчатой механической коробкой передач, что делает AW томобиль ВАЗ 21043 более динамичным и приятным в управлении. Не так давно появилась модификация ВАЗ-21045 с атмосферным (безнадувным) дизелем производства «Барнаултрансмаш», объемом 1,52 литра.

ВАЗ-2104 двигатель ВАЗ-2105, 1,3 литра, карбюратор, с 4-КПП), базовая модель
ВАЗ-21041 двигатель ВАЗ-2101, 1,2 литра, карбюратор с 4-КПП. Серийно не выпускалась.
ВАЗ-21042 двигатель ВАЗ-2103, 1,5 литра, правый руль
ВАЗ-21043 двигатель ВАЗ-2103, 1,5 литра, карбюратор с 4- или 5-КПП, в вариантах с электрооборудованием и салоном от ВАЗ-2107
ВАЗ-21044 двигатель ВАЗ-2107, 1,7 литра, моновпрыск, 5-КПП, экспортная модель
ВАЗ-21045 двигатель ВАЗ-2107, 1,8 литра, моновпрыск, 5-КПП, экспортная модель. Серийно не выпускалась.
ВАЗ-21045Д двигатель ВАЗ-341, 1,5 литра, дизель, 5-КПП
ВАЗ-21047 двигатель ВАЗ-2103, 1,5 литра, карбюратор, 5-КПП, улучшенный вариант с салоном от ВАЗ-2107. Экспортные модификации оснащались решёткой радиатора от ВАЗ-2107.
ВАЗ-21048 двигатель ВАЗ-343, 1,8 литра, дизель, 5-КПП
ВАЗ-21041i двигатель ВАЗ-21067 1,6 литра инжектор, 5-КПП, салон и электрооборудование ВАЗ-2107
Экспортные названия ВАЗ-2104
Lada Riva Великобритания и страны материковой Европы
Lada Nova Германия и страны материковой Европы
Lada 1500 или Lada Signet Канада
Lada Laika Бразилия

фотография ВАЗ-2104 вид сзади

фотография ВАЗ-2104

Дизайн салона и органов управления

В целом дизайн модели ВАЗ-2104 , как и всех классических моделей, аскетичный. Но внутренний салон автомобиля в зависимости от вашего желания может быть разным. Более экономный вариант предполагает стандартную панель с минимально необходимым набором включателей и контрольно — измерительных приборов, обивку салона и сидений со стандартными подголовниками искусственной кожей, резиновые коврики пола. Если Вы желаете большего комфорта, то Вам предлагается улучшенный салон, оригинальное рулевое колесо и панель приборов с дополнительной центральной консолью, которая располагет расширенным набором функциональных клавишей и контрольной аппаратуры. Улучшенный салон — это сидения с обивкой из ворсованного трикотажа (передние с высоко поднятой спинкой), двери с цельноформованными накладками, ворсованные коврики пола. Этот вариант «четвёрки» позволит Вам даже в дальней поездке чувствовать себя комфортно.

фотография салон ВАЗ-2104

Двигатель ВАЗ-2104 и его особенности

Двигатель 2104-1000260 может применяться для установки на автомобили ВАЗ 2103, 2104, 2106, 21053, 2107.
Изначально двигатель ВАЗ 2104 выпускался только в карбюраторном исполнении. В дальнейшем он был модифицирован под использование системы впрыска топлива и получил обозначение ВАЗ 2104-21.
Двигатель ВАЗ 2104 создан на основе предыдущей модели — ВАЗ 2103. В конструкции использованы: блок цилиндров, шатунно-поршневая группа, привод ГРМ и коленчатый вал от двигателя 2103.

фотография двигатель ВАЗ-2104

Блок цилиндров от двигателя ВАЗ 2103. Диаметр цилиндра — 76,00 мм. Приняты межремонтные размеры — 76,40 и 76,80. На двигатель устанавливается коленчатый вал 2103 или взаимозаменяемый вал модели 21213.
Для обеспечения работы системы впрыска, потребовалась установка узлов и деталей с других двигателей, которые изначально разрабатывались под инжекторную схему подачи топлива. Применяется новая крышка привода распределительного вала, на которой имеется место под установку датчика контролирующего положение коленчатого вала. Потребовалась установка головки цилиндров 2104-1003015, оригинальной конструкции, с увеличенными площадками под впускной коллектор. Конструкция головки предусматривает установку форсунок. Распределительный вал, клапана и пружины соответствуют установленным на двигателе ВАЗ 2103. Установка гидроопор рычагов клапанов не предусмотрена.
Привод ГРМ осуществляется от двухрядной втулочно-роликовой цепи 2103-1006040 . Механизм натяжения цепи механический, аналогичный устройству на двигателе ВАЗ 2103.

На коленвал устанавливается шкив с демпфером и задающим диском 21214-1005058-11. Для привода генератора применяется ремень 2107-1308020(длина — 944мм). Инжекторная модификация 2104 имеет оригинальную систему питания. Система включает в себя электробензонасос с датчиком указателя уровня топлива, топливные магистрали, топливный фильтр топливную рампу с форсунками, воздушный фильтр, рукава подвода воздуха, дроссельную заслонку и систему улавливания паров топлива. Для очистки поступающего в двигатель воздуха предусмотрена установка воздушного фильтра модели 2112. Вместе с впускным коллектором устанавливается ресивер модели 2104 или модели 2123-1008027. Для регулировки объема поступающего воздуха установлен дроссельный патрубок 2112.
Модуль электробензонасоса 21073-1139009 устанавливается в бак и обеспечивает подачу топлива к топливной рампе и форсункам. Используется оригинальная топливная рампа 2104-1144010, коробчатого типа с регулятором давления и обратным сливным трубопроводом. Впрыск осуществляется с помощью четырех форсунок попарно-параллельного действия. Возможна установка форсунок BOSCH 0 280 158 502 (чёрные, тонкие), SIEMENS VAZ 6393 (бежевые, толстые) или других типов с соответствующими параметрами.
Система зажигания включает в себя: модуль зажигания модели 2112, установленный на специальном кронштейне на блоке цилиндров, свечи зажигания и провода высокого напряжения. В состав модуля зажигания входит две катушки зажигания и два электронных устройства управления. В соответствии с управляющими сигналами от блока управления, модуль зажигания формирует и подает высоковольтные импульсы на свечи зажигания.
Управление зажиганием возлагается на электронную систему управления двигателем. Данная система обеспечивает контроль количества воздуха и топлива, подающегося в цилиндры, контролирует работу топливного насоса, управляет подачей высоковольтных импульсов от катушки зажигания на свечи зажигания и корректирует угол опережения зажигания, регулирует частоту вращения коленвала на холостом ходу. Основным управляющим элементом системы служит электронный блок управления(ЭБУ)-контроллер.
Двигатель соответствует нормам токсичности ЕВРО-2.

Ваз 2105. Чертеж четырехдверного пятиместного автомобиля. Серийный выпуск – 1979…2010 годы.

01. ВАЗ-21050 – коробка передач пятиступенчатая.
02. ВАЗ-21051 – коробка передач четырехступенчатая, двигатель — ВАЗ-2101.
03. ВАЗ-21053 – коробка передач четырехступенчатая, двигатель — ВАЗ-2103.
04. ВАЗ-21053-20 – коробка передач пятиступенчатая, двигатель — ВАЗ-2104, распределенный впрыск.
05. ВАЗ-21054 – коробка передач пятиступенчатая, двигатель — ВАЗ-2106.
06. ВАЗ-21054-30 – коробка передач пятиступенчатая, двигатель — ВАЗ-21067, распределенный впрыск.
07. ВАЗ-21055 – двигатель дизельный ВАЗ (БТМ)-341.
08. ВАЗ-21057 – ВАЗ-21053 — правосторонний руль, двигатель с моновпрыском.
09. ВАЗ-21058 – ВАЗ-21050 — правосторонний руль, двигатель с моновпрыском.
10. ВАЗ-21059 – двигатель ВАЗ-4132 (роторно-поршневой).
11. ВИС-2345 – пикап на базе ВАЗ-21053 и ВАЗ-21054.
12. ВАЗ -2105 VFTS (LADA-VFTS) – спортивный автомобиль.
13. ВАЗ-2105 VIHUR – раллийный автомобиль.

ВАЗ-2104 УНИВЕРСАЛ – самая популярная малолитражка, которая пользуется хорошей репутацией у дачников и индивидуальных предпринимателей. Серийный выпуск – 1984…2012 годы. Модификации ВАЗ-21047 (пятиступенчатая коробка передач), ВАЗ-21045 (дизельный двигатель).

ВАЗ-2105 ИЗОТЕРМА ФУРГОН — («каблучок»)


01. Вес перевозимого груза, 0,4т.
02. Вес автомобиля, 0,995т.
03. Дорожный просвет, 0,175м.
04. Бак, 39л.
05. Объем багажника, 345л.
06. Колесная база, 2,424м.
07. Двигатель — 2105.
08. Мощность двигателя, 63,6л.с.
09. Шины, 175/70 R13.
10. Объем, 1290см.куб.
11. Скорость, 145км/ч.
12. Расход смешанный, 10л.

Что такое стенс. История Stance-культуры и USDM культура Виды stance

Существует много автомобильных стилей..но на данный момент самым популярным является именно стэнс стиль.
Основными элементами Stance культуры являются посадка (клиренс) автомобиля и расположение колеса в арках.
Поклонники Stance культуры на своих Stance car»ах осознанно жертвуют быстрым и комф ортным передвижением по дорогам, медленно переползая через лежачие полицейские, сталкиваются с проблемами в виде плохих дорог и прочих колдобин, отдавая дань стилю и культуре в целом.
Все это позволяет выделить автомобиль на дороге из серый массы и сделать его более привлекательным. А по сути дела с автомобилем сделано «совсем ничего»: замена пружин или чуть более дорогой вариант — винтовые стойки, подбираются колеса с максимальным вылетом и приемлемой шириной, подбирается резина (обычно низкопрофильная) и натягивается на диски, теперь все это устанавливается на машину, подгоняется под арки и делается развал, чтобы эти самые диски умещались. В дополнение стиля может быть добавлен скромный (подчеркивающий достоинства) обвес. После всего этого,машина обретает тот самый stance стиль, который был задуман владельцем авто. Теперь можете быть уверены, что Ваш автомобиль стал уникальным и 100% не затеряется в толпе.
В этом движении существует много терминов, вот их подробней и разберём:
Вайтволлы (флипера) – в двух словах это автомобильные (и не только) шины, покрышки, имеющие полосу или всю боковую сторону, состоящую из белой резины. Многие ошибочно думают что это просто краска и прочее. Иногда их еще называют вайтбенды или вайтстрайп, разница лишь в ширине полосы белой резины.
Сейчас вайтволлы становятся популярными не только на западе, но и повсеместно. В основном, вайтволлы устанавливаются как на западную классику, так и на классику российского автопрома – москвичи, волги, жигули и тд.

Вип(VIP) – это особый вид тюнинга автомобилей, который со временем перерос в особую автомобильную культуру. Возникновение VIP стиля связано с развитием JDM сцены. Рождение нового стиля припадает на начало 90-х годов ХХ века, как правило все придерживаются двух версий появления Bippu.

Первая связана с японской мафией Якудза, считается, что езда на роскошных европейских седанах привлекала много внимания со стороны полиции, поэтому члены Якудзы для передвижения стали использовать дорогие автомобили японского производства с характерными внешними доработками.

Вторая версия относится к уличным гонщикам Осаки, которые из-за постоянных нелегальных гонок по шоссе Hanshin также стали привлекать внимание полиции, тогда они пересели со спортивных купе на большие седаны, которые дорабатывались в стиле Mercedes-AMG. Первой группой VIP эниузиастов считается команда Black Cockroach в распоряжении которой были доработанные Nissan Cima, Nissan Cedric, Toyota Celsior и Toyota Crown.Основные доработки при таком тюнинге касаются внешности автомобиля. Отличительные черты: очень низкая посадка автомобиля (применятся винтовая или пневмо-подвеска), большие и очень широкие диски для установки которых нередко приходится прибегать к доработкам крыльев и отрицательному развалу, строгие (часто широкие) обвесы кузова, доработки интерьера, высококлассная аудиосистема. Однако самое главное при VIP тюнинге сделать машину как можно ниже, придав тем самым правильную посадку (Stance) и установить большие, широкие колеса (Fitment). Господин Такетоми, владелец Junction Produce, однажды отметил: «Стиль VIP – это посадка и колеса, все остальное, в том числе обвес – просто аксессуары».Однако все больше и больше людей втягивалось в новую культуру, которая перешла океан и осела в США, Малайзии, Гонг Конге и иных странах, поэтому со временем стали появляться машины компакт-класса в стиле VIP (Toyota bB, Toyota iST, Honda Fit и другие). Европейские марки (Mercedes-Benz, BMW, Jaguar) также стали подвергаться доработкам в VIP стиле. Несмотря на то, что практически все виды автомобильных кузовов в той или иной мере подвергаются тюнингу в VIP стиле, 100% VIP машинами считаются только большие седаны, минивены и Kei-машины все остальные платформы в стиле VIP принято называть VIP Inspired.

Джып, жып, жыыыыып – автомобиль, который по мнению окружающих не вписывается в рамки «низких автомобилей», не зависимо от типа кузова, будь то даже кабриолет, главным критерием является клиренс и чем он меньше, тем больше вероятность того, что данное авто не оскорбят термином «джип».

ЖДМ(JDM) – Japanese Domestic Market (англ. Японский отечественный рынок или Японский внутренний рынок) — термин, распространённый в отношении автомобилей (как и прочих товаров), продающихся на рынке Японии. Обычно модели автомобилей, предназначенных для Японии, отличаются от тех же моделей, предназначенных для других рынков, или же вовсе не имеют зарубежных аналогов.

Корч – это автомобиль предназначенный для участия в спортивных соревнованиях,и не предназначенный для перемещения по городу,пременение этого термина к убитому ТАЗу с банкой проспорт-не верно.

Левл – вариант, когда порог параллелен земле. Reverse (french) rake – задняя часть автомобиля ниже передней. Straight (californian) rake – передняя часть автомобиля ниже задней части

Разварки – это изменение ширины стального диска (штамповка), путем вваривания полосы или сварка из двух дисков одного. Уже многие знают, что «разварки»-это сленговое название широких стальных дисков. Часто в нашей стране их зовут еще штампованными дисками или «штамповками» – это про те, которые обычные, еще не ставшие широкими разварками.

rake (рейк) – продольный наклон автомобиля, т.е. то на сколько ровно он находится относительно земли.

Рэт-Лук(Rat-look) – (от rat – крыса) представляет собой довольно большую часть ресто движения. Но в данном случае это не тот рэт-лук, который привычен и известен всем – черная матовая краска и плюшевая крыса на торпеде – а правильный с точки зрения ресто движения. Основные принципы те же: оригинальная внешность, салон и все остальное. Только если в случае ресто машина выглядит как новая, с начищенным хромом и сверкающей краской, то рэт-лук автомобиль имеет кузов таким, каким он стал за долгие годы с момента своего появления на свет. И не важно в каком он состоянии: стояла ли машина долго в гараже и просто запылилась или же пролежала на заднем дворе какой-нибудь фермы и порядком заржавела. Но непререкаемым правилом является полная реставрация всей технической начинки. Подвеска, днище, двигатель – буквально всё доводится до кондиций полностью отреставрированного автомобиля. Кузов тоже подвергается ремонту, но только там, где этого не будет видно – в колесных арках, внутри салона и других подобных местах. Салон обычно просто отмывается и оставляется как есть. С двигателем ситуация более сложная. С одной стороны внешне он может соответствовать кузову – быть ржавым и пыльным, с другой, может быть вычищен до блеска. Но обязательно отремонтирован до полностью рабочего состояния.
Довольно популярной является стилизация под рэт-лук. Когда кузов после полной реставрации намеренно состаривается: или какими – либо абразивными и химическими материалами, или за счет особой покраски. Колеса, аксессуары и все остальное аналогично стилю Resto-Cal.

Стикербомб – изначально японская дрифтовая тема причем именно на боевых корчах, которые периодически прикладывают об стены и другие машины. Чтобы не ремонтировать все эти коцки придумали стикербомб и зиптаи(хомуты, которыми чинят бампера, когда они рассыпаются от ударов), стикеры лепятся на те места, которые просто впадлу чинить, да и смысла нет, потому что все равно рано или поздно ты всечешь машину о что-нибудь.

Cтенс (Stance) -общая посадка автомобиля. Взаимное положение дороги, колес и кузова.

Стритсракер – стритрейсер. Отличительные особенности автомобиля среднестатистического стритрейсера – поналепливать на свое авто ве что попало, особую популярнось имеют наклейки ак-47, ноггано и т.п. Иногда они устанавливают на свое авто прямоток, бывают конечно и более серьезные изменения по движке. Так же особым элементом является установка мощной аудиосистемы, которая иной раз вдвое, а то и больше раз может превышать стоимость самого авто. Вообщем про стритсракеров можно писать долго и нудно.

Cтретч – натянутая резина(Домиком)

Фитмент – суть характеристика, определяющая положение колёс относительно кузова (в частности, кромки крыльев) автомобиля. Ключевые элементы, формирующие фитмент:
wheel offset & width – вынос и ширина колеса,
fender gap – расстояние от кромки диска до кромки крыла,
tyre stretch & profile – профиль и степень растянутости шины. При этом, сам фитмент в сочетании с клиренсом формирует посадку автомобиля, именуемую англоговорящими товарищами stance.
Логично предположить, что, раз колёса есть у каждой машины, то и фитмент тоже. Однако выделяют степени, или уровни фитмента, признаваемые лоу-движением, и разумеется, что о фитменте стоит говорить только если машина занижена.
Виды фитмента:
Tucked in – когда размер арки не позволяет вместить колесо, и оно залазит под крыло.
Такая комбинация в основном встречается на Veedub-ах, на VIP машинах с пневмоподвеской или, к примеру, на низких ресто Жигулях.
Flush – нечто похожее на русское “заподлицо”, но немного по-другому. Колесо с покрышкой как бы продолжает форму крыла, либо находится на одной вертикальной линии с его кромкой. При этом, расстояние между кромкой диска и крылом может составлять около полудюйма, что вполне позволяет использовать машину повседневно, или, например, для дрифта.

Hella flush – крайняя степень радикальности фитмента, когда кромка диска или боковина шины буквально трёт о кромку крыла.
Сам термин Hella flush – слэнговое словечко, возможно, выдуманное неким Jerry в 2003 году и переросшее в целое движение с девизом Offset is everything, иными словами, приверженцы Hella Flush-а стремятся любыми правдами и неправдами впихнуть в машину колёса пошире.
Однако, бывают и негативные проявления стремления к широте колеи, например too much poke или Mexi flush – если колесо выпирает слишком далеко за арку.
Стоит заметить, что достижение “правильного фитмента” никоим образом не имеет своей целью (хотя и не исключает) улучшение управляемости или поворотной способности машины. Фитмент – это черта внешнего вида машины, не более того.

Худрайд (Hood Ride) – Словосочетание «hood ride» можно интерпретировать как «машина для района», «машина для перемещения по району». Внешний вид машины полностью соответствовал духу стиля рэт-лук: местами потертая и облупившаяся краска, вмятина почти во всю дверь, отсутствие крыши, притом, что это был кабриолет, но ходовая часть, двигатель были в отличном состоянии, ряд аксессуаров дополняли внешний вид машины.В 2004 году к Деррику Пачико (Derrick Pachico), известный как DopeBeat Derrick, приехали знакомые. Один из них, мало знавший Деррика решил поинтересоваться, на какой машине тот ездит. Деррик показал ему свой Karmann Ghia, который был совершенно стандартным, но на максимально низкой подвеске. Посмотрев на машину, человек произнес фразу, благодаря которой движение и получило свое название: «Shit man… It’s a real Hood Ride!».
Через некоторое время после этой встречи Деррик открыл сайт и форум, которые получили название hoodride.com. Этот сайт должен был стать сообществом людей, для которых важен не сам автомобиль, а любовь к своему транспортному средству.
С каждым днем участников становилось все больше. «Худрайдом» хотели быть уже не только владельцы «трэшовых» Фольксвагенов, но и владельцы вполне прилично выглядящих «Фольксвагенов» и владельцы американских машин. Но так повелось, что термин «худрайд» ассоциируется именно с машинами сомнительного вида. Это и не удивительно – ведь основными источниками «исходников» были американские автомобильные свалки. Но не те, где свалено огромное количество машин и их время от времени прессуют, а небольшие, расположенные на фермах или в полях или в старых амбарах.
Основной популярностью движение пользовалось, конечно, в США. Ведь там нет обязательного технического осмотра, и ездить фактически можно на всем, на чем хочешь. В Европе же с этим сложнее, поэтому в Старом свете люди часто ограничивались небольшими участками ржавчины и стенсилами «худрайд» на капоте или крышке багажника. К концу 2006 года движение достигло своего пика, и его популярность уже стала оказывать отрицательное влияние. Не разобравшись, что к чему, люди стали лепить на свои ржавые корыта наклейки и рисовать стенсилы «худрайд», хотя на самом деле их машины не имели к движению никакого отношения. Владельцы старых машины, у которых элементарно не было средств на их ремонт, решили, что, назвав свой автомобиль «худрайдом», они станут круче и ни у кого не останется вопросов насчет внешности машины. В последние месяцы существования сайта это явление обрело массовый характер и отбиваться от таких мнимых «худрайдов» стало сложно.

И вот только недавно движение пришло в Россию. Хотя пришло даже не само движение, а только название. Но у нас началось все с того, «благодаря» чему умер «худрайд» там – владельцы ржавых корыт решили, что теперь они могут называть свою машину «худрайдом» и гордится ей, а это совсем не так. Перспектив развития движения в нашей стране не наблюдается, как, впрочем, и развития стиля рэт-лук – всё-таки еще слишком силен фактор «статусности» автомобиля здесь: уважением пользуются только дорогие иномарки. Мало кому может придти в голову, что выезжая на ржавой внешне машине, ты можешь быть владельцем довольно приличной машины на каждый день.«Худрайд» — это не стиль. «Худрайд» — это идея, классический протест против системы, может немного наивный, не до конца продуманный, но идущий от искреннего нежелания отдельного человека или группы людей быть не как все.

«Всем привет! Меня зовут Александр, я из Балаково.

Хочу рассказать вам про мой любимый проект — Chevrolet Lacetti, которым я владею уже более 6 лет и расставаться с ним не собираюсь!

Я всегда питал теплые чувства к автомобилям. Еще с детства я обращал на них пристальное внимание, отличал проезжающие мимо меня марки автомобилей. Особо отчетливо помню моду на различные массивные пластиковые обвесы на машинах, модные диски «арбузы» — мне это безумно нравилось! Наверное, именно эти моменты зародили в моей голове мечту — моя машина обязательно будет отличаться от прочих серых машин!

На данный момент у меня Chevrolet Lacetti 2009 года выпуска. К стилю, в каком мой «Лачетти» выполнен сейчас, я пришел, конечно, не сразу. Было опробовано очень многое: сменено очень много колес, различных бамперов, порогов и т. д. Начинал с неоригинальных китайских запчастей и дисков, но решил перейти на редкие оригинальные японские диски и запчасти.

Я ярый любитель Stance-культуры. Считаю, что это самый благородный из прочих автомобильных стилей — автомобили Stance выполнены в строгости. И самое прекрасное, что Stance-автомобиль создаешь ты сам! Ты не можешь приехать в какой-нибудь сервис и сказать: «Мастер, подгони мне Fitment («фитментом» называют положение колес по отношению к кузову автомобиля (кромка крыла) и формируется он из следующих элементов: wheel offset & width (вынос и ширина дисков), fender gap (расстояние от кромки диска до кромки крыла) и tyre stretch & profile (натянутость шины и ее профиль), подрежь тут, укороти там…». Автомобили в стиле Stance — это строго индивидуальная работа, где весь образ машины ты придумываешь сам, своими силами.

И свою машину я, естественно, делал собственноручно. Первым делом установил четырехконтурную пневмоподвеску, короткоходные стойки с занижением -70 на рубенах.

Диски меняю каждый год, это уже стало традицией. В нынешнем году заказал японские редкие трехсоставные диски Desmond. Резина Nankang 205/40/17.

Салон также несколько преобразовал. А также установил выпуск паук 4-2-1. Был удален катализатор, и автомобиль был прочипован на динамику.

Машина не просто красивая, она еще и громкая. Разумеется, сделана шумоизоляция всего кузова, кроме крыши и капота.

Мне не жалко было потраченных средств и времени, ведь это как хобби, как образ жизни. Каждый труд, как известно, поощряется. Машина выделяется, привлекает массу внимания. О ней говорят, с ней хотят сфотографироваться, и мне это очень нравится».

Действительно, машина выглядит очень благородно — сочный цвет, с которым отлично сочетаются эти колеса, установленная пневмоподвеска только привлекает еще большее внимание.

Александр регулярно посещает различные автомобильные мероприятия и выставки. В этом году побывал на «VolgaCarHoliday» и «АвтоПикнике на Волге» и, естественно, забрал кубки за стиль своего Lacetti.

Остается только пожелать Александру удачи и неиссякаемого воображения в дальнейших преобразованиях своей машины.

Друзья, хочу поговорить с Вами о наболевшем, а точнее порассуждать на такую тему как stance. Почему мы выбираем эту культуру? Это же так непрактично, тем более в наших городских условиях. Но почему мы всё равно стремимся быть низкими и широкими? Я часто слышу в свой адрес фразу: «Как можно ездить в России на такой низкой машине?» на что у меня сразу вырывается ответ: «Да разве она низкая?! Она же высокая! Посмотрите какой плохой wheel gap» . Такой вопрос Вы тоже скорее всего слышали: «А колеса не чиркают об арки?» Да я только рад буду, если они начнут чиркать, ведь тогда я буду знать что fitment у меня в порядке. Итак, зачем нам всё это надо и что значат все эти термины? Давайте разберём всё по порядку.

Что такое Stance?
Это очень простое слово, часто использующееся западными тюнерами. Но в своей простоте оно не имеет аналогов в русском языке и поэтому для большинства отечественных энтузиастов подразумевает целое направление доработки своего авто до по-настоящему сногсшибательного вида. Если переводить дословно, то оно звучит как «стойка», что и объясняет большинству характер данного направления. Мы пытаемся придать «правильную стойку» нашему автомобилю. Давайте теперь посмотрим с чем это едят.

Wheel Gap (вилгэп)
Расстояние от верхнего края колеса до кромки арки, то есть изменение клиренса машины. Другими словами у джипов wheel gap будь здоров! Суть stance-культуры такова, чтобы максимально сократить это расстояние до минимума и чем меньше оно будет, тем выше Ваш уровень.

За этот показатель у нас отвечают амортизационные стойки. Как вариант можно просто спилить витки на штатных пружинах. Но как правило такой способ Вам не даст правильного вилгэп»а, а только быстрее выведет стойки из строя. Для правильного получения чёткой посадки автомобиля, у нас есть два пути:

Coilovers (винтовая подвеска)
Данный вид подвески имеет регулировку высоты и жесткости. Предел клиренса у некоторых производителей достигает до -100 мм от штатного показателя, а жесткость стоек может иметь аж 30 регулировок. Всё это настраивается только механическими путями за счёт регулировок на самих амортизаторах. Если выражаться на сленге, то «винты» (так их называют) имеют большое уважение в кругах стенсеров и считаются «true».

Поскольку все препятствия на нашем пути мы вынуждены преодолевать скребя нашим «пузом» оставляя на днищах наших автомобилей некие подписи, таким образом появилось выражение «пузотёрки».

Air Suspension (пневматическая подвеска)
Данный вид подвески имеет все те же особенности, что и винты, за исключением пружин. Они заменены на воздушные подушки. Регулировка высоты автомобиля происходит из салона машины путём нагнетания или стравливания воздуха из подушек. Можно сказать, что такой тип подвески очень практичен и актуален для наших дорог поскольку мы облегчаем наше движение в проблематичных местах. Однако, такой вид в stance-кругах считается «читерским», т.е. грубо говоря мы обходим препятствия, а не преодолеваем их. Зато в таком варианте подвески мы получим максимально чёткий wheel gap.

Fitment (фитмент)
Расположение колеса в арке, другими словами насколько красиво оно выглядит в арке вашей машины. Задача stance-культуры состоит в максимальной минимизации расстояния между внешним краем колеса до внутреннего края арки. За этот показатель отвечает вылет диска (ET). Чем цифра меньше, тем больше колесо будет выступать наружу и тем самым компенсировать недостающего вам расстояние для идеально правильного фитмента. Добиться хорошего результата можно двумя путями:

Outer Lip / Rim (внешние обода)
Такой способ подходит только для владельцев составных дисков. Достаточно поменять внешние полки диска на более широкие, тем самым сократив нужное нам расстояние.

Spacers (проставки)
Существуют для изменения вылета диска. Устанавливаются между колесом и ступицей. Проставки бывают разной ширины, от 5 мм до 50 мм и больше.

Stance понятие растяжимое и у него тоже есть свои степени и уровни. Формируются они за счёт тех двух составляющих, Wheel Gap и Fitment. Давайте разберёмся подробнее.

Когда колесо «прячется» под крыло. В большинстве случаев подвеска специально занижается для того чтобы утопить колесо в арку. В основном такие комбинации встречается на VDUB или VIP-машинах с пневмоподвеской. VIP-культура, это тоже отдельная история, о которой мы с Вами как-нибудь поговорим.

Нечто похожее на русское «заподлицо», но немного по-другому. Колесо с покрышкой как бы продолжает форму крыла, либо находится на одной вертикальной линии с его кромкой. При этом, расстояние между кромкой диска и крылом может составлять около полудюйма, что вполне позволяет использовать машину повседневно, или, например, для дрифта.

Крайняя степень радикальности фитмента, когда кромка диска или боковина шины буквально трёт о кромку крыла. Сам термин HellaFlush — слэнговый, возможно выдуманный неким Jerry в 2003 году и переросший в целое движение с девизом «Offset is everything». Иными словами, приверженцы HellaFlush»а стремятся любыми правдами и неправдами впихнуть в машину колёса пошире. Для этого часто используются такие вещи как «camber kit» и «stretch». К ним мы вернёмся чуть позже.

При таком раскладе, крыло как бы лежит на ободе диска, колёса заваливаются домиком, делается сумасшедший отрицательный развал. Как правило такой вариант используют на машинах с пневмоподвеской. Чаще всего такой фитмент можно встретить на VIP-автомобилях.

Однако, бывают и негативные проявления стремления к широте колеи, например «Too much poke» или «MexiFlush» — случай, если колесо выпирает слишком далеко из арки.

Стоит заметить, что достижение правильного фитмента ни коим образом не имеет своей целью (хотя и не исключает) улучшение управляемости или поворотной способности машины. Фитмент — черта внешнего вида машины, не более того.

Stretch (стреч)
Резина домиком. Мы специально подбираем на диски резину изначально уже, чем полагается для данного диска. Например на диск 10×17 по всем законам физики и технике безопасности полагается устанавливать резину 265/40. Мы же пытаемся поставить 215/40.

Для чего и зачем? В первую очередь это делается, для упрощения процесса установки широкого диска. Например, диск с резиной 265/40 просто не поместится у нас в арку, будет чиркать и цеплять всё, что только можно. Во-вторых, этот, так называемый, стреч делает диск более объёмным за счет минимизации резины на нём, что в свою очередь создаёт эффект больших и выразительных колёс.

Но в этом есть и свои минусы. Обода дисков теряют защиту в виде резины на кромках, что чревато вмятинами или расколом обода диска от соприкосновения, например, с поребриком (бордюром). Поэтому, надо быть крайне аккуратным, ведь красота — страшная сила!

Camber Kit (комплекты для отрицательного развала)

Имеют очень большие величины отрицательного развала, вплоть до 10 градусов. Используют их для той же цели что и stretch — установку в арку широких колёс. Бывает множество разновидностей данного девайса, в том числе и на винтовых стойках иногда есть возможность регулировки развала. Приведу на фотографии наиболее распространённые способы.

Так же подвеска машины делается максимально жесткой. Представьте, что будет происходить при клиренсе в 5 см будь у автомобиля мягкая подвеска. Поэтому всю подвестку нашего автомобиля мы пытаемся максимально сделать жесткой как у картинга, для избежание на неровных участках соприкосновений с дорогой.

Не забываем и про кузов машины. Эта очень важная часть должна иметь максимально свежий вид. Различные обвесы, накладки, реснички и тонировка имеют место быть в том случае если это гармонирует с общим обликом машины. Как правило, OEM (оригинальные детали) имеют правильный и гармоничный дизайн. Что касается тонировки, тут нет четкого определения.Очень большое внимание уделяется мелочам, таким как кулиса, панели в салоне машины, руль и прочее. Создавайте свой неповторимый стиль и грацию! Подведём небольшой итог того, что нужно для правильного stance-автомобиля. Назовём это «правилом трёх принципов»:

1. Чистый и свежий внешний облик кузова.
2. Правильная посадка автомобиля.
3. Впечатляющие своей шириной и красотой колеса.

Так почему же stance? Наверное, потому что это очень увлекательно и интересно. Потому что по нашему мнению это очень стильно, ведь стиль и характер нашему автомобилю задаём мы сами. Потому что заниженная машина на широких дисках сразу выглядит иначе, линии кузова смотрятся намного красивее и изящней. Потому что машина приобретает спортивный и агрессивный облик. Много «потому что», но мы свой выбор сделали и предлагаем Вам тоже сделать свой выбор в пользу данной культуры. А мы в свою очередь обязательно Вам поможем с правильным советам и решением возникающих вопросов. Друзья, давайте развивать данную культуру вместе, ведь это так интересно!

Мы ломаем стереотипы, что стиль не для наших дорог!

Вероятнее всего на эту страницу вы попали вследствие запроса в поисковике: Что такое Стэнс (Stance)?”

Ответить на этот вопрос очень просто. Это слово так же как и многие другие, пришло к нам с запада, и относится оно к автомобильному миру. Если объяснять на пальцах, то дословно любой англо-русский словарь переведет вам слово STANCE – как: стойка, позиция, положение, и это совершенно верно, потому что это имеет прямое отношение к данному направления автомобильного стайлинга. Основные элементы подобного тюнинга это дорожный просвет, клиренс, “посадка”, разновидность подвески, расположение колес в арках, диски, параметры дисков, соотношение резины и прочее. Как вы уже поняли общее понятие данного слова достаточно обширно, поэтому важно помнить, что оно включает в себя массу различных понятий и прочих нюансов.

Стенс — это относительно новая автомобильная культура «низких» автомобилей. К этому термину stance относятся практически все автомобили которые можно посадить на «брюхо», при помощи установки койловеров (регулируемый аммортизатор) или пневмоподвески.

fitment, stretch, flush, static, lowered, poke, slammed, dumped, decked, dropped etc, static, bagged – это все словечки и обозначения из stance культуры.

Мы почти уверены что следующим вопросом у Вас будет: “Что такое Фитмент (Fitment)?” – Это как раз расположение колеса в арке автомобиля. На это может влиять очень много факторов, начиная от подвески автомобиля, она может быть статичной благодаря различным винтовым подвескам (Coilovers) Либо подвеска может быть воздушная, так называемая “пневмо подвеска” а так же “гидро подвеска”, что в России пока, к сожалению, встречается редко. Далее имеет значение ширина диска, ширина резины, вылет диска, настройки подвески, развал и т.д. Настройки и параметры всех этих пунктов позволяет добиться идеального Фитмента (Fitment)

“Что такое Camber ?”-
– в двух словах это развал колеса, он измеряется в градусах, и как правило наибольшая площадь контакта колеса с поверхностью дорожной части возможна при его перпендикулярном положение, то есть при нулевом угле развала. Однако на практике это возможно лишь при движении по прямой на ровной дороге. При прохождении поворота на колеса автомобиля начинают действовать силы старающиеся вывернуть колесо от его перпендикулярного положения или даже оторвать от дороги. Для этих целей развал управляемых колес на обычных автомобилях делается изначально либо нулевым, либо с небольшим отрицательным значением. Хорошие результаты для отрицательного развала дают регулируемые рычаги. В нашей истории развал применяется для подгонки фитмента и расположения колеса на автомобиле.

Lowdaily – это крупнейший в России и СНГ некоммерческий проект, представляющий из себя информационный блог о разнообразии культур низких автомобилей по всему миру.

«Мы старались расширить информационное поле, которое доступно нашим согражданам, что бы объем информации, которую можно получить на нашем ресурсе был достаточен для формирования правильного мышления у всех желающих вникнуть в суть культуры» — Шимановский Илья

Stancepedia – это Энциклопедия по стенсу в которой вы найдете всю полезную информацию. Если вы хотите разбираться в терминах и понимать с чего нужно начать для того чтобы собрать стильный автомобиль – то вы зашли на правильную страницу! Здесь мы будем публиковать спецвыпуски посвященные STANCE тематике.

Часть первая – Диски

Первое видео из нашего цикла посвящается конечно же дискам и их правильному выбору!
Памятка для начинающих:*

  • “ET” – вылет диска, расстояние в миллиметрах оси симметрии диска от привалочной плоскости (плоскости прилегания)., измеряется в миллиметрах (ET+12)
  • “J” – форма закраин кромок, измеряется в дюймах (9.5J)
  • “PCD” – или «сверловка», основной параметр, где первое значение это кол-во отверстий, а второе их радиальное расстояние, измеряется в миллиметрах (5 х 114.3)

ВАЗ 2106 | LD — Coub — Самая большая платформа видеомема

ВАЗ 2106 | LD — Coub — Самая большая платформа видеомема
  • Дом
  • Горячий
  • Случайный
  • Подробнее …

    Показать меньше

  • Мне нравится
  • Закладки
  • Сообщества
  • Животные и домашние животные

  • Ведение блога

  • Стенд-ап и анекдоты

  • Мэшап

  • Аниме

  • Фильмы и сериалы

  • Игры

  • Мультфильмы

  • Искусство и дизайн

  • Живые изображения

  • Музыка

  • Новости и политика

  • Спорт

  • Наука и технологии

  • Еда и кухня

  • Знаменитости

  • Природа и путешествия

  • Мода и красота

  • танец

  • Авто и техника

  • Мемы

  • NSFW

  • Рекомендуемые

  • Coub of the Day

  • Темная тема

ключей faze poboljšanja onoga što biste trebali znati o kulturi Stens

Умжетность у людском разумиеваню широка и вышеструка.Nevjerovatan broj stilova i vrsta umjetničkog slikarstva može u vama izazvati čitav niz emocija — od šoka do euforije. Svako od vas odlučuje za sebe: da se divi čuvenoj «La Giocondi» Леонарда да Винчиа или да падне у несвиест од главоболье koju je izazvao njen pogled.

Suprematizam je smjer čiji je osnivač Каземир Малевич. Suštinu slika ovog pravca autor prenosi kroz prizmu najjednostavnijih geometrijskih Oblika i obrisa. Nastao u prvoj polovici 1910 -ih, bio je osuđen na godine nesporazuma.Međutim, danas nema osobe na svijetu koja ne bi poznala čuveni «Crni kvadrat» Maleviča, čija se cijena procjenjuje u milionima američkih dolara.

Stil tuninga automobila je vrsta umjetnosti sa svojom poviješću i vrijednostima. Dakle, stil stava, koji se pojavio relativno недавно, poput suprematizma, često ostaju podcijenjeni. Unatoč tome, krug ljubitelja ovog smjera raste sa svakim ciljem, hvatajući većinu vozača iz cijelog svijeta. Pokušajmo shvatiti što je stav i koji je razlog njegove popularnosti.

Назив имя споминье читаву культуру автомобильного тюнинга, чия главная характеристика ниска позиции. Važno je napomenuti da se sam pojam pojavio nekoliko godina kasnije, nakon popularizacije potcjenjivanja automotivebila. Za kreiranje projekta stajanja pojebno je, prije svega, smanjiti udaljenost vozila od tla, a zatim ne zaboraviti na ugradnju «ispravnih» naplataka. Nekoliko je načina da automotive učinite «nižim»:


«Statičko» ogibljenje, or statičko, najjeftinija je opcija za promjenu visine vožnje.Obično se opruge u vašem automotivebilu zamjenjuju slčnim, kraćim dužinama, što značajno smanjuje količinu «neželjenih» сантиметра испод vašeg automotivebila. Imajte na umu da se rezanje opruga ne isplati jer će ovaj postupak dovesti do uništenja preostalih zavoja i nepravilnog rada amortizera.

Спиральная суспензия

Spiralni ovjes or «coilovers» vrlo je praktično i jeftino rješenje za one koji žele «podcijeniti» svoj Automobil. Главна разлика измeню ове метод и стaтичкe je mogućnost mehaničkog podešavanja kretanja potporne čaše, zbog čega se zazor vozila povećava ili smanjuje, ovisno o izvršenim radnjama.

Zračno ogibljenje

Automobili opremljeni posbnim «zračnim jastucima» umjesto amortizera, kao i kompresorom za stvaranje potrebnog pritiska u sistemu, mogu promijeniti zazor od tla u nekoliko sekundi naçundi pritismečekra odgov. Ova opcija «podcjenjivanja» automobila je najskuplja, ali udobnost i praktičnost koju pruža vrijedi sav novac potrošen na setu.

Naravno, za stvaranje «ispravnog» uklapanja nemoguće je samo «podcijeniti» automotivebil, jer stupanj vašeg «podcjenjivanja» ispravno ovisi o položaju točkova, koji se naziva «.Za vizualno razumijevanje sorti «fitment», ilustracija je navedena u nastavku.

U većini slučajeva, što su širi naplatci, to više pažnje zaslužuje završen projekt. Как би сэ осигу рала могучность поставляя диска найвеце могуче ширин, користи се негативни нагиб коди омогучуйе «пеньенье» диска у «утробу» лукова котача.

После того, как корак у Припреми проекта стадиона, установленного на исправных дисках. Разноликость доступных произведений и модель еще невыявленная. Веч смо разговарали о томе како одабрати праве котаче за себя.Međutim, stav je umjetnost koja zahtijeva žrtvu. A za instaliranje некада популярных дисков у новой культуры из Bentley Continental GT на белом коде другие автомобильные потребности на одностороннем уровне за адаптера коди омогуцую не само промену характеристики главчине и броском отворачивания за слежение за движением.

Odstojci za kotače se поставляю прямое изменение главы и наплата. Постое двие врсте одногодка: одни и адаптеры. Prvi se koriste za povećanje pomaka kotača, što vam vizualno omogućuje da proširite trag automotivebila, kao i da se riješite efekta «upijanja» lukova kotača.Adapteri se koriste za promjenu bušenja automotive or kada se veličina središnjeg centra na disku ne podudara. Obično je ova vrsta odstojnika pričvršćena na glavčinu vozila automotiveim vijcima, nakon čega je naplatak pričvršćen na odstojnik pomoću dodatnih vijaka.

Možete kupiti odstojnike za povećanje prevjesa or adaptere za promjenu bušenja kontaktiranjem profesionalaca u svom području, Master Fitment.

Unatoč postojećem stereotipu, modern odstojnike za kotače odlikuje visoka kvaliteta i izdržljivost legura, a njihov dizajn dopušta da se ne stvori kritični pritisak na glavčinovlač što povgje.

Zaključno, napominjemo da se, bez obzira na marku i model, svaki automotive može pretvoriti u Privlačan projekt. Svaki vlasnik sam odlučuje na koje načine će postići željeni rezultat, ovisno o financial mogućnostima i preferencijama ukusa. Я просмотрел неспоразума других, ставе постао врста умжетности коя сэ може волжети или мрзити, а саде е немогуче поречи чинженицу да е освойила cijeli svijet.

Tijekom formiranja и razvoja automotive industrial, želja ljudi da se izdvoje od svoje vrste odražavala se u njihovim vozilima.Nije ovisilo o kontinentu, boji kože, vjerskim uvjerenjima i materijalnom stanju, jer, usput rečeno, ne ovisi o tome sada. Želja da budete jedinstveni, da radite ono u čemu uživate, da postižete rezultate i da se nađete u tome, razlozi su zbog kojih ljudi mijenjaju svoje car. „Какве глупости? Stavio sam debele gume i alarm za automatsko paljenje s jedinom svrhom da automotive može izaći na rubnik i da se ne smrzne zimi! «- i bićete u pravu na svoj način. Jednako su ispravni i oni koji namjerno žrtvuju potrošačke kvalitete radi lijepog, jedinstvenog izgleda.Sada ćemo vam reći o najraširenijoj pojavi u povijesti modernog tuninga automobila — Stensovom stilu.

Израз «став» появио се сасвим недавно — почетком овог столица — я преведен е на руски дословно као «став» или «став». Svojevrsna auto joga, u kojoj vrijeme i trud uloženi, ako nemaju duboko duhovno značenje, onda zasigurno pomažu u spoznaji potrebe za samoizražavanjem. Zanimljivo je da se naziv stila pojavio dugo nakon pojavljivanja samih automotivebila «у позиции». Štoviše, ne postoji točno razumijevanje tko je i kada odlučio tako nazvati takve «projekte», ali općenito se vjeruje da je ova riječ došla od izraza «Lijep stav, brate!», Štoled se može ! »… У чему, заправо, лжепота и идея овог феномена?

Da bismo to razumjeli, navest ćemo ilustrativan primjer.Размислите о том как скица концепция автомобиля изгледа много прие него это еутеловлена ​​у металла и пластика. Ovo je tijelo doslovno rašireno po tlu s velikim kotačima, kao da se slojeva u krila. Svojevrsni idealni monolit, percipiran kao cjelina s cestom. На путу массовне производство, проект образа формальности, због чега губи свою «идеальность». Ради практики, котачи постаю малы, клиренс од тла се, против, повечава — «интегритет» се губи. На ideološkom nivou, «stens» vraća automotivebil u prvobitni imidž.Koje su karakteristike automobila napravljenog u ovom stilu?

Globalno, изглед «Stensovog automotivebila» određuju samo dvije stvari — kotači i podcjenjivanje. Али то не значи да će ugradnja još nekoliko сантиметара диска, zajedno s niskim ovjesom, automotivebilu pružiti loversno «držanje». Суштина лечи у релятивном положении точкова у односу на теле, а тела — у односу на тло. A ako smo nedavno sa smanjenjem razmaka od tla, tada ćemo posbnu pažnju usmjeriti na položaj kotača u odnosu na tijelo, a posbno na lukove kotača.Reč koja karakteriše ovu nauku je «prilagođenost» или, labavo, «stepen sadnje». Koje vrste ugradnje postoje i po čemu se razlikuju jedna od druge?

У воды, угдня сэ можно назвать било коджим распоредом котача у луку, али ми чэмо сэ усредоточити на одном негове врсте кое одговараю идеологи «исправног» стенса. Почнимо с найрадикальным, названым «хеллафлуш». У овой изведби, диск себе налази это е могуче ближе рубу крила и у двие равни гледанья. U najčvršćoj konfiguraciji ovjesa s oprugom, rub luka nadvisuje obruč diska samo nekoliko milimetara kako bi se izbjegao kontakt dok opruge rade.У случаю зрачног овьеса, можно уопче неце бити празнина — лукови у непомичном положении автомобиля леже на дисковима. Гума же у овой версии поставлена ​​на много маню ширину. Rezultirajuće «smetnje» omogućavaju skrivanje gume iza luka kotača, što će zauzvrat omogućiti veće potcjenjivanje vozila.

Postoje i više «mirnih» opcija ugradnje koje omogućuju da se diskovi nalaze unutar, iza ravnine lukova («uvučeni»), kao i veću udaljenost do diskova («u ravnini»). Prekomjerno isticanje kotača u potrazi za širinom kolosijeka naziva se «mexiflush» или «paddyflush».Ova vrsta ugradnje manje je uobičajena i služi prije kao primjer «kako to nije potrebno učiniti». Opremu se može pronaći i na automotive pripremljenim za sportske dogaaje, kao i u njihovim replikama. Njegovo ime, «Meatyflush» («меснат», «порыв»), nastalo je od trkaćih guma višeg profila, poput «гладак».

Осим релятивного положения кота и каросерие, позорность себе посвету и ширини диска — это више, то боле. Ovaj poduhvat doveo je do prisilnog povećanja kuta nagiba kako bi ih lukovi mogli smjestiti.Nakon toga, sam negativni nagib postao je moderan «trik», koji se koristi čak i u slučajevima kada za to nema potrebe. Osim toga, «blokirani» točkovi vizualno čine automotive širim, što je jedan od kanona stila «Stens».

Tako je tvornički izgled automobila ispunjen agresivnošću i estetikom zahvaljujući samo dotjerivanju šasije. Стиль «Стенс» не регулируется присутствием других ваньских тюнингов, и его можно припадать автомобилями различных годов моделей, марки и типа каросерия.Дакле, «Стенс» таковы, что можно записать и домашним классом в элементах. Pa čak i autombili koji mogu «dati ugao» — kao npr. Ово е главна разлика изме ню овог стила и свих оставшихся — универзальна я и ограничена само с неколико критерий. Zato njegove manifestacije u različitim oblicima postoje u svim krajevima planete. Većina automobila

Najvjerojatnije ste došli na ovu stranicu zbog zahtjeva u tražilici: Шта такав Став (Став)? «

Odgovor na ovo pitanje je vrlo jednostavan.Ova je riječ, poput mnogih других, došla do nas sa zapada, a odnosi se na automotivei svijet. Ako to objasnite prstima, doslovno će svaki englesko -ruski rječnik za vas prevesti riječ STANCE — као: став, положай, положай, а то и апсолютно точно, иер има израван на автомобильной смазке. Главни элементы таквог уганья су размак од тла, размак од тла, «уклапанье», врста овьеса, распоред котача у луковима, диски, параметры диска, омджер гуме итд. Kao što ste već shvatili, opći koncept ove riječi prilično je opsežan, pa je važno zapamtiti da uključuje mnogo različitih pojmova i other nijansi.

Стенс релятивно новая культура автомобиля «ниских» автомобилей. Do ovog termina stav uključuje gotovo sve car koji se mogu staviti na «trbuh» ugradnjom preklopnika (podesivi amortizer) or zračnog ovjesa.

uklapanje, rastezanje, ispiranje, statičko, spušteno, ubodno, zalupljeno, izbačeno, dekirano, ispušteno itd., Staticno, u vrećama su sve riječi i oznake iz kulture stava.

Gotovo smo sigurni da će vaše sljedeće pitanje biti: «Šta такав Арматура (установка)? «- Ovo je upravo lokacija kotača u luku automotivebila.Na to može utjecati mnogo faktora, počevši od ovjesa automotive, može biti statično zbog različitih spiralnih ovjesa (prevrtača) Или ovjes može biti zračni, takozvanao «zračni ovjost. Nadalje, bitna je širina diska, širina gume, pomak diska, postavke ovjesa, nagib itd. Поставки и параметры свих ових ставок омогучую вам да постигнет сохраненную прилагодбу (Fitment)

«Šta такав Развал ? »-
— ukratko, ovo je nagib kotača, mjeri se u stupnjevima, a u pravilu je najveća površina kontakta kotača s površinom dijela ceste moguća s njegovim okomibim priuulto nest, to jest.U praksi, međutim, to je moguće samo kada se vozite ravno po ravnoj cesti. U zavojima sil počinju djelovati na kotače automotivebila pokušavajući okrenuti kotač iz okomitog položaja или ga čak otkinuti s ceste. U ove svrhe, nagib управляющих котач на конвенциональным автомобилям, у почтку или нула или с малом негативном вриеднощчу. Подесиве полуге даю добре результат за негативни нагиб. У нашей с вами повести камбер коридор за укладку и положай котача на возилу.

Lowdaily Najveći je neprofitni projekt u Rusiji i ZND-u, koji je informativni blog o разноликости культуры ниских автомобилей широм свиджи.

«Pokušali SMO proširiti informacijsko полье Koje JE Насим sugrađanima и доступно, тако да JE količina Informacija Koja себе może dobiti на našem resursu била dovoljna да formira ispravno mišljenje ZA св Кодзи ZELE razumjeti suštinu Kulture» — Илья Шимановского

Stancepedia je Stance Enciklopedija u kojoj ćete pronaći sve korisne informacije. Ako želite razumjeti uvjete i razumjeti odakle trebate započeti da biste sastavili moderan automotive, došli ste na pravu stranicu! Ovdje ćemo objavljivati ​​posbna izdanja posvećena STANCE temama.

Prvi dio — Diskovi

Први видео у нашей серии, наравно, посвечен дисковым и нжиховым правильным избору!
Подсветник за почтой: *

  • «ET» — помак диск, удаленость у милиметрима од оси симметрия диска од равнине спаяня (контактна равнина)., Место у милиметрима (ET + 12)
  • «J» облик прирубника, мьеро у инчима (9,5J)
  • «PCD» — или «bušenje», главный параметр, gdje je prva vrijednost broj rupa, a other njihova radijalna udaljenost, mjereno u milimetrima (5 x 114,3)

Sve to vam omogućuje da razlikujete automotive na cesti od sive mase i učinite ga privlačnijim.

Šta je stav? Zapravo, ovo je vrlo jednostavna riječ koju često koriste zapadni tuneri. Али zbog svoje jednostavnosti, nema analoga na ruskom jeziku, pa je za većinu domaćih entuzijasta zatvorena čitava linija usavršavanja njihovog automotivebila do zaista zapanjućeg izgleda. Recimo, na primjer, vidite Nissan Silviu S15 koja je pala na sam trbuh na parkiralištu trgovačkog centra, овако:

«Statički pad» — sa engleskog Statičko potcjenjivanje, preklopnici su instalirani na mjestu ovjesa stoka, to je također spiralni ovjes koji je podesiv u jednu željenu na visinsku pozicija ueda ueda kaj начин вожне за сваки дан, кажу да Дечки на статику имая гвоздена яя и да не извлаче чоколадно око приликом стругания автомобилей по асфальту или неравнинама, итд., ali samo prija prateće iskre ispod automobila i osmijeh s mišlju (o tome govorim) =) Любители культуры, позиция у своего автомобиля, позиция, намерно жртвую брзо и удобно кретанье по цестаме, лозая суточная проблема rupa, odajući počast stilu и kulturi općenito.

Zračni ovjes — od eng. jezik (Zračno ogibljenje) JE Jos Jedna mogućnost ZA spuštanje automobila metodom zračnih jastuka коджи су ispunjeni zrakom из- okretnog kompresora, коджи VAM omogućuju да у било kojem trenutku podesite Размак од vozila контролом ključeva из- unutrašnjosti automobila Kao у najniži položaj, zapravo leži с cijelim trbuhom i pragovima na tlu iu tijelu podizanja automobila do slobodnog prostora većeg od početnog, zračni ovjes ima svoje čari ljepote, sjaja i praktičnosti za svaki dan i ovo očarava mnoge.Korištenjem zračnog ovjesa ne možete postići baš cool Fitment, na primjer, kada rub luka leži između ruba diska i gume, это nije lako postići na statičkom padu.

Фитинг — дословно с англеског. jezik (komad namještaja) je položaj kotača u odnosu na luk.

Mnogi ljudi se pitaju kako postići savršenu prilagodbu i koji promjer, pomak i širina naplataka trebaju biti, koja veličina gume bi trebala biti prikladna i aso saznati ove čarobne brojeve? postoje neki mali koraci ka zacrtanom cilju — prvo morate odrediti koja će vrsta potcjenjivanja biti.- bit će određeno s približnim promjerom za najveći pad i pomak diskova po vašem mišljenju. — на ispod podignute mašine postavljamo disk bez gume i ispod njega postavljamo, na primjer, ploču i malo je spuštamo dok ne dodirne rub luka, ovako možete odrediti ispravan odlazak koji vam je potreban. — ako trebate jači negativni nagib, možda ćete morati kupiti poluge nagiba (šipke)

Fitment je sastavni dio Stanca, u kombinaciji s ekstremnim podcjenjivanjem, koje vam omogućuje da autombil pretvorite u zadivljući izgled i izdvojite se iz sive po gomile, prisiljava, котор нужно найти, чтобы открыть окно, котор нужно выполнить. смотри — размак измелю точкова — дословно с англеског.jezik (prekid kotača) je udaljenost izmeu luka i kotača, prisustvo ega jednostavno nije dopušteno u Fitmentu, jer se gubi suština i njegovom prisutnošću teško je nešto javelis to «Fitment». Зове се «культура става». Включите VW, ВАЗ, Опель, BMW и оставьте рынок и модель автомобиля, коди сэ држе у заедничкой традиции — исправные котировки и пристаянье, као и присутствие раскости, которую можно найти в автомобиле, можно найти. U kulturi Stance takvi dodaci vanjštini dopušteni su kao «skromni» komplet tijela koji ponavlja linije tijela i nije uočljiv na prvi pogled, bilo da se o usnama, razdjelniku koseompled it., sve bi trebalo biti umjereno i ne prkosno, različite boje nisu dobrodošle ala dvije pruge po dužini karoserije i hrpa šuškanja na kolicima, automotive bi trebao izgledati «cisto» i «jednostavno».

Recimo, na primjer, vidite na parkiralištu trgovačkog centra automotive koji je pao do samog trbuha, ovako:


Šta je stans i ko se može smatrati osnivačem kulture? Izuzetan auto-styling изумили су тюнери из Японии.Нет, inovatori iz Amerike doprinijeli su širenju i popularizaciji kulture. Kretanje stava ukorijenjeno je u практической употребления широких негативных предыдущих котач.

Sedamdesetih godina prošlog stoljeća u europskim zemljama proizvoači Porschea i Turba počeli su koristiti negativne nagibe i široke kotače za stvaranje široke tračnice za car. Inovacija garantuje sigurnu stablenost u zavojima i bolje prianjanje na stazi.

Gumena «kuća» na diskovima — характеристика современного kretanja stava, prvi su put koristili Japanci 1980.Година. Međutim, u Europi je široka «kućna» guma bila povezana sa DUB stilom. Američki tjuneri kombinirali su evropski DUB i japanski stense, stvarajući novu generaciju plišane karoserije, niskog stava i mirne, odmjerene vožnje. Tako je nastala stans kultura.

Automobili Stens izraeni su u Plemenitoj strogosti, krajnji rezultat je kreativan Individualni rad, koji je razvio vlasnik i majstor servisnog centra. Ruski ljubitelji stacionarnih automobila, koji se često susreću s terenskim uvjetima, odaju počast stilu, namjerno žrtvujući brzo и praktično kretanje po localnim cestama.Сваки власник автомобила може научити шта е стиль шаблона. Модель, класа, старость, произношения не играю улогу. Zapanjući projekti stvaraju se i na minijaturnim Toyotama и na starim, dotrajalim sovjetskim automotive Zhiguli.


Šta je Stens? Став е зазор (слиетанье) автомобила и правил распоред котача у луковима. Modifikacija se sastoji u zamjeni opruga or korištenju vijčanih stupova. Ugrađeni su котачи с максимальным дозегом и оптимальным ширином, odabiru se gume niskog profila.Zatim se konstrukcija montira ispod lukova. Čini se da točkovi prerastaju u zajedničku cjelinu s karoserijom i efektno naglašavaju индивидуальность автомобиля. Как би автомобильный попримио тай непоновливи стиль у стилю стенса и постао 100% эксклузиван, додайе се каросерия коя ćе поволйно нагл.

Automobil sastavljen u stilu «stensa» stilski je osmišljen automotive sa kompetentnim rasporedom točkova u lukovima i ispravnim diskovima, gdje se dužna pažnja posvećuje prevjesu diska i njegovom urušavanan.Техничка реализации можно бити врло различита. Da biste ažurirali izgled svog modela, možete započeti s malim i isjeći opruge, ali stroj može postati nestabilan. Profesionalci приступают к монтажу на свеобухватан начин, поболщавую овьес, угольную додатне полуге, čahure. Ako je model automotive rasprostranjen u stilu šablona, ​​proizvoač može proizvesti odgovarajuće sastavne dijelove.


Эта модель в стиле стенс у моторного изображения Руси и како изгледа више нижняя тайна.Покрытие открытого моря, на главном судне:

1. Statičko potcjenjivanje: omogućena je samo mehanička kontrola slejetanja.

2. Пневматски smjer: montirani su sistemi, zahvaljujući kojima se krilo može podići u pokretu или «leći» на диске.

Među ljubiteljima vožnje nema high i niskih standarda ovjesa: automotive se može potpuno spustiti na tlo or pretvoriti u moćan SUV po porebi.

Ako želite da se vaš automotive ističe među sivilom grada — оставьте свое имя!

Mnogo je već rečeno o unutarnjem i vanjskom tuningu, o JDM Styleu и svim tim stvarima, ali danas ćemo se dotaknuti posljednje teme u vezi autombila i tuninga.Став Je izraz koji će danas postati hrana za razmišljanje.

Ukratko, Stance je sve vezano za slejetanje automotivebila. Izuzetno je važno shvatiti da ovaj stil ne uključuje podcijenjene vaze koje su danas popularne u narodu. По правилам, автомобильные коды на трбуху припадаю стиля Stance, коды на традиционных JDM, зар не?

Šta je tuning stava?

Ovaj «lažljivi» pogled naziva se Low Stance. Постой и супртна врста слиетанья, коя сэ зове Гей Стэнс, али за разлику од прве, овдье се повечава клиренс, уствари правечи джип од автомобила.

Odličan dodatak, pa çak i element stila Stance je другие стиль koji se zove Hella Flush. Главне разнится овог стиля су диски великог промьера са гумама ниског профила, као и уске гуме на широком ободу. Glavna značajka ovog smjera je da kolaps postaje izrazito negativan. Izgleda vrlo lijepo i neobično.

Stance Style — это тренажерный зал, популярный стиль автомобиля. U slučaju da ste spremni nositi se s beskrajnim problemima u Obliku rupa, naleta brzine и других неволя, ako ste spremni odustati od brze vožnje, ako vam je izgled i «nadmašivanje» automotivebila ses javnostijožnija vaa культура, već i njenim представником.

Činjenica je da u Rusiji nema analoga ovoj jednostavnoj riječi (Stance), pa je za mnoge domaće vozače pristup reviziji i «dovršavanju» njihovog automotivebila do idealnog stanja zatvoren. Stoga postoje sve vrste «pogrešnih smjerova» povezanih s «dječačkim» podešavanjem domaćih automotivebila.

S druge strane, promjena izgleda vašeg automobila, bez obzira na stil, košta, ali u svakom slučaju važno je znati kada stati, inače çete svoj automotive pretvoriti u «sveobuhvatnu».Известите властите заключек, али чините их тихо, као што раде сви паметни люди.

Прочтите такое

админ 2015-01-15T13: 50: 58 + 00: 00

Риеч ул.

Riječ stans na engleskom jeziku (транслитерация) — stans

Riječ strofa sastoji se od 5 slova: an n s s t

Značenje reči strofa. Šta je strofa?

Станца (нем. Stanza), strofa, stih, ponekad i cijela pjesma. iz strofa sa potpunim sadržajem («С.» Пушкина).У ближем смысла, С. се назива. традиционна строфа у облику октаве од 5 или 6 стопа джамбова, ина октаве.

Брокгауз и Ефрон. — 1907–1909

STANZA je izraz izveden iz talijanske riječi stanza, što znači zaustaviti se. Ponekad se ovaj izraz općenito primjenjuje na bilo koju strofu. Ponekad se primjenjuje na oktavu (vidi ovu riječ). У другом смислу ньене строфе — пьесма …

Književna enciklopedija: Rečnik književnih pojmova

Stans (italijanska strofa — остановка) — u širem smislu, strofa, stih; ponekad se S.naziva cijela pjesma, koja se sastoji od strofa sa potpunim sadržajem («Пушкинове строфе»).

Enciklopedijski rječnik F.A. Brockhaus i I.A. Ефрон. — 1890–1907

«Станце» («Odmah trčite umom»)

«СТАНС» («Odmah trči sa umom»), стих. рани Л. са характерным овог раздобля стваралаштва мотив разочаранья у животу, обмане у любави: песник, такоречи, сажима драмско. историю вашег односа в воленом особом.

«Станце» («Волим кад се борим дух»)

«СТАНЦЫ» («Волим кад се борим душом»), рани стих.Л. (1830). Tematski stih. — склонность сузама делать према «земальским» осьедзима. Svaka od tri strofe sadrži detaljno poreenje — tehniku ​​koja se često nalazi u L.

Лермонтовская энциклопедия. — 1981

«Станце» («Погледай како су ми очи мирне»)

«STANCES» («Pogledajte kako su mi oči mirne»), jedan od najranijih stihova. L. (1830), upućen E. A. Sushkovi и диктиран osjećajem ljubomore i razočaranja. Uključujući i ovaj stih. У своим воспоминания о Л. (1875), Сушкова я написала…

Лермонтовская энциклопедия. — 1981

«Stanze» («Ne mogu da čamim kod kuće …»)

«STANS» («Ne mogu da čamim kod kuće»), стих. рани Л. (1830-31). Адресирано на Н.Ф. Иванова.

Stance & Fitment na primjeru Auto RightRide

U stih. pronašao izraz osjećaja usamljenosti i neuzvraćene ljubavi, koju mladi pjesnik ne može zaboraviti i od koje ne može pobjeći.

Лермонтовская энциклопедия. — 1981

«Strofe do D ***» («Не могу то изговорити»)

«STANCES TO D ***» («Ne mogu reći»), стих.рани Л. (1831). Prema pl. характеристика дневничкого характера; izražava prije osjećaj divljenja i divljenja nego strast ljubavi …

Лермонтовская энциклопедия. — 1981

«Stanze» («Predodređeno mi je da volim do groba»)

«STANCES» («Suđeno mi je da volim do groba»), stih. рани Л. (1830. или 1831.). Джедан од првих эксперимента у развою тему демона. особа осущена на усмотрение и патню (…

Лермонтовская энциклопедия. — 1981

руски йезик

Морфемийский и правописный рэчник.- 2002

Станс, -а (строфа).

Pravopisni rječnik. — 2004

Znojenje je prirodan process u ljudskom tijelu. Али не остаётся увийек незапажено. Osim žutih mrlja na odjeći, znoj može osjetiti i poseban miris, uzrokujući puno neugodnosti osobi. Kozmetika nudi široku paletu proizvoda za znojenje i njegovu «aromu». Jedan od njih je dezodorans u stiku protiv znojenja.

Šta je to?

Stick je dezodorans protiv znojenja u Obliku štapića, tvrde konzistencije.Njegova je svrha blokirati znojne žlijezde i spriječiti rast bakterija. Произведение обнаженной štap i za žene i za muškarce. Lako se koristi i može se nositi bilo gdje u torbici.

Testovi su pokazali da je prilikom nanošenja štapića protiv znojenja koža prekrivena nevidljivim talkom koji upija vlagu i smanjuje rast bakterija. Djelovanje takvog filma dosže dva do tri sata, nakon čega se smanjuje učinak talka.

Vanjski izgled vozila, modifikovan u stilu Stance, odmah ga izdvaja od ostalih tjuniranih automotivebila.Na prvi pogled, ništa komplicirano ne nastaje tijekom revizije: ovjes se spušta, ugrađuju se novi diskovi, a negativni nagib postavlja se na jednu od osovina. Чак се и облик лукова котача не мора миеняти. Я препоручу себе да себе такой параметр као это je vanjski promjer diska ostavi u razumnim granicama. Эти потребно доводити до максимума это это стиль Stance. Vlasnik će sam moći izvršiti sva poboljšanja. Naravno, osim ako su cijene za kotače s krakovima koje proizvode samo dvije или tri kompanije zastrašujuće.

Minimalne promjene u standardnom dizajnu i maksimalne emocije

Guma niskog profila postavljena je najširi obod povezan saredišnjim diskom pomoću čeličnih jbica. Альтернативно, средние диски, конструкция на озере Ливане. Присутсвие широких гума ниског профила smanjuje držanje na cesti i postiže se negativno naginjanje kako bi se nosili s neželjenim posljedicama. Као результат тога, сви они коджи погледаю измейжено возило немаю сумма: испред нджих е власников «другие» автомобили.

Moderan, potpuno redizajniran automotive

Podcjenjivanje ovjesa, kada je u pitanju ozbiljno ugađanje, gotovo se uvijek izvodi. Али поанта ове revizije je poboljšati izgled, ništa više. Prilikom preinake automobila u stilu Stance imajte na umu sljedeće:

  • Točkove sa aluminijumskim, pa čak i magnezijumskim naplatcima najbolje je profustiti avijatičarima;
  • Samo zamjenom opruga možete postići malo. Da biste podcijenili uklapanje za više od 20-30 мм, ugrađeni su podesivi vijčani stupovi;
  • Nakon što ste kupili vlasničke stalke s vijcima, prvo postavite sve matice za podešavanje u željeni položaj.Činjenica je da se nakon instalacije gubi pristup podešavanju;
  • Često se odlučuje napraviti podesive stupove od običnih. Затим се «стакло» с навоем завое на тиело амортизатора. Vjerojatno nema potrebe objašnjavati kako prijeti uništavanje takvih Struktura (vidi donju sliku).

Stil Stance izmišljen je u Americi. Али тамо о нджэму кажу овако: у реду е ако не разумийеш. Općenito, sve izgleda odlično ako ga ima netko други. «Не требуется нам ово» — овако можно превести израз коди е овдье дат.

Domaći podesivi nosači ovjesa

Recimo da se vlasniku umara vožnja tjuniranog automotivebila. Tada ćete morati izvršiti radnje: vratiti vrijednost kuta nagiba na standardnu ​​vrijednost, ponovo instalirati tvorničke podloške, promijeniti diskove. Учтите уганя могу себе уклонити, это различное подешаванье у стиля Позиция соревновательных методов.

Све наведено у овом поглавлять почтово е релевантно послеследних годов. Ranije je riječ «Stance» korištena samo za označavanje promjene u fit tijelu.

Odabir odgovarajućih nijansi boja

Nakon što ste maksimally podcijenili svoj cars, glavna stvar neće biti odlazak na Susjednu Struju, koja se zove riječ «Bosozokuvi» i pojav se. U nastojanju da ostanu unutar «klasičnog stava», nema smisla instalirati dodatne spojlere или druge dijelove koji služe za poboljšanje aerodinamike. Ne možete koristiti nikakve kisele boje, kao ni nijanse koje izazivaju asocijacije na Plastiku. Ako ugađeni automobil nalikuje transformatoru, чтобы узнать да je postignut pravi učinak i napravljeno je još jednoremek -djelo u stilu Bosozoku.

Стиль Bosozoku primijenjen je na Toyotu Soarer limuzinu

Većina izvora sugerira da se sljedeći automotive dobro podnose promjeni u stilu Stancea:

  • Sportski Automobili japanskih marki;
  • Сви лимузины средние величины с большим снагом мотора за почту;
  • Готово автомобильный рынок Volkswagen;
  • Разни модели BMW -a.

Ovdje navedeni podaci sami po sebi razumljivi. Međutim, nitko se ne trudi provesti kompetentno podcjenjivanje «41.Moskviča «:

Hečbek AZLK 2141 — svi znakovi Stansa na lageru

Prilikom poduzimanja prvih koraka u automatskom podešavanju, bolje je početi s nečim što je moguće početi s nečim što je moguće početi as 2101, nazatier moscow. u spuštenoj verziji

Praktičnost gore navedenih poboljšanja je upitna.Sretno ugađanje!

Познать видео запись: ВАЗ-2109

Fazat kryesore të përpunimit Zgjedhja e hijeve të ngjyrave të përshtatshme

Më shumë gjasa në këtë faqe ju keni rënë me kërkesë në motor kërkimi: çfarë Столис (Кендрим)? «

Përgjigjja Kjo pyetje është shumë e thjeshtë. Kjo fjalë është si dhe shumë të tjerë на erdhën tek ne nga Perëndimi dhe i takon botës së makinës.Нэсе шпджегони нэ гиштат, атёхерэ фьялэ пэр фьялэ чдо фьялор англишт-рус до тэ трансфероджэ ю фьялэн кендрим — си: нджэ рафт, позитэ, позитэ, дхэ штэ мжафт эджэрдэджоэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджэджоэджэджэджэджоэджэджэджэджэджэджоэджэджэджэджэджэджоэ Elementet kryesore të akordimit të Tillë janë pastrimi i tokës, pastrimi, «ulje», një lloj pezullimi, vendndodhjen e rrotave në harqet, rrotat, parameter e diskut, raporti i gomës dhe kështu me radhështu me. Сич е куптони ташмэ концептин е пёргджитшэм тэ ксай фьяле штэ мьяфт и гджерэ, прандадж штэ и рендэсишме тэ мбани менд се перфшин шумэ концептэ тэ ндрышме тхе ндрышме дхе.

Muret — Kjo është një kulturë relativisht e re e automotivebilave të makinave «të ulëta». Pör këtë term qëndrim Pothuajse të gjitha makinat mund të bashkëngjiten në «кора», герцог pёrdorur instalimin e Coilovers (амортизатор и rregullueshëm) ose pezullim pneumatik.

pajisje, shtrirje, rrafshuar, statike, ulur, poke, slammed, hedhur, zbukuruar, rënë, etj, statike, çanta — Kjo është e gjitha pörkufizimet dhe përcaktimet i kënduruar.

Ne jemi pothuajse të sigurt se ju do të keni pyetjen e ardhshme: «farë Pajisje (Монтим)? «- Kjo është vetëm vendndodhja e timonit në harkun e makinës.Kjo mund të ndikojë në shumë faktorë, герцог filuar nga pezullimi i makinës, mund të jetë statike në sajë të pendantëve të vidave të ndryshme (Coilovers) ose pezullimi mund ashatihequérulla, ijë Cili në Rusi është ende keqardhje, është e rrallë. Tjetra, gjerësia e diskut, gjerësia e gomës, largimi i diskut, cilësimet e pezullimit, kolapsi etj. Cilësimet e pezullimit, kolapsi etj.

«Фарэ Xhungë ? »-
— Me pak fjalë, kjo kolaps i timonit, ajo matet në gradë, dhe si rregull, zona më e madhe e kontaktit të rrotave me sipërfaqen e pjesës së rrugës është e mundur me pozicionin e mundur me pozicionin.Megjithatë, në praktikë është e mundur vetëm kur lëviz në një vijë të drejtë në një rrugë të sheshtë. Kur kthehen në rrotat e makinës, pikat e forta duke u përpjekur për të hequr rrota nga pozicioni i saj pingul ose madje heqin rrugën. Për këto qëllime, rënia e rrotave të kontrolluara në makinat e zakonshme bëhet fillimisht ose zero ose me një vlerë të vogël отрицательный. Rezultatet e mira për kolaps negative japin leva të rregullueshme. Në Historinë tonë, kolapsi përdoret për të përshtatur këmbët dhe vendndodhjen e timonit me makinë.

Lowdaily. — Ky është projekti më i madh jo-komercial në Rusi dhe CIS, i cili është një blog informacioni për diversitetin e kulturave të ulëta të makinave në mbarë botën.

«Ne u përpoqëm të zgjerojmë fushën информативный që ishte në dispozicion të qytetarëve tanë, të cilët do të ishin sasia e informacionit që mund të merret në burimet tona ishteme e mjaurë e mjaurë du mjaurë du mjaurë du mjaurë du mjaurë dj »- Шимановский Илья

StancePedia është një enciklopedi në muret në të cilat do të gjeni të gjitha informatat e dobishme.Нэсе дони тэ куптони куштет дхе тэ куптони псе духет тэ филлони нэ мэнирэ кэ тэ мбледхни нджэ макинэ элегантный — атехерэ ю шкуат нэ факен е духур! Коту до тэ publikojmë një çështje të veçantë kushtuar qëndrimit të subjektit.

Pjesa e parë — disqe

Videoja e parë nga cikli ynë është i dedikuar për sigurisht disqe dhe zgjedhjen e tyre të duhur!
Памятка для звезд: *

  • «ET» — диск и нисджес, дистанция нэ милиметра тэ боштит тэ симетрисэ сэ дискут нга авиони и авионит (аэропланы и пёрштатшэм)., Matet në milimetra (et al. + 12).
  • «J» — forma e bërthamës së skajeve, matet në inç (9,5J)
  • «PCD» — осе «шпим», параметр крисор, ку влера и пара ште нумри и вримаве, дхе дистанция и диале матет нэ миллиметра (5 x 114,3)

Ка шумэ стиль автомобилистики .. пор нэ кэтэ момент мэ популярный стиль и станс.
Elementet kryesore të qëndrimit të kulturës po ulen (pastrimin) e makinës dhe vendndodhjen e timonit në harqe.
Qëndrimi я kulturës qëndrim në МЯКИННА е шины të qëndrimit «ах sakrifikojnë меня vetëdije lëvizjen х shpejtë ДНО komike në rrugë, ngadalë dërrmuese përmes policisë С.Е. gjumit, të ballafaquar меня Probleme në FORMEN е rrugëve të këqija ДЕНЬ të tjera kardybin, герцог я dhënë haraç стильт дхе культурес си нджэ э тёра.
E gjithë kjo ju lejon të theksoni makinën në rrugë nga masa gri dhe ta bëni atë më tërheqës. Dhe në fakt, makina është bërë me makinën: zëvendësimi i burimeve ose një version pak më i shtrenjtë — vidë, rrotat janë zgjedhur me largimin maksimal dhe gjerësinë e zgjedhur me largimin maksimal dhe gjerësinë e zegésinë e prangeshtur, gjédésinë e pranueshtur, gjomedésinë e pranueshme gjithë kjo është instaluar në makinë, të përshtatur nën harqe dhe kolapsi është bërë në mënyrë që këto disqe më të përshtatshme. Përveç stilit, mund të shtohet një скромный (nënvizues).Pas gjithë kësaj, makina fiton të njëjtën stil qëndrimi që u konceptua nga pronari i makinës. Tani mund të jeni i sigurt se makina juaj është bërë unike dhe 100% nukshtë e humbur në turmë.
Ka shumë terma në këtë lëvizje, këtu janë detajet e tyre dhe çudi:
WAYTHERS (FLIPER) — Me pak fjalë, këto janë goma të autombilave (dhe joë vetëm, giritan ojë një, gäjë tjë, qjë tjë, qjë тэ пэрбэрэ нга гоме тэ бардха. Шумэ габимишт мендойнэ се ёште ветэм боджэ э кэшту ме радхэ.Ndonjëherë ata quhen edhe Weitbores ose Weitstraep, ndryshimi është vetëm në gjerësinë e rripit të gomës së bardhë.
Тани Вайцоллат хен të njohura jo vetëm në Perëndim, por edhe kudo. Не thelb, Vaites janë instaluar si në klasike perëndimore dhe në klasike të industrialrisë së autombilave ruse — Москвичи, Волга, Жигули, дхэ ТД.

Vip (VIP) — Ky është një lloj i veçantë i akordimit të makinave, i cili me kalimin e kohës ka një studim në një kulturë të veçantë të makinave.Shfaqja и стиль VIP është e lidhur me zhvillimin e skenës JDM. Линджа э нджэ стили тэ ри би нэ филлим тэ витеве ’90 тэ шекуллит тэ нджезетэ, законишт и пэрмбахен ди версияев тэ shfaqjes së BIPKU.

E para është e lidhur me mafinë japoneze të Yakuzës, besohet se hipur mbi sedanët luksoze evropianë tërhoqi shumë vëmendje nga policia, kështu që anëtarët e Yakuzës podiské

Versioni я dytë я referohet всадников rrugëve të Осаку, я Cili PER shkak të garave të përhershme të paligjshme përgjatë autostradës Hanshin gjithashtu filluan të tërheqin vëmendjen х policisë, atëherë ата у zhvendosën нг NJE купе спортивного PER седаны të медха, të cilat у rafinuan në stilin e mercedes- AMG.Grupi i parë Vip i EniuziaStov рассматривает эту возможность, как и все, что вам нужно, чтобы найти Nissan Cima, Nissan Cedric, Toyota Celsor на Toyota Crown. Përpunimi kryesor me tuning të tillë shqetëson pjesën e jashtme të makinës. Karakteristikat dallalian: ulja shumë e ulët e makinave (spirale ose pneumatike), disqe të mëdha dhe shumë të gjera për instalimin e të cilave shpesh duhet të përdorin përsosjen e krahëves shreptë, китэпсэпес рэптэс нэ китэпсэвэ рэптэс , Системы и класс сэ lartë audio.Megjithatë, gjëja më e rëndësishme kur akordimi VIP e bën makinën sa më të ulët të jetë e mundur, герцог и башканджитур кешту ульдже të drejtë (qëndrimë) dhe të vendosë rrohata, të vendosë rrohata, të vendosur rrohata. З. Такей, пронари и крикезимит продхон, дикур вури нэ дукдже: «Стили Вип është një ulje dhe rrota, gjithçka tjetër, герцог përfshirë kit të trupit — vetëm pajisje». Мирэ, gjithnjë e më shumë njerëz kanë tërhequr në një kulturë të re që kaloi oqeanin Dhe gomar në SHBA, Malajzi, Gong Kong dhe vende të tjera, kështu që me kalimin Ifa e kështu që me kalimin Ifa BB , Honda Fit dhe të tjerët).Markat, европейский (Mercedes-Benz, BMW, Jaguar), канал bërë gjithashtu të rafinuar në stilin Vip. Pavarësisht nga fakti se pothuajse të gjitha llojet e bodys makinave në një mënyrë apo në një tjetër janë akordim në stilin Vip, vetëm sedans të mëdha, минивэны dhe kei eonsidera vip, témédha%, минивэны dhe kei eonsidera vip, тёкэя makidera makidearé java të thërrasin VIP të frymëzuar.

Jip, zhyyyyyp — NJE MAKİNE QE sipas mendimit të të tjerëve NUK përshtatet në kuadrin е «makinave të Uleta», pavarësisht нга lloji я trupit, pavarësisht Neşe еште edhe NJE konvertueshme, kriteri kryesor еште pastrimi ДНЕ çfarë еште М.Е. пак, ак мэ и мадх штэ гджасат се кджо макинэ нук до тэ фьен термин «шип».

Jdm (jdm) — Tregu i brendshëm japonez (английский. Tregu i brendshëm japonez ose tregu i brendshëm japonez) është një term i zakonshëm për makinat (si mallra të shitura. Zakonisht, modelet e makinave të destinuara për Japoninë ndryshojnë nga të njëjtat modele të destinuara për tregje të tjera, ose fare nuk kanë analoge të huaja.

Кокс — Kjo është një makinë e destinuar për pjesëmarrje në garat sportive dhe nuk ka për qëllim të lëvizë nëpër qytet, premium i këtij termi në legen e vrarte me.

— Opsioni kur pragu është paralel. Обратные грабли (frëngjisht) — mbrapa e makinës nën pjesën e përparme. Дрейт (калифорнийский) rake — para e makinës nën pjesën e pasme

Rrotë — Ky është një ndryshim në gjerësinë e diskut të çelikut (vulosjes), герцог e kthyerdimin shiritin nöse. Ташмэ шумэ е динэ се «дворники» është një emër zhargon и disqeve të gjera të çelikut. Шпеш нэ вендин тонэ эмри и тире энде штэ вуулосур дискэ осэ «вуулосже» — штэ пэр ато чжанэ тэ законшме тэ цилэ тэ энде нук джанэ берэ житэсит тэ гьерэ.

грабли (Rake) — anim gjatësorin e makinës, то есть Sa saktësisht është në krahasim me tokën.

Rat-look (крысиный) — (nga rat — miu) është mjaft më i lëvizjes së resto. Пор нэ кэтэ раст, кжо нук штэ боу-харк, и чили штэ тельбэсор дхе штэ и нджохур пэр тэ гджитэ — боджэ тэ зезэ мат дхе рат предж пелуши нэ торпеда — дхэ левизшт э духур. Parimet themelore janë të njëjta: pamja origjinale, e brendshme dhe gjithçka tjetër. Ветэм нэсе, нэ растин э нджэ ресторанти, макина дукет си нджэ э ре, ме нджэ кром тэ тмерршэм дхе боджэ ме газ, атехерэ макина э рат-харк ка нджэ труп паши штэ бэрэ эджатэ гжатэ пара вите.Дхе нук ка рендэси се шфара штети штэ: нэсе макина иште герцог кендруар пэр нджэ кохэ тэ гжатэ нэ гараж дхе ветэм плюхур осе штрирэ нэ оборрин э нджэ фершом дхендри. Por rregulli i vazhdueshëm është rivendosja e plotë e të gjithë mbushjes teknike. Pezullimi, Fundi, Motori — fjalë për fjalë gjithçka i komunikohet gjendjes së një makine të rinovuar plotësisht. Trupi është gjithashtu i riparuar, por vetëm kur nuk do të jetë e dukshme — në harqet me rrota, brenda kabinës dhe vende të tjera të ngjashme.Salloni zakonisht është larë thjesht dhe është lënë siç është. Я мотор, ситуата ёште мне е компликуар. Nga njëra anë, mund të korrespondojë me trupin — të jetë i ndryshkur dhe i pluhurosur, nga ana tjetër, mund të pastrohet për të ndriçuar. Por domosdoshmërisht rinovuar deri në gjendje të plotë të punës.
Pretty popullor është stilizimi nën bark. Kur trupi pas restaurimit të plotë është dhënë qëllimisht: ose me ndonjë material gërryes dhe kimik, ose në kurriz të pikturës speciale. Rrotat, aksesorët dhe çdo gjë tjetër në mënyrë të ngjashme me style resto-cal.

Stickerbomb — Fillimisht, tema japoneze e drejtimit dhe është në të lashtat luftarake që aplikohen periodikisht për muret dhe makinat e tjera. Pra, për të mos riparuar të gjitha këto mbretër shpikur Stickerbombom dhe Ziphai (зажимы që riparojnë parakolp kur ata shpërndahen nga goditjet), стикеры по биседойнэ në ato vende që thjëde

Sittens (qëndrim) — герцог кендуар ульен э макинаве.Pozicioni i ndërsjellë i rrugës, rrotave dhe trupit.

Stritzrar — Стритрейзер. Karakteristika të veçanta të makinës së pasazheve mesatare të rrugës — për të derdhur në makinën e tyre që ra, një popullaritet i veçantë i AK-47 наклейки, noggano, etj. Ndonjëherë ata instalojnë flukse të drejtpërdrejta në makinën e tyre, ka sigurisht ndryshime serioze në motor. Gjithashtu, një element i veçantë është instalimi i një sistemi audio të fuqishëm, i cili ndonjëherë është dy herë, dhe madje edhe më shumë herë mund të tejkalojë koston e vetë makishëm.Në përgjithësi, ju mund të shkruani për strTitsrakov për një kohë të gjatë dhe me të vërtetë.

Shtrirje — Gomat e shtrirë (shtëpi)

Pajisje — Thelbi i karakteristikës që përcakton pozitën e timonit në krahasim me trupin (në veçetanti krajutë, skajutë. Artikujt kryesorë që formojnë pajisje:
kompensimi i rrotave dhe gjerësia — Shkarkimi dhe gjerësia e timonit,
fender hendek. — Largësia nga buza e diskut në buzë të krahut,
bus Stretch & Profile — Profili dhe shkalla e shtrirjes së gomave.Në të njëjtën kohë, vetë pajisja, në kombinim me pastrimin, përbën një ulje të një makine, të referuar si qëndrim i shokëve të gjuhës angze.
Është logjike të supozohet se, pasi që çdo makinë ka rrotat, pastaj këmbët. Megjithatë, ndarja eiplomave ose niveleve të monitorimit të njohur nga lëvizja e ulët, dhe natyrisht, vlen të flasësh për fitmanin vetëm nëse makina është nënvlerësuar.
Llojet e pajisjes:
Tucked in. — Kur madhësia e harkut nuk lejon të akomodojë timonin, dhe do të mbyllet nën krahun.
Një kombinim i Tillë gjendet kryesisht në Veedub-Ah, në makinat VIP me një pezullim pneumatik ose, për shembull, në Resto të ulët, Жигули.
Промывка. — diçka e ngjashme me rusisht «Flush», por pak ndryshe. Rrota me një gomë duket të vazhdojë formën e krahut, ose është në një vijë vertikale me buzën e saj. Нэ тэ нджеджтэн кохэ, дистанча нэ мес тэ бузэс сэ дискут дхе крахут мунд тэ джетэ ррет гжисма и тхевитм, е цила джу леджон тэ пэрдорни макинэн чдо дитэ, осе, пер шембулл, пер.

Hella Flush. — Шкалла экстреме е радикалеве тэ фитме, кур бузэ э дискут осе гомаве анэсоре фьялэ пэр фьялэ феркон нэ бузэ тэ крахут.
Termi Hella në vetvete vetë është një fjalë sllanhenie, ndoshta imagjinar për disa Jerry në vitin 2003 dhe është rritur në një lëvizje të tërë me moton e kompensimit çë e rrotave të rrotave.
Megjithatë, ка эдхе проявление негативного тэ дэширес пэр нджэ гжерэси тэ турур, тэ тилла си шумэ тк осе мекси флеш — нэсе ррота першритет шумэ ларг нга харку.
Влен тэ пэрмендет се арритджа э «пэрштатджес сэ духур» нэ аснджэ мёнырэ нук ка пэр кллим (эдхе псе нук пэрджаштон) пэрмирэсимин е менаксхимит осе капачитетит тэ кхимит. Pajisja është veçoria e shfaqjes së makinës, jo më shumë.

Худрейд (удхетим ме капуч) — фраза «Поездка на капюшоне» мунд тэ интерпретатор ши нджэ «макинэ карку», «макинэ пэр тэ левизур ррет зонес». Shfaqja e makinës plotësisht korresponduar me frymën e stilin e rat-harkut: në disa vende në humbje dhe bojë me zë të lartë, gjurmë pothuajse të gjithë derën, pa çati, pavarjënda n të shkëlqyer, një numër i aksesorëve plotësuan pamjen e makinës.Në vitin 2004, Деррик Пачико (Derrick Pachico), i njohur si Dopebeat Derrick, erdhi i njohur. Njëri prej tyre, i cili e dinte pak Derrick vendosi të pyeste, në cilën makinë ai rides. Derrick tregoi atë Karmann Ghia, e cila ishte krejtësisht standarde, por në pezullimin më të ulët të mundshëm. Герцог паре макинен, бурри тха се фраза, нэ саджэ тэ сэ цилес левизджа дхе мори эмрин э садж: «Дерьмо нджери … штэ нджэ удхетим и вэртетэ!».
Pas një kohe, pas këtij takimi, Derrick hapi vendin dhe forumin, të quajtur hoodride.com. Kjo faqe duhej të bëhej një komunitet njerëzish për të cilët vetë makina është e rëndësishme, por dashuria e objektit të saj të transportit.
Çdo ditë pjesëmarrësit u bënë gjithnjë e më shumë. «Дудрид» не тэ иште йо ветэм пронарет е «плехрав» Фольксваген, пор пронарет джанэ миряфт мирэ герцог кэркуар «Фольксваген» пронарет и макинаве американе. Пор иште кешту ке иште се термины «худриди» штэ и лидхур ме макинат э лоджит тэ дишимта. Në Fund të fundit nuk është e habitshme — në Fund të Fundit, deponitë amerikane të makinave ishin burimet kryesore të «burimeve».Пор джо ато ку нумри и мадх и макинаве джанэ нгджитур дхе ата джанэ тэ штипур херэ па здесь, дхе тэ вогла, тэ вендосура нэ ферма осе нэ фуша осе нэ хамбаре тэ ветра.
Natyrisht, popullariteti kryesor i lëvizjes është përdorur, natyrisht, në Shtetet e Bashkuara. Нэ фонд тэ фундит, нук ка аснджэ инспектим тэ детируешем текник, дхэ нэ факт ю мунд тэ джени нэ тэ вэртетэ нэ гджитчка це деширони. Нэ Европэ, është më e komplikuar me këtë, prandaj, në botën e vjetër, njerëzit shpesh u kufizuan në zona të vogla të ndryshkut dhe mureve «Dudride» në kapuç ose trung kapak të.Дери нэ фонд тэ витит 2006, левизджа аррити кулмин е садж дхе популларитети и садж ташмэ штэ берэ нджэ ндиким негатив. Па у пикеллуар атэ që ата кишин, njerëzit filluan të gdhendin наклейки në luginën e Tire të ndryshkur dhe të nxjerrë muret «Dudride», edhe pse në fakt makinat e tyre nuk kishin ndonjë maréné. Pronarët e makinave të vjetra, të cilët nuk kanë fonde elementare për riparimet e tyre, vendosën që duke telefonuar makinën e tyre «Dudride», ата до тэ jenë më të të freskët dhe askushte nukhjeen do meë kisham.Në muajt e fundit të ekzistencës së faqes, ky fenomen ka fituar një karakter masiv dhe për të luftuar prapa nga ky imagjinare «Худрайдов» у bë e vështirë.

Dhe vetëm lëvizja e fundit erdhi në Rusi. Эдхе псе нук ëште левизур ас, пор ветэм эмри. Пор нэ тэ гджитэ филуам ме кэтэ, «Фалеминдерит», «дврид» вдик атдже — пронарет е лугит тэ ндрышкур вендосен се тани ата мунд тэ террасин макинэн и тире «Худрауд» дхе кренарэ пё кр йо тэ, дхе кренарэ пё кр йо тэ. Perspektivat për zhvillimin e lëvizjes në vendin tonë nuk është vërejtur, si, megjithatë, zhvillimi i stilin e miut është ende shumë i fortë «statusi» faktorë i makinës makinës shumë i fortë «statusi» faktorë i makinës makinës kërdnja në: vetës toretës kërdnjaku.Пак пер тэ cilët mund të vijnë në mendje që të largohen në një makinë të ndryshkur jashtë, ju mund të jeni pronar i një makine mjaft të mirë për çdo ditë. «Дудрид» нук është një стиль. «Dudride» ешт NJE язь, NJE protestë klasike Кундер sistemit, ndoshta пак наивная, НУК еште menduar plotësisht, Por Qe vjen нг ngurrimi я sinqertë я NJE personi ОСЭ Grupi të veçantë të njerëzve QE NUK JANE си të gjithë të tjerët.

E gjithë kjo ju lejon të theksoni makinën në rrugë nga masa gri dhe ta bëni atë më tërheqës.

Çfarë është qëndrimi? Në fakt, kjo është një fjalë shumë e thjeshtë, e përdorur shpesh nga tunerët perëndimorë. Пор нэ тйештэсинэ э садж нук ка аналог нэ русишт дхе пэр кэтэ арсие, пэр шумицэн е энтузиастэве вендас, нджэ дрейтим и тэрэ и пэрсосйес сэ макинэс сэ пэ штëр мбйтэр мбйтэ мбйл мбыл. Пэр шембулл, ю шихни нэ парковкаун е qendrës tregtare тэ мбисур нэ мэ тэ баркут Nissan Silvia S15, si kjo:

«Капля statike» — нг mungesa statike е gjuhës angleze, койловер JANE instaluar në Vendin е Варезе të aksioneve е Cila përshtatet меня NJE pozicion të dëshiruar, KJo mënyrë thotë себе Makina еште gjithmonë герцог lëvizur në NJE pozicion ДНО konsiderohet të Jete në европа Dhe gjendja më e vërtetë e tërheqjes së tërheqjes për çdo ditë, ata thonë se djemtë në vezët e hekurit statike dhe nuk lëkunden syrin me çokollatë me crackers e auto në päjëtë, néqë törheqë, nje néqë, nje néqë, nj? buzëqeshje mendim (që është duke folur për) =) qëndrimin e qëndrimit të kulturës në qëndrimin e Tire Car’ah me vetëdije sakrifikojnë lëvizjen e shpejtë djër e rrugëve të këqija dhe Koldybin tjera, герцог и dhënë haraç stilit dhe kulturës në tërësi.

Pezullimi ajror — английский. Gjuha (pezullimi Pneumatik) Ky еште NJE tjetër mundësi е heqjes С.Е. makinës меня metodën е jastëkëve pneumatikë QE JANE të mbushura меня ajër të kompresorit të Обряды дзю Лейон të rregulloni pastrimin е makinës në CDO KOHE герцог kontrolluar çelësat нга Kabina е makinës си në Pozicioni М.Е. я улет në të vërtetë я gënjyer në të gjitha barkut ДНО pragjet në Toke ДНО në Мишин е ngritjes С.Е. авто në pastrimin М.Е. të lartë себе rrjedha fillimisht, në pezullimin Pneumatik ка kënaqësitë е Сай të bukurisë, блеск ДНО praktike PER CDO Дите ДНО ATE Rryshfetet шумэ меня ndihmën е пезуллимит тэ аджрит ю нук мунд тэ меррни паджисже тэ vërtetë тэ фтохтэ пэр шембулл кур бузэ е харкут би нэ мес тэ бузес сё дискут дхе гомэс, э чритила нукрэ тэ нукэ тэ нукэ тэ нукэ тэ нукэ тэ.

Pajisje — fjalë për fjalë nga anglishtja. Gjuha (objekti i situatës) Ky është pozita e rrotave në krahasim me harkun.

Шумэ предж тире пйесин се си тэ аррийнэ пэрштатджен е персосур — дхэ чили диаметр, ларгим дхэ гжерэси э дискве дуэ тэ тэ джетэ, шфарэ мадхэси тэ гомэс духет тэ джетэ тэ гэршештатс Ka disa hapa të vegjël për objektivin e çmuar — së pari duhet të përcaktohet se cili lloj i nënvlerësimit do të jetë.- Përcaktuar me një diametër shembullor për rënie maksimale dhe largimin e disqeve sipas mendimit tuaj. — Në nën makinën e Dombracted, ne instalojmë diskun pa gome dhe e gjej atë nën atë për shembull një pjatë dhe ulet nga pak kohë, nuk do të prekë skajin e harkutny, është në lidhërë me невойитет. — Nëse keni nevojë për një kolaps më të fortë negativ, është e mundur të blini leva të palosshme (tërheqje)

Mesnoni NJE Komponent интеграла të Stanc-ЮВА С.Е. башка мне NJE nënvlerësim Экзотрет QE дзя Лейон të transformoni NJE MAKİNE në NJE vështrim mahnitës ДНО të Dale нга NJE turmë грите QE я detyron kalimtarëve të kthejnë KOKEN ДНО shoferët е thjeshtë PER të adresuar në LUME ДНО герцог у хапур годжет нга boshllëku и пара — фьялэ пер фьял нга англиштья.Gjuha (ndërprerja е rrotave) ешт distanca МИДИС harkut ДЕНЬ rrotave, egoja thjesht NUK lejohet në montim Паси thelbi еште я humbur ДЕНЬ ешт х vështirë të thërrasësh «qëndrimin» е pajisjes мне praninë е Сай — KJo еште е Tere Kultura х Makina të Uleta . Është quajtur «культура е qëndrimit». Ай перфшин VW, Ваз, Опель, БМВ дхе тэ гджита маркат дхе модель и тджера тэ макинаве, тэ гррюхуара нэ традита тэ пёрбашкета — дискет э духура дхе улджен, си дхе прания э нджа ршо лэджэ нджэ нджэ ршо лэджэ тэ.Në qëndrimin e kulturës, shtesa të Tilla në pjesën e jashtme si një kit i trupit «скромный» герцог përsëritur linjat e trupit dhe nuk është në shikim të parë në shikim të parë, njëzë paraë, ose njëzë плотэ нэ нджэ Ррети, этдж, гжитчка дуэ тэ тэ джетэ нэ модерим дхе джо шумэ ллогаритаре, улджет э ндрышме тэ ала ди корси нук джанэ тэ мирэпритур нэ трупин э трупит дхе нджэ бандэ эшротеарэ дхэ нджэ бандэ э Шеротрепа нэ нэ нджэ бандэ э Шеротрепа «пастер» Дхе «е тйештэ» тйешт е пастер.

Пер шембулл, ю шихни нэ парковкаун е qendrës tregtare të ashtuerdhur në makinën më të barkut, si kjo:

Historia e shfaqjes së lëvizjes së murit

Çfarë është Stans dhe kujt mund të konsiderohen themeluesit e kulturës? Шпикур тюнеры и авто из Японии. Por innologët nga Amerika kontribuan në përhapjen dhe popullarizimin e kulturës. Lëvizja е qëndrimit shkon rrënjët e saj në përdorimin praktik të rrotave të gjera me një largim negativ.

Në vitet ’70 të shekullit të kaluar në vendet evropiane, Porsche dhe prodhuesit turbo për krijimin e një gamë të gjerë auto, filluan të aplikojnë një kolaps negativ dhe rrota të gjera. Inovacioni garantonte stabilitet të sigurt të kthimit dhe rubinetin më të mirë në rrugën e duhur.

Gome «Domik» në disqe — një tipar dallues i lëvizjes së qëndrimit modern, u aplikua për herë të parë në vitin 1980 nga japonezët. Megjithatë, në Evropë, një gome e gjerë «shtëpi» u shoqërua me një stil dub.Tunerët amerikanë të bashkuar Dub dhe muret japoneze duke krijuar një gjeneratë të re të trupave luksoze, ulje të ulët dhe udhëtim të qetë, të matur. Pra, shfaqet stans kulturës.

Murs-auto janë kryer në ashpërsi fisnike, rezultati përfundimtar është një punë krijintage Individual që pronari po zhvillon dhe një mjeshtër i qendrës së shërbimit. Tifozët e makinave të qëndrimit ruse, shpesh përballen me jashtë rrugës, i japin haraç stil, герцог sakrifikuar qëllimisht lëvizjen e shpejtë dhe të përshtatshme në gjurmët lokale.E di se çfarë është stili mur, pronari i ndonjë makine mund. Modeli, klasa, mosha, prodhuesi i rolit nuk luan. Projektet mahnitëse janë krijuar gjithashtu në Toyota-X miniaturë, dhe për viktimat e vjetra të «Zhiguli» sovjetike.

Si të mblidhen në mur-auto?

Çfarë është muret? Qëndrimi është një pastrim (ulje) auto dhe rregullimi i saktë i rrotave në harqe. Modifikimi është të zëvendësojë burimet ose përdorimin e rafteve të vidë. Rrotat me largim maksimal dhe gjerësi optimale, janë zgjedhur gomat e profilit të ulët.Pastaj dizajni është montuar nën harkun. Rrotat, siç ishte, të rritet në një numër të plotë të zakonshëm me rastin dhe të theksojë në mënyrë efektive personalitetin e makinës. Në mënyrë që makina të marrë stilin më unik të murit, dhe u bë 100% exkluzive, shtohet kit, i cili përfiton avantazhet e tjera të një makine të përditësuar.

Макина э mbledhur në stilin e «mureve» është një makinë stilistik të zhytur në mendime me një vend kompetent të rrotave në harqe dhe disqe të drejta, ку и куштохет vëapsevemente dhehur disque.Mishërimi teknik mund të jetë më i ndryshëm. Për të rinovuar pamjen e modelit, ju mund të filloni me burime të vogla dhe spërkatje, por makina mund të humbasë stabilitetin. Profesionistët janë të përshtatshëm për Kuvendin, për të përmirësuar pezullimin, instalimin e levave shtesë, рукава. Nëse modeli i makinës është i përhapur në stilin e mureve, pjesët përkatëse të pjesëve rezervë mund të lëshohen në të.

farë duhet të jetë i vetëdijshëm për kulturën e kulturës?

Cila është stili i murit në lëvizjen e automotivebilave të Rusisë dhe çfarë duket — jo më sekrete.Левизья перфшин шумэ дрейтиме, мирэмбайтджа është:

1. Kuptimi statik: parashikohet vetëm rregullimi mekanik i uljes.

2. Дрейтими пневматик: система джанэ монтуар, нэ саджэ тэ сэ цилес крахут мунд тэ рритет нэ левизже осе «биен» нэ диск.

Ndër tifozët e lëvizjes nuk ka standarde për pjesën e sipërme dhe të poshtme të pezullimit: makina mund të zbresë plotësisht në tokë ose të kthehet në një SUV të sipas neqish.

Nëse doni që makina juaj të dalë në mesin e gropës urbane — mishëroni ëndrrat në realitet!

Шумэ ташме është thënë për akordimin e brendshëm dhe të jashtëm, rreth stilit JDM dhe të gjitha që, пор то не тэ преким темен мэ тэ фундит нэ лиддже ме макинат дхе акордимин.Qëndrimi është termi që sot do të jetë ushqim për refktim.

Nëse ju thoni të shkurtër, atëherë qëndrimi është gjithçka që është e lidhur me mbjelljen e makinave. Është e domosdoshme të kuptohet se ky stil nuk përfshin vazo të nënvlerësuara, të cilat janë të njohura tani popullore. Si rregull, stili i qëndrimit përfshin makina që lidhen fjalë për fjalë në bark, i ngjan një JDM tradicionale, apo jo?

Çfarë është akordimi i qëndrimit?

Një specie e tillë «e gënjyer» quhet qëndrim i ulët.Ekziston edhe lloji i kundërt i uljes së quajtur qëndrim homoseksual, por ndryshe nga e para, këtu ju rritni pastrimin e tokës, në fakt, герцог берэ нджэ макинэ шип.

Një shtesë e shkëlqyer dhe madje edhe element i stilit të qëndrimit është një stil tjetër që quhet Hella Flush. Даллимет криесоре тэ кетидж стили джанэ дискет мэ тэ медха тэ диаметрит меня гоме тэ профилит тэ ульет, си дхе гоме тэ нгуштэ нэ нджэ бузэ тэ гджерэ. Типари криесор и кешай дрейтими штэ се колапси бэхет шумэ негатив.Duket shumë e bukur dhe e pazakontë.

Style Style — это актуальный мэ популярный автомобиль. Në rast se jeni gati për të luftuar проблема e pafundme në formën e përzgjedhjes së rrugës, герцог gënjyer policinë dhe проблема e tjera, nëse jeni gati të heqësh dorë ngatim një udjë, phemë ngatim ijë udjë «и пхэмэ нджэ уджэджа», пхэтим нджэ уджэджа Трамп «Me makinën tuaj në publik, atëherë ju mund të përmirësoni veten tuaj jo vetëm një njohës të kulturës, por edhe përfaqësuesin e saj.

Fakti është se Rusia nuk ka analoge me këtë fjalë të thjeshtë (qëndrim), kështu që për shumë shoferistë vendas, qasje në rishikimin dhe «përfunduar» të makinës ejë tyre në Ideal. Prandaj, të gjitha llojet e «адаптации» duket të lidhura me akordimin «Patzansky» të makinave stëpiake.

Nga ana tjetër, герцог ndryshuar pamjen e makinës së saj, pavarësisht nga stili i parave, por në çdo rast është e rëndësishme të dini masën, përndryshe ju do ta ktshnithuaBëni përfundime, por bëni ato në heshtje, si bëjnë të gjithë njerëzit e mençur.

Lexoni gjithashtu

админ 2015-01-15T13: 50: 58 + 00: 00


Fjala stan letra britanike (përkthye) — станс

Fjala e stacionit përbëhet nga 5 shkronja: një n me t

Vlerat e qëndrimit të fjalës. Cila është stacioni?

Станца (Станца), Станца, Куплет, nganjëherë një varg i tërë. Nga structura me përmbajtjen e përfunduar («С.» Пушкин).Нэ нджэ куптим мэ тэ афэрт тэ С. Важив. Stanza tradicionale në formën e tetë klasave prej 5 ose 6 të ndaluar, përndryshe oktavë.

Brockauz dhe Efron. — 1907–1909

Stans janë një термин që rrjedh nga fjala italiane Stanza, që do të thotë të ndalosh. Ndonjëherë ky термин pёrdoret fare për çdo kokëfortë. Ndonjëherë aplikohet në oktavë (shih këtë fjalë) .. Në një vlerë tjetër të stacioneve të saj — стихотворение …

Enciklopedia letrare: fjalor i termave letrare

Станца (итал.Станца — Стенд) — në kuptimin e gjerë të Stanzës, një varg; Ndonjëherë C. quhet një стихотворение e tërë e përbërë nga një dizajn me përmbajtje të përfunduar (Stacioni Pushkin).

Fjalor enciklopedik f.a. Brockhaus dhe I.A. Ефрон. — 1890–1907

«Станс» («menjëherë drejtimin nga mendja»)

«Станс» («менджехере дрейтимин нга менджа»), варгу. Në fillim të L. Me motivin e zhgënjimit në jetën karakteristike të kësaj periudhe të krijimtarisë në jetë: poeti duket se është duke u përmbledhur në mënyrë dramatike.Tregimet e marrëdhënieve të утомляет меня të dashurit.

«Станс» («Люблю кур, герцог люфтуар мне шпирт»)

«Станс» («Унэ э дуа кур, герцог люфтуар ме шпирт»), аджетин э хершем. Л. (1830). Ajeti temë. — Preferencat e lotëve të «tokës» të lutjes. Secili nga tre Stanza përmban një krahasim të detajuar — притжа шпеш ndodh në l ..

Энциклопеди Лермонтова. — 1981.

«Станс» («герцог кёркуар си ситэ э ми тэ кэтэ»)

«Станс» («герцог кёркуар си ситэ э ми тэ кэтэ»), нджэ нга аджети и хершем.L. (1830), iu drejtua E. A. Sushkova dhe diktoi nga një ndjenjë e xhelozisë dhe zhgënjimit. Герцог перфширэ кэтэ варг. Në kujtimet tuaja të L. (1875), Сушкова шкрой …

Энциклопеди Лермонтова. — 1981.

«Станс» («Unë nuk mund të lëngojë atdheun tim …»)

«Станс» («Унэ нук мунд тэ ленгош нэ атдхеун тим»), варг. Не филлим тэ Л. (1830-31). Корниза, урожденная Н. Ф. Ивановой.

Qëndrimi dhe përshtatja në shembullin e auto rightrideve

Нэ варг Ата gjetën shprehjen е ndjenjës së vetmisë dhe dashurisë së paarsyeshme, poeti i ri nuk mund të harronte dhe nuk mund të shpëtohej nga K-Roy.

Энциклопеди Лермонтова. — 1981.

«Stans për të d ***» («Unë nuk mund të them»)

«Stans për të d ***» («Unë nuk mund të them»), варг. Не филлим тэ Л. (1831). Në MN. Шенджат кане нджэ карактер дитар; Аджо шпреху нджэ ндженджэ адмирими дхе адхурими шеша нджэ пасион дашури …

Энциклопеди Лермонтова. — 1981.

«Станс» («për të dashur për varrin e krijuesit të destinuar»)

«Станс» («Të duash për varrin e krijuesit të destinuar»), варгу.Në fillim të L. (1830–1831 гг.). Një nga eksperimentet e para për të zhvilluar temën demonike. Личное, i dënuar për vetminë dhe vuajtje (…

Энциклопеди Лермонтова. — 1981.

Gjuha ruse

Морфемно-орфографический словарь. — 2002.

Stan, -A (строфа).

Fjalor ortografik. — 2004.

Джерса është një process i natyrshëm në trupin e njeriut. Пор нук рджедх гжитмонэ па гджурме. Первеч пикаве тэ вердха нэ рроба, джерса мунд тэ джетэ нэ мэнирэ спецификке эрэ, герцог крижуар шумэ неудобства.Kozmetikë ofrojnë një gamë të gjerë të produkteve nga djersa dhe «аромат» и садж. Një nga këto është një дезодорант-антиперспирант — шкоп.

Cfare eshte?

Stick është një дезодорант-дезодорант që ka një laps dhe konsistencë të fortë. Qëllimi i tij është të bllokojë gjëndrat e djersës dhe të parandalojë riprodhimin e baktereve. Prodhuesit ofrojnë stoqe për gratë dhe burrat. Është e përshtatshme për përdorim, dhe mund të vishen kudo me mua, duke vënë në një kuletë.

Sipas rezultateve të testimit, është vërtetuar se kur aplikohet me një антиперспирант ngjitës, mbulon lëkurën janë të veshura me një film të padukshëm talk, i cili thith lagëakshritjte dheen. Efekti i një filmi të tillë arrin dy ose tre orë, pas së cilës efekti, я говорю по zvogëlohet.

Ки материал у тексуа нга унэ нэ факет е ревистэс сэ хуадж пэр культурен е кендримит тэ замедление дхе унэ до тэ ндадж ме юконсидератат пэр мэнырэн сэ си ка ориджинэн культура е qëndrimit.

Ne do të jemi realistë, fati i fitimit dhe muret në vendin tonë u bë më i madh se vetëm haraç për të modës. Шумэ шпеш, культура е qëndrimit shkakton mosmarrëveshje të zemëruara në форум е makinave dhe më gjerë. Adhuruesit dhe tifozët e qëndrimit-kulturës kanë qenë prej kohësh të bashkuar në grupe, të tilla si scanceworks, hellaflush, rimtuck dhe slamburglers.

Lindja е kulturës shumë të qëndrimit është mjaft e vështirë për t’u caktuar, sepse rrënjët e kësaj lëvizjeje të makinave të çojnë në disa burime.Çfarëdo që muret vetë thonë, «qëndrimi» tani mund të konsiderohet modë, por racimi i tij është i rrënjosur dhe për përdorimin praktik të rrotave të gjera me një largim të vogë. Dhjetëra vite më parë, rrota të tilla filluan të përdorin rrota të Tilla për të krijuar një gamë më të gjerë të automjeteve, të cilat ofruan automjete të fuqishme ngarkesën më tézë mirë. Por mos harroni se kultura e qëndrimit është më shumë многогранный, ka pasur dërguesit e tjerë në shfaqjen e saj.

Përdorimi i një shtëpie të gomës të tensuar tani është и lidhur me lëvizjen e qëndrimit, por i pari që përdorin tuners japonezë, aderimtarët e lëvizjeve auto / mukëndo en / mup në Evropë, Shtëpia e Kulturës Dub-Kulturë (ajo tashmë shkroi për të edhe në Carakoom). Kjo veçori karakteristike u importua gradient në Shtetet e Bashkuara, ku ai mori dédhe shpërët tunuara, ku ai mori dhe shpërët tunhe mésété térndarje mésété térndarje mésété.

Па dyshim, ndikimi më i madh në formimin e kulturës së qëndrimit vazhdoi nga japonezët. Megjithatë, si shumë gjëra të njohura në botën tonë, më në fund kultura e qëndrimit ka zhvilluar në Amerikë, në përpjekjet e skenës së makinave USDM për të acceptuar stilin japonezuar stilin.
Ju mund të filloni të argumentoni se japonezët ishin të parët ose evropianët me skenën e tyre dub. Definitivisht, një тренд и ngjashëm në ato skajet, në Histori kishte makina me një stil të ngjashëm dhe skenën moderne të qëndrimit, disa teknika u miratuan nga japonezët dhe evropianët.Megjithatë, ia vlen të kuptosh se «shtetet» janë përgjegjëse për shpërndarjen dhe popullarizimin e kulturës së qëndrimit.

Kultura e makinave të huaja në SHBA është tani në gjeneratën e dytë. Gjenerata e parë ishte reflection mjaft me saktësi në filmin e shpejtë dhe të furishëm. Kultura e automotivebilave të gjeneratës së parë në Shtetet e Bashkuara u ndërtua në aspiratat dhe aspiratat e shumë tuners, modifikuesve dhe kryqëzimit. Gradualisht, kultura e administratës dhe tani mund të vëzhgojmë gjeneratën e saj të dytë.Kultura e qëndrimit nisi rrënjët e saj në këtë brez të dytë.

Сот, qëndrimi përcaktohet nga dy parameter kryesorë: lartësia e pastrimit dhe phytmeth (për atë që mund të lexoni edhe në Carakoom). Пёркундэр кёсадж, школлат «тэ мендуарит тэ дрейте» джанэ шумэ дхе кжо паскирон нджэ нумэр тэ мадх тэ буримеве që ндикуан нэ формимин э нджэ культура. Пёр диша, është e rëndësishme të mbahen (dhe madje edhe përmirësimin) и sfidave të makinës, punën e pezullimit të saj, për të tjerët, nuk ka asgjë më të të tjerët, nuk ka asgjë më të rënësésimësishmesishme.

Kultura e qëndrimit, si shumë të tjerë, hoqi dorë nga fjalët e reja, shtypni ‘tuck’ tuck ‘,’ thyej ‘,’ shtrirje ‘,’ pastrim ‘,’ rrafshuar ‘,’ statike ‘,’ Ulur ‘ (‘SACKET’ Slammed, hedhur ‘,’ zbukuruar ‘,’ railed ‘,’ rënë ‘etj).

Ka disa elemente më shumë që erdhën në skenën e makinës amerikane së bashku me një trend në këmbë. Ме э шкуар: рат-шуфра (пер тэ чилен ю гджиташту мунд тэ лексони нэ паджисдже дхе паджисже ретро, ​​пйесэ кембими дхе диске тэ чилесисэ с шкелкьер нга Япония.Nëse flasim për kabinën e një sporti kompakt, atëherë tani është e pabesueshme me të pabesueshme dhe të çmendur motorët.
Kjo është se si ndodh jashtë vendit. Nëse jeni të interesuar për të mësuar në lidhje me skenën e autombilave ruse dhe kulturën e qëndrimit në Rusi, unë rekomandoj leximin e materialit Иван Федоров nga revista Ranflas. Пер фат тэ мирэ, ай гджиташту ка дику нэ вендин фкиндж.

Art në kuptimin e një personi është gjerësisht dhe shumëfishuar. Një numër i pabesueshëm i stileve dhe varieteteve të pikturës së artit mund të shkaktojë një gamë të tërë të emocioneve — nga shoku në eufori.Secili prej jush vendos: të admirojnë «Joconda da Vinçinë e famshme», ose të bjerë pa ndjenja nga dhimbja e kokës, e cila duket e saj.

Suprematizmi është një drejtim, themeluesi i të cilit u bë Casesemer Malevich. Thelbi i pikturave të këtij drejtimi transmetohet nga autori përmes prizmit të formave dhe skemave më të thjeshta gjeometrike. Në gjysmën e parë të viteve 1910, ajo ishte e dënuar për vitet e keqkuptimit. Megjithatë, sot nuk ka asnjë person në botë që nuk do të dinte Sheshin e famshëm të zi Malevich, kostoja e së cilës vlerësohet nga miliona dollarë amerikanë.

Stili i akordimit të automotivebilave është një lloj arti i caktuar me historyinë dhe vlerat e saj. Pra, e cila u shfaq relativisht kohët e fundit stili i qëndrimit, si suprematizmi, shpesh mbetet nënvlerësuar nga jashtë. Përkundër kësaj, rrethi i admiruesve të kësaj drejtimi me çdo qëllim po bëhet gjithnjë e më shumë duke kapur shumicën e shoferëve nga e gjithë bota. Ле тэ përpiqemi të kuptojmë se çfarë qëndrimi është dhe cila është shkaku i popullaritetit të saj.

Эмри я qëndrimit shënon të gjithë kulturën e akordimit të autombilave, veçoria kryesore dallulus e të cilave është e ulët «ulje».Vlen të përmendet se termi vetë u shfaq disa vjet më vonë, pas promovimit të nënvlerësimit të makinave. Пёр тё крижар проектин и кендримит, штэ э невойшме, пара сё гджиташ, пер тэ звогёлуар пастримин э макинэс, дхе пастадж, мос харрони пёр инсталимин и рротаве «тё дрейта». Пэр тэ бэрэ нджэ макинэ «мэ тэ ульэт», ка диса метод:


Pezullimi «statik», ose statik, është versioni më i buxhetit i lumit rrugor. Si rregull, burimet e makinës suaj ndryshojnë në gjatësi të ngjashme, më të vogël, gjë që redukton ndjeshëm numrin e centimetrave «të padëshiruar» nën makinën tuaj.Vini re se prerja e burimeve nuk ia vlen, pasi ky operacion do të çojë në shkatërrimin e kthesave të mbetura dhe operacionin e pasaktë të amortizatorëve.

Pezullimi i printuar

Pezullimi i shtypur, ose «koyovelers» — një zgjidhje shumë praktike dhe e lirë për ata që duan të «zhvishen» makinën e tyre. Даллими крисор и кесай метод нга статике është афтэсия пэр тэ rregulluar mekanikisht lëvizjen e Kupës së Mbështetjes, si rezultat i së cilës rritet ose zvogëlohets pastrimi.

Пезуллим айрор

Makina të pajisura me «jastëkë të ajrit» të veçantë në vend të amortizuesve, si dhe një kompresor për të krijuar presionin e nevojshëm në sistem, mund të ndryshojë pastrimë në sistem, mund të ndryshojë pastrimë në kë në. Ky version i «zbrazjes» të makinës është më i shtrenjtë, por komoditeti dhe praktika që do të ofrojë është e gjitha paratë e shpenzuara.

Natyrisht, është e pamundur për krijimin e një ulje «të drejtë» për të krijuar një makinë, që nga shkalla e «nënvlerësimit» direkt varet nga pozita e rrotave të quajtur.Për një kuptim vizual të varieteteve të «Fitth» është dhënë ilustrim më poshtë.

Në shumicën e rasteve, aq më e madhe është gjerësia e kokës, aq më shumë vëmendje është e merituar nga projekti i përfunduar. Për të siguruar mundësinë e vendosjes së disqeve të gjerësisë maksimale të mundshme, zbatohet një kolaps i rrotave negativ, i cili ju lejon të «mbushni» rrotat në «nëntokë» rroë harqq.

Faza përfundimtare në përgatitjen e projektit të qëndrimit është instalimi i disqeve «të sakta».Një shumëllojshmëri e prodhuesve dhe modeleve ekzistintage Amazes. Не кеми фолур ташмэ пер мёнырен се си тэ згджедхим рротат пер туаджин. Megjithatë, qëndrimi është një art që kërkon viktima. Dhe për të instaluar një herë të njohur në këtë kulturë të disqeve nga Bentley Continental GT në ndonjë makinë tjetër kërkon adaptorë të thjeshtë që lejojnë jo vetëm të të njohur në lejojnë jo vetëm të edrotë karandroys

Распорки rrota janë instaluar direkt në mes qendrës dhe disk tim.Dy lloje të spacers janë të dallueshme: проставки для переходников. Э пара джанэ пэрдорур пэр тэ рритур ларгимин и тимонит, тэ чилат ме сы джу леджон тэ згджерони рутинэ э макинэс, дхе гджиташту тэ хэкин кафе эфектин е «титхес» мне харкет э рротаве. Adaptorët aplikohen për të ndryshuar shpimin e makinave ose kur madhësitë e KSHC-së zbriten në disk. Si rregull, spacers e këtij lloji janë të bashkangjitur në qendër të makinës me bulonave të makinave, pas së cilës me rrota është e lidhur me spacer me bulona shtesë.

Ju mund të blini spacers për të rritur largimin ose adapuesit për të ndryshuar shpimet që mund të kontaktoni me profesionistët e biznesit tuaj, master montim.

Pavarësisht stereotipit ekzistues, spacers moderne të rrotave dallohen nga cilësia e aliazhit të lartë dhe qëndrueshmëria, dhe dizajni i tyre ju lejon të mos krijoni presion dritikë në shpëjë shpëjë shpëjë shpëjë shpëjë shpëjë.

Në përfundim, ne vërejmë se pavarësisht nga markë dhe model, çdo makinë mund të shndërrohet në një vëmendje tërheqëse të projektit të qëndrimit.Cilat metoda për të arritur rezultatin e dëshiruar, secili pronar vendos për vete, në varësi të aftësive financiare dhe preferencave të shijes. Дхе паварешишт нга тэ гджита кеккуптимет э тэ тджерев, кендрими штэ берэ нджэ лодж арти që джу мунд тэ дони осе тэ уррени, дхе тани шште э памундур тэ мохони гджо пуштоэ глои пуштои се.

Анализ микроорганизмов, связанных с неудачным эндодонтическим лечением на основе полимеразной цепной реакции

Введение. Enterococcus faecalis (E.faecalis) является наиболее важным видом в стоматологии и играет важную роль в этиологии стойких апикальных поражений после лечения корневых каналов. На сегодняшний день лучшим способом уничтожения E. faecalis является внутриканальное введение 2% хлоргексидина в течение 7 дней. Однако из-за способности этой бактерии сохраняться и выживать в суровых условиях многие исследования были направлены на поиск альтернативной стратегии для ее предотвращения или искоренения. Это исследование было проведено для изучения влияния наночастиц висмута на E.faecalis, как этиологический фактор при рецидивирующих инфекциях корневых каналов. Методы. Сорок пациентов, направленных в эндодонтическое отделение Медицинского университета Шираза для предварительного эндодонтического лечения, предоставили образцы корневых каналов. Сначала все образцы переносили в бульон Enterococcosel и инкубировали. Затем образцы, показавшие рост, высевали на чашки с кровяным агаром и инкубировали для дальнейшей процедуры ПЦР. Порошок наночастиц растворяли в воде высокой чистоты, и конечную концентрацию наночастиц висмута (BiNP) измеряли с помощью спектрофотометра.Минимальную ингибирующую концентрацию (MIC) BiNP против E. faecalis определяли методом разведения микробов в соответствии с методами испытаний на чувствительность к противомикробным препаратам. Кроме того, бактерицидные анализы были проведены в среде бульона Мюллера-Хинтона и представлены как концентрация BiNP, которая снижает количество жизнеспособных бактерий на 99,9%. Полученные результаты. Из всех образцов 77,5% выявили присутствие E. faecalis с помощью ПЦР. Кроме того, ингибирование роста E. faecalis наблюдалось в диапазоне концентраций от 0,625 мкг / мл до 20 мкг / мл (среднее геометрическое: 2.337 мкг / мл), а значения МБК находились между 1,25 мкг / мл и 40 мкг / мл (среднее геометрическое: 4,781 мкг / мл), что по сравнению с хлоргексидином, эти значения составляли примерно одну восьмую от хлоргексидина. Заключение. Экспериментальные данные свидетельствуют о том, что наночастицы висмута могут быть интересной альтернативой для борьбы с E. faecalis, что, учитывая упомянутые преимущества наночастиц висмута, такие как ингибирование образования биопленок Streptococcus mutans и более высокая антибактериальная активность по сравнению с хлоргексидином, можно предложить для использования в разные области стоматологии.1. Введение Enterococcus faecalis как представитель рода Enterococcus является грамположительным факультативным анаэробом, который чаще всего встречается как комменсал в желудочно-кишечном тракте (включая ротовую полость) и мочеполовой системе. Из всех видов энтерококков E. faecalis является наиболее важным видом в стоматологии из-за их роли в стоматологических заболеваниях, включая эндодонтические инфекции, пародонтит и кариес зубов [1, 2]. В этом отношении исследования показали значительную ассоциацию E.faecalis с возникновением неудач эндодонтического лечения [3]. В отличие от первичных внутрирадикулярных инфекций, которые являются полимикробными и в которых преобладают грамотрицательные анаэробные палочки, микроорганизмы, участвующие во вторичных инфекциях, ограничены одним или несколькими видами бактерий [4]. E. faecalis — это стойкий микроорганизм, который, несмотря на то, что составляет небольшую часть флоры в необработанных каналах, играет важную роль в этиологии стойких апикальных поражений после лечения корневых каналов. Обычно он обнаруживается в большом количестве случаев неудачного эндодонтического лечения и может оставаться живым в корневом канале как отдельный микроорганизм или как основной компонент флоры [4].Присутствие E. faecalis связано с различными формами эндодонтических инфекций, такими как первичные и стойкие эндодонтические инфекции. При первичных инфекциях он чаще встречается при бессимптомных хронических перирадикулярных поражениях, чем при остром перирадикулярном периодонтите или абсцессах. Он выявляется при 4–40% первичных эндодонтических инфекций, в то время как его частота в зубах с неудачным лечением в 9 раз выше [5]. Исследования с использованием методов культивирования для выделения энтерококков при вторичных эндодонтических инфекциях показали их распространенность от 24 до 77%, в то время как использование метода ПЦР приводит к степени выделения от 67 до 77% [6], поэтому молекулярные методы могут быть полезны в В этом отношении благодаря их высокой чувствительности и точности, среди которых мультиплексная полимеразная цепная реакция (ПЦР) является одной из новейших [7].Действительно, E. faecalis может быть одним из существенных факторов неэффективности лечения корневых каналов, и его присутствие во время обтурации может значительно снизить показатели успеха лечения [8]. Его патогенность в первую очередь зависит от его выживания и устойчивости в корневых каналах, хотя он имеет дополнительные факторы вирулентности, такие как способность прикрепляться и формировать биопленку на поверхности хозяина [9]. Во многих исследованиях изучались различные эндодонтические препараты и ирриганты для уничтожения и / или предотвращения E.faecalis от доступа к системе корневых каналов во время лечения. Например, от 3% до полной концентрации гипохлорита натрия может уничтожить E. faecalis, в том числе его существование в виде биопленки [10]. ЭДТА и 10% раствор лимонной кислоты обладают небольшим антибактериальным действием против активности E. faecalis; однако они обладают способностью удалять неорганическую часть смазанного слоя, позволяя другим ирригационным средствам достигать дентинных канальцев [11]. Кроме того, MTAD, новый ирригант корневых каналов, состоящий из смеси тетрациклина, кислоты и детергента, продемонстрировал многообещающую способность уничтожать E.faecalis [12]. Аналогичным образом, 2% гель или жидкость с хлоргексидином эффективны для удаления E. faecalis из поверхностных слоев и дентинных канальцев, что может быть связано с существенным противомикробным действием [13]. Другие ирригирующие средства, которые показали свою эффективность при уничтожении E. faecalis, включают фторид олова и озонированную воду [14]. С другой стороны, гидроксид кальция, широко используемый внутриканальный препарат, оказался почти неэффективным против этих бактерий [15]. Кроме того, антибактериальная активность нескольких силеров была также исследована против E.faecalis с Roth 811, герметиком на основе оксида цинка и эвгенола, обладающим сильнейшим ингибирующим действием [16]. До дальнейших исследований сообщается, что внутриканальное введение 2% хлоргексидина в течение 7 дней является лучшим способом уничтожения E. faecalis [17, 18]. Однако из-за способности этой бактерии сохраняться и выживать в суровых условиях окружающей среды, а также из-за возникающей устойчивости среди специй Enterococcus, многие исследования были направлены на поиск альтернативной стратегии предотвращения или искоренения E.faecalis из системы корневых каналов [1]. Среди этих стратегий наночастицы, обычно размером 0,2–100 нм, показали хорошие результаты в качестве новых противомикробных агентов. Их преимущество может быть связано с их высоким отношением поверхности к объему, которое увеличивает взаимодействие между этими частицами и микроорганизмами, улучшая их ингибирующие эффекты [19]. Кроме того, различия в размере и площади поверхности между этими частицами и обычными противомикробными средствами могут снизить вероятность развития устойчивости [19].До сих пор металлы, наиболее часто используемые в биомедицинских целях, включают золото, титан, серебро, медь, цинк, магний и висмут [20]. Висмут (Bi) — это диамагнитный, кристаллический и хрупкий металл группы VA, обычно встречающийся в виде сульфида висмута, оксида висмута и карбоната висмута [21]. Исследования показали, что производные висмута и его формы в виде наночастиц подавляют рост Helicobacter pylori, изменяя их цикл Кребса, аминокислотный и нуклеотидный метаболизм, и их можно использовать в качестве противодиарейного средства для лечения тошноты, рвоты и боли в желудке [22].Кроме того, сообщалось, что BiNP проявляли антибактериальную и противогрибковую активность при концентрациях ниже 1 мМ и 2 мМ соответственно [23, 24]. Кроме того, они могут препятствовать образованию биопленок S. mutans, основного этиологического агента кариеса зубов [23]. Однако потенциал наноразмерных частиц висмута для применения в стоматологии широко не изучался, и настоящее исследование было проведено для изучения влияния BiNP на стандартный штамм и клинические изоляты E.faecalis, как этиологический фактор при рецидивирующих инфекциях корневых каналов. 2. Методы 2.1. Отбор проб Сорок пациентов в возрасте от 18 до 45 лет, в том числе 22 мужчины и 18 женщин, обратились в эндодонтическое отделение Университета медицинских наук Шираза для предварительного эндодонтического лечения, предоставили образцы корневых каналов, которые затем были проанализированы на наличие E. faecalis. Все образцы были взяты у пациентов, у которых была завершена терапия корневых каналов более 1 года назад. Были исключены беременные, страдающие диабетом, курильщики и пациенты, которым требовалось предварительное лечение из-за отсутствия каналов, сломанных инструментов, перфораций, выступов или кальцинированных корневых каналов.Ни у одного из выбранных зубов нет окончаний пломбы корневого канала короче 5 мм на рентгенограммах и пародонтальных карманов глубже 4 мм. После наддесневого удаления зубного камня и изоляции с помощью резиновой прокладки один из авторов взял образцы, как ранее описано Gomes et al. [13]. Зуб и прилегающее поле были обеззаражены 2,5% гипохлоритом натрия в течение 30 с каждый, а затем инактивированы 5% тиосульфатом натрия. После удаления предыдущих реставраций и подготовки полостей для доступа пульповые камеры были продезинфицированы средством 5.25% гипохлорита натрия и обтурационные материалы были удалены никель-титановыми вращающимися инструментами ProTaper SX-F2 (WNT, Индия) при орошении стерильным физиологическим раствором. Образцы микробов собирали, вставляя две стерильные бумажные иглы в рабочую длину канала и удерживая их на месте в течение 60 с. Обломки на бумажных штифтах переносили в стерильные 2 мл пробирки Эппендорфа, содержащие среду для жизнеспособности агара III Готенберга, и оценивали сразу в течение 2 часов.После встряхивания образцов в миксере в течение 60 с (Vortex, Scientific Industries Inc., Спрингфилд, Массачусетс) 1 мл каждого образца использовали для культивирования, а другой 1 мл замораживали при -20 ° C для процедур ПЦР [ 13]. Дополнительно был изучен стандартный штамм E. faecalis (ATCC 51299), полученный из Американской коллекции типовых культур. Исследование было одобрено этическим комитетом Ширазского университета медицинских наук (96-01-03-14924). Пациенты были проинформированы о процедурах и целях исследования, и было получено письменное согласие.2.2. Культура и процедуры идентификации Сначала все образцы переносили в бульон Enterococcosel (HiMedia, Индия) и инкубировали 72 ч при 35 ° C. Затем образцы, показавшие рост, высевали на чашки с кровяным агаром (Plast Labor, Рио-де-Жанейро, RJ, Бразилия) и инкубировали при 35 ° C для дальнейшего использования [8]. 2.3. Процедуры ПЦР Аликвоты объемом 1 миллилитр из положительных культур в бульоне Enterococcosel (HiMedia, Индия) переносили в микропробирки, и ДНК экстрагировали кипячением, как описано Siqueira и Rocas (2004).Был выбран ген, кодирующий 16S рРНК E. faecalis. Все продукты ПЦР загружали в 1% -ный агарозный гель (Cinnagen, Тегеран, Иран) и подвергали электрофорезу (Ахтариан, Тегеран, Иран) в течение 1-1,5 ч вместе с маркером молекулярной массы. После окрашивания бромидом этидия (Merck) полосы ДНК визуализировали при УФ-освещении (UVP Gel Documentation, Upland, Калифорния, США), и о распространенности E. faecalis сообщали как процент исследованных случаев. Последовательность праймера и условия ПЦР, используемые для идентификации E.faecalis приведен в таблице 1 [25]. Целевая ДНК Последовательность праймера (5-3) Состояние Размер ампликона (пб) 16S рРНК GTTTATGCCGCATGGCATAAGA G CCGTCAGGGGACGTTCAG 95 ° C -2 мин; 36 циклов (95 ° C -30 с; 60 ° C -60 с; 72 ° C 60 с) и 72 ° C -2 мин 310

Microsoft Word — HPM-4611-19_C 2019 Справочник поставщиков и аптек TEXT.docx

% PDF-1.6 % 87 0 объект > эндобдж 84 0 объект > поток application / pdf

  • Microsoft Word — HPM-4611-19_C 2019 Справочник поставщиков и аптек ТЕКСТ.docx
  • пконнелли
  • 2018-10-04T15: 41: 11-04: 00PScript5.dll Версия 5.2.22019-01-02T12: 48: 49-05: 002019-01-02T12: 48: 49-05: 00Acrobat Distiller 8.3.1 (Windows) uuid: 205200bc-62d3-4526-ac0d-c4115842fb64uuid: 7368d52f-0d62-4f78-b47f-f31582ba726d конечный поток эндобдж 118 0 объект > / Кодировка >>>>> эндобдж 81 0 объект > эндобдж 116 0 объект > эндобдж 2267 0 объект > эндобдж 117 0 объект > эндобдж 3333 0 объект > / Pa1 + 3> / Pa0> / Pa1 + 4> / Pa1> / Pa1 + 5> / Pa1 ++ 1> / Pa1 ++ 2> / A4 + 1> / Pa1 ++ 3> / A4 + 2> / Pa1 ++ 4> / A4 + 3> / Pa1 ++ 5> / A4 + 4> / A4 + 5> / Pa1 ++ 6> / Pa1 ++ 7> / Pa1 ++ 8> / A5 ++ 1 > / A5 ++ 2> / A5 ++ 3> / A5 ++ 4> / A5 ++ 5> / A0 +++ 1> / A5 ++ 6> / A0 +++ 2> / A5 ++ 7 > / A0 +++ 3> / A5 ++ 8> / A0 +++ 4> / A0 ++ 1> / A2 +++ 1> / A0 ++ 2> / A0 ++ 3> / A2 ++ +2> / A2 +++ 3> / A0 ++ 4> / A2 +++ 4> / A0 ++ 5> / A0 ++ 6> / A0 ++ 7> / Pa0 ++ 1> / A0 + +8> / Pa0 ++ 2> / Pa0 ++ 3> / Pa0 ++ 4> / Pa0 ++ 5> / Pa0 ++ 6> / Pa0 ++ 7> / Pa0 ++ 8> / A4 +++ 1> / A4 +++ 2> / A4 +++ 3> / A4 +++ 4> / A5 +++ 1> / A5 +++ 2> / A5 +++ 3> / A5 + 1> / A5 +++ 4> / A5 + 2> / A4 ++ 1> / A5 + 3> / A4 ++ 2> / A5 + 4> / A4 ++ 3> / A5 + 5> / A4 ++ 4> / A4 ++ 5> / A4 ++ 6> / A4 ++ 7> / A4 ++ 8> / A2 + 1> / Pa0 +++ 1> / A2 + 2> / Pa0 +++ 2> / A2 +3> / Pa0 +++ 3> / A2 + 4> / A2 + 5> / Pa0 +++ 4> / Pa1 +++ 1> / Pa1 +++ 2> / Pa1 +++ 3> / Pa1 +++ 4> / Pa0 + 1> / Pa0 + 2> / Pa0 + 3> / Pa0 + 4> / Pa0 + 5> / A0> / A2> / A4> / A5> / A2 ++ 1> / A2 ++ 2> / A2 ++ 3> / A2 ++ 4> / A2 ++ 5> / A2 ++ 6> / A2 ++ 7> / A0 + 1> / A2 ++ 8> / A0 + 2> / A0 + 3> / A0 + 4> / A0 + 5> / Pa1 + 1 >>> эндобдж 3439 0 объект > эндобдж 3433 0 объект > эндобдж 3424 0 объект > эндобдж 3425 0 объект

    Ваз 2105 максимальная брзина.Колико тэжи ВАЗ автомобильный (Жигули, Лада, Нива)? Jeftin модель «АвтоВАЗ»

    Stvarajući određenu zbrku u svijesti potrošača, VAZ je svoju «peticu» objavio ranije od «jetvorke». ВАЗ 2105 поставьте эту основную модель модернизированной модели «копейка» и — переднюю часть, оставленную моделью ВАЗ-а, которая находится на трассе више от 30 лет.

    ВАЗ 2105 жэ седан с погоном на стражне котаче, коди е створен као «автомобиль из 1980», уедно и као база за нову обитель автомобиля. Истодобно, инженеры су добили интересан задатак: доказывать дубоку технолошку модернизации модели, задржаваючи притом основную архитектуру каросерие.Ovo rješenje omogućilo je minimaliziranje promjena na transporteru, barem u pogledu zavarivanja структурных элементов. Истодобно, automotive se morao izvana promijeniti nabolje i ponovno postati privlačan potrošačima kako u inozemstvu, tako i u sSSR-u. Прототипы ВАЗ-а 2105 створены су у просинку 1977 года. Године, годину дана касние автомобильные автомобили, прошао меđународну потврду у Франкуской и почтовой продажи в Европе.

    Карактеристика мотора

    Prijenos automotivebila

    Kočioni sustav i servo upravljač

    Величина Гуме


    S obzirom na činjenicu da je VAZ 2105 isvorno bio namijenjen stranom potrošaču, dizajn je revidiran u korist povećane sigurnosti.Sigurnosne rešetke pojavile su se u okvirima vrata, ukrasne kape su prošlost — sve je bilo podređeno svjetskim zahtjevima za osiguravanje pasivne sigurnosti. U kabini se pojavila inovacija usmjerena na povećanje sigurnosne klase automobila — nasloni za glavu koji bi se mogli podesiti po visini. Уз то, запремина пртляжника из темеля се повечала — до 300 лир.


    Потрошня гора

    Предак druge generacije «klasične» obitelji iguli, sovjetska limuzina VAZ-2105 pojavila se kao rezultat ozbiljne modernizacije automotive prethodne generacije ВАЗ-2101 и ВАЗ-2103.Zašto se «petica» odnosi na other generaciju? To je prvenstveno zbog njegova izgleda, umjesto da su okrugli automotive dobili pravokutna svjetla. Auti i karoserije su se razlikovali, iako su tehnologija okvira i karoserije ostale iste.

    Prvi prototipovi pojavili su se 1979. godine, istodobno je proizvedena i prva pilot serija. Tvornica automobila Volžski pokrenula je potpunu serijsku proizvodnju automotive VAZ-2105 krajem siječnja 1980.

    Izgled automotivebila VAZ-2105 nije se mijenjao tijekom cijelog vremena proizvodnje, a trajao je 31 godinu, ako uzmemo u obzir eksperimentalnu industry seriju из 1979.Салон такой

    1982. Године створена е «люксузна» версия «домашнее животное» лимузин ВАЗ-2107, новый автомобиль, 1984. године, создателя автомобиля ВАЗ запчасть, производящую караван ВАЗ-2104, изготовленную на основе лимузина ВАЗ-2105. По аналогии с претензией, можно не использовать модификацию автомобиля ВАЗ-2105 извозилу у разно земли под именем Lada 1300, Lada Saloon, Lada Nova и Lada Riva.

    Krajem prosinca 2010. Године, АвтоВАЗ я зауставио производящий због мужской портрет за моделью ВАЗ-2105. Do tada je već proizvedeno 2 milijuna 91 tisuća automobila ВАЗ-2105 различных модификаций. Nakon što je zaustavljena proizvodnja automotive u Togliattiju, planirano je nastaviti proizvodnju u Iževsku, ali od te je ideje odustalo.

    Дизайн и конструкция

    U usporedbi s automobilima prve generacije, лимузина VAZ-2105 dobila je other masku hladnjaka, pravokutne farove s hidrokorektorom, jedinicu stražnjih prenjih svjetala po prvi putra kombinirala, svjetlajetrajetajetajetajetajetajetajeta.Automobil je izgubio gotovo sav krom, učinili su to kako bi smanjili troškove proizvodnje. Umjesto kromiranih dijelova, počeli su stavljati crnu plastiku or obojeni metal.

    Оквир автомобиля ВАЗ-2105 био я сличан претодним образцом, али нови каросерийски панели дали су му модернизи, па чак и помодни «кутни изглед» према стандартима тихого года. Opći omjeri automotivebila, pa čak i uzdužni nagib, također su se promijenili. Дакле, объединение лимузина ВАЗ-2105 с автомобилем прве генерации (ВАЗ-2101, 02, 03,) bilo je mnogo niže nego s другим генерацией (ВАЗ-2104, 07).

    U unutrašnjosti automobila VAZ-2105 prvi su se put pojavili jednodijelni utisnuti unutarnji paneli izraeni od poliuretana (kasnije su napušteni). Grijano stražnje staklo već je standardno ugraeno. Pojavila se funkcija zagrijavanja bočnih stakala, uslijed čega su napustili okretne trokute, čineći tako staklo jednodijelnim. Сьедала с наслоном за главу подесивим по видимости пресвучена на полном коже (средином 2000 г. Automobil je dobio sjedala od VAZ-2107).

    Kao pogonska jedinica, VAZ-2105 bio je opremljen raznim motorima zapremine 1,2 do 1,65 litara i kapacitetom od 64 do 140 conjskih snaga.Motori su bili karburatori i distribuirali su ubrizgavanje goriva, i konvencionalni i rotacijski klip. Осим бензинских мотора, у малим серии произведений на автомобилях ВАЗ-2105 с дизельским мотором ВАЗ-341 запремине 1,52 литра и запремине 50 коньских снаг.



    Основни модель 1979 года. С мотором с распределяемым объемом 1,29 литра и 63,6 коньских снага. Dovršen je s 4-stupanjskim jenjačem.


    Isti model s pet, ali s 5-stupanjskim jenjačem


    Измена с мотором расплиняча ВАЗ-2101 запремине 1,2 литра и запремине 58,7 коньских снага, мяняч е, као и у основной изведби, 4-ступаньски.


    Измена с мотором ВАЗ-2103 запремине 1,45 литра и запремине 71,4 конйске снаже. Dovršen je s 4 i 5-stupanjskim mjenjačima.


    Измена с мотором за убризгаванье ВАЗ-2104 с расподжеленим убризгаваньем, обувь 1,57 литра и снадж 82 конйске снаж. Mjenjač je 5-stupanjski.


    Посещение прейнака за потреблением не мане специальных служб, попутно прометне полиции, Министарства унутарных пословов и ФСБ-а.Определяется мотором ВАЗ-2106 с распределением запоминающего устройства 1,57 литра и запремления 80 коньских снаг. Уз к су инсталирани додатни спремник за плин и батареи.


    Još jedna posbna preinaka, ali s moćnijim motorom s raspodijeljenim ubrizgavanjem VAZ-21067, 82 konjske snage, koji udovoljava Euro-3 ekološkim standardima. Mjenjač je 5-stupanjski.


    Автомобили за услугу у таксию, произведена она мала серии с дизельским мотором ВАЗ-341 запреминена 1,52 литра и емкостью от 50,3 конъюнктуры.

    Лада Рива (ВАЗ-21057)

    Известна ика автомобилей ВАЗ-21053, произведена с 1992 г. до 1997 г. за землю с ливним прометом, однозначно управляет налацио с десне страны. Мотор я у складу с экологичным стандартом Евро-1

    Лада Рива (ВАЗ-21058)

    Isti desničarski automotivebil, заснован на ВАЗ-21050, производство с 1982 года. До 1984 года.

    Лада Нова

    Известна модификация ВАЗ-2105, произведена в углавном за нимачка тржишта. Мотор ВАЗ-2105, 4-ступенчатый мотор.Произведено с 1981 года по 1997 год. Годин.


    Još jedna posbna modifikacija automotivebila bila je opremljena rotacijskim klipnim motorom ВАЗ-4132 Wankel zapremine 1654 cm 3 i kapacitetom od čak 140 conjskih snaga. Ovaj je automotive proizveden у малой серии за потребление прометне политики, Ministarstva unutarnjih poslova i KGB-a


    Полуоквирни пикап, коди е производство с 1995 г. до 2006 г. године ЗАО «ВАЗИНТЕРСЕРВИС» на тему модификации ВАЗ-21053 и ВАЗ-21054.


    Sportski Automobil с присильным мотором ВАЗ-2106, коди цвета карбюраторе WEBER 45 DCOE. Kapacitet motora bio je 1,6 литра, снага 160 коньских снага за 7000 окретей у минут. Opremljen mjenjačima s 4 i 5 stupnjeva prijenosa s briježnim spojkama. Kako bi se smanjila težina automotivebila, 1986. godine standardna vrata zamijenjena su aluminijskim.

    Седан ВАЗ-2105 может быть назван «модернизированным классом» советским и русским автомобильным двигателем — новая модель развития на платформе ВАЗ-2101 и заправо е ньегова дубока модернизация.

    «Домашнее животное» (tako se na jednostavan način ovaj automotive popularno naziva) ušao je u malu proizvodnju 1979. Годин, годин, годин, это массовое производство, ходя, траяла до 30. Просинца, путь, 2010. — Када, место, путь, 2010. ..

    Tijekom više od 30 godina proizvodnje, VAZ 2105 praktički se nije promijenio u izgledu, ali je 2000. godine prošao značajnu modernizaciju tehničkom smislu i u pogledu organacije interijera.

    ВАЗ 2105 je limuzina sa stražnjim pogonom B-klase: duljina automobila je 4130 мм, visina — 1446 мм, širina — 1620 мм.Испод дна «петице» (зазор) налази с удаленностью од 170 мм, размер осовина — 2424 мм (врло скромна бройка чак и за Б класу).

    Kada je opremljeno, vozilo teži od 976 do 1060 kg, ovisno o preinaci.

    to se tiče izgleda, VAZ-2105 se ne razlikuje, ali jest u naše vrijeme … a u godinama kada je ušao na tržište, ovaj je cars u dizajnerskom smislu u potpunosti odgovarao europskoj modi. Tijelo «petice» odlikuju se ispravljenim linijama i jednostavnošću izvedbe. Sprijeda i straga mogu se primijetiti velika svjetla pravokutnog Oblika i aluminijski odbojnici, a sa strane — bokobrani s izrezanim konturama, apsolutno ravni krov, duga hauba i prtljažnik koji se snažno.

    Međutim, zbog svoje aerodinamike ova je limuzina među ljudima dobila još jedan nadimak — «сигла».

    Za automobil možemo reći ovo — ništa više, apsolutno ništa! Изгледа вместе «домашнее животное», привлекательность или стиль овдже ни не миришу.

    Укомплектован ВАЗ 2105 у потпуности одговара изглэду. Armaturna ploča zastarjelog je dizajna i ne blista informativnim sadržajem — osim brzinomjera i tahometra, uključuje indikatore za gorivo, temperaturu motora i stanje baterije.Яко сэ показатели добро читаю у било коджим увжетима. На среднем уровне можно увидеть само «мотор», крохе, когда вы находитесь в приложении, где температура течет в зраке, уплачивает за сигарету и пепеляра. Ispod je mjesto za ugradnju radija.

    2000-ih, kao što je već napomenuto, unutrašnjost automobila malo je ažurirana.

    Салон «домашнее животное» не само изгледом, веч и квалитетом материяла квари први доям — пластика и дословно храст. Da, i sve je prikupljeno na niskoj razini, između dijelova postoje praznine, dok se u vožnji čuju škripe i zvečke.

    Передняя съедала ВАЗ 2105 потом уже без воды и подъехала на себя на удаленности от управления. Sjediti ispred nije baš ugodno — prostor za noge čak i za putnike prosječne visine možda se nece činiti dvoljnim. Stražnja kauč službeno je dizajnirana za tri osobe, ali čak i dvije osobe bit će skučene, posbno u nogama. Уз то, други красный съедала нема наслоне за главу, это угроза сигурность.

    Prtljažni prostor «petice» nije samo mali (korisna zapremina 385 litara), али йош увийек има неугодан облик.Snažno izbočeni lukovi kotača skrivaju značajan dio svog volumena i ne pridonose prevozu glomaznih predmeta. Али испод пода е резервни котач у пуной великини.

    За ВАЗ 2105 у различного бензинового двигателя:

    • Karburatorske jedinice imale su zapreminu od 1,2 do 1,6 litara i proizvodile su od 59 do 80 conjskih snaga.
    • Također je bio dostupan i 1,5-litreni dizelski motor čija je snaga bila 50 «konja» и 92 Nm najvećeg okretnog momenta.
    • Nedavno je ispod haube limuzine postavljen ubrizgavajući cetverocilindrični benzinski motor s raspodijeljenim ubrizgavanjem radne zapremine 1,6 литровый i snage 73 conjske snage, razvijajući potisak od 116 Nm.

    Svi su bili kombinirani s 5-stupanjskom «mehanikom» and pogonom na stražnje kotače.

    Убежище до прве стотке за автомобильной траекторией ~ 17 секунд, максимальная скорость ~ 150 км / ч.

    Лимузина ВАЗ 2105 ima neovisni opružni ovjes sprijeda i ovisni opružni ovjes straga.Диск kočnice koriste se na prednjim kotačima, a bubanj na stražnjim.

    Cijena — tijekom godina proizvodnje bila je glavna prednost «petice». Ali zbog niske cijene limuzine, bila je to iskreno loša oprema, koja je uključivala samo sigurnosne pojaseve i električno grijano stražnje staklo.

    U 2010. години, када автомобиль автомобильный запуск по монтажу автомобиля, новый автомобиль ВАЗ-2105 по цене от 178 рубля. U 2018. Години «домашнее животное подржаных у покрытия» кошта 25 000 ~ 100 000 рубля (овесно о станю и години производное одрееног примерка).

    ВАЗ-2105, опись, характеристика, проверка вожня

    ВАЗ-2105 — это дома для развития автомобиля, это результат модернизации автомобиля ВАЗ-2101.

    Automobil je dobio moderniji izgled, što je omogućilo uspješnu prodaju automotive u inozemstvu. Mora se reći da su klasični VAZ modeli bili posbno popularni u Maarskoj.

    Početak proizvodnje model je 1979. godine, tada je započela mala proizvodnja.

    Na pokretnoj traci Rusije automobil je trajao sve do 2010.Година.

    Tijekom njegove proizvodnje karoserija i unutrašnjost nisu modernizirani. У касний модели, уместо мотора от 1300 кубических сантиметров снаджа 69 KS, отметки на уровне мотора снаджа 1450 кубических сантиметров снаджа 71,4 кг.

    Među klasičnim VAZ modelima, «petica» nije bio najpopularniji automotive. Razlog tome bio je motor u prvim modelima, koji je donio muhu u masti u bačvu meda, bio je s remenskim pogonom bregaste osovine. Ponekad je remen otkazao, pa je trebalo popraviti i cijeli motor….

    Takvih slučajeva nije bilo puno, ali sarofan radio je brzo proširio tu činjenicu, što je utjecalo na potražnju за автомобилем.

    Mora se reći da je motor stalno moderniziran, glavna svrha modernizacije bila je smanjiti potrošnju goriva i povećati radni vijek prije remonta.

    Tako su 1985. godine počeli proizvoditi radilice s bljeskalicama.

    Karburatori su se neprestano poboljšavali, a mijenjao se i pokretač.

    2009. Година белая, если она была изображена на ВАЗ-2105.

    Međutim, nakon završetka programa, potražnja za njim takoer je pala.

    U 2010. godini prestao je ВАЗ-2105. Štoviše, glavni razlog nije bila potražnja, već potreba za newom kapaciteta za proizvodnju modernijeg automotivebila — Lada — Granta.

    Tijekom godina proizvodnje proizvedeno je 2.000.000 возила ВАЗ-2105.

    Измене ВАЗ 2105:

    ВАЗ-2105 — с мотором с распределением от 1300 кубических сантиметров, с 4-й ст. Контрольная точка.

    ВАЗ-21050 — с мотором расплава од 1300 кубических сантиметров, с 5-й ст.Контрольная точка.

    ВАЗ-21051 — с мотором с распределением от 1200 кубических сантиметров, с 4-ступенчатым двигателем.

    ВАЗ-21053 — с мотором расплава от 1500 кубических сантиметров или убризгаванием ВАЗ-2104 с 5 брзинами. Контрольная точка.

    ВАЗ-21054 — малая прейнака за прометну полиции, Министарство унутарных пословов и КГБ с дополнительным спремником за плин и аккумулятор.

    ВАЗ-21055 — с дизельским мотором от 1500 кубных сантиметров Барнаултрансмаш, мала прейнака за такси.

    ВАЗ-21057 (Lada Riva) — извозна верзия ВАЗ-21053 с десним погоном, произведена 1992.-1997. За опскрбу Великой Британии.

    ВАЗ-21058 — извозна верзия ВАЗ-21050 с десним погоном, произведена 1982-1994 гг. За Великую Британию.

    ВАЗ-21059 — с ротационным мотором од 1300 кубических сантиметров ВАЗ-4132 snage 140 KS, korišten je u prometnoj policiji.

    Технические характеристики ВАЗ-2105:

    Известия :

    Четверотактни, бензин, расплиняч, Четвероцилиндрични



    Наконечник tijela

    Брой врата

    обувь пртляжника, дм 3

    Ukupne dimenzije, mm:

    властита тежина, кг

    Međuosovinski razmak, мм

    Trag prednjih kotača

    Trag stražnjih kotača

    Pogonski kotači

    Razmak od tla do dna

    Zazor na gredi stražnje osovine

    Zazor na gredi prednjeg ovjesa


    341- дизель

    ВАЗ 4132

    радна запремина, кубика см

    Макс.снага, кВт (pri okretajima u minuti)

    Макс. снага, л. iz.

    Макс. uvrtanje rudnika., Nm (pri okretajima u minuti)

    сустав опскрбе




    Broj stupnjeva prijenosa

    Применимые места:


    Konačni omjer pogona

    Najveća brzina, км / ч

    ubrzanje do 100 км / ч, с

    Потрошенная гора, л / 100 км:

    Потрошня Горива при 90 км / ч

    Потрошня Горива при 120 км / ч

    урбана потрошня горива

    Kapacitet spremnika za gorivo, l

    Prednje kočnice


    Stražnje kočnice


    Put kočenja opterećen od 80 km / h

    Pogon parkirne kočnice


    Погон квачила


    Prednji ovjes


    Stražnji ovjes

    пэт тактова


    пуж — валяк

    Najmanji radijus okretanja

    Težina oluje vučene prikolice.

    Težina vučene prikolice bez kočnica

    Максимальная тежина кровного носа

    Максимально возможное отображение без уборки

    Ресурс до ограничения. Поправак, км

    Температура хладног старта, S

    165 / 70R13 175 / 70R13

    Надзорная площадь

    Grijano stražnje staklo






    Vanjska ogledala

    Tapeciranje sjedala

    Обивка потолка

    Облога врата


    ВАЗ-2105: пробна возня

    Измене ВАЗ 2105

    ВАЗ 21051 1.2

    ВАЗ 2105 1,3

    ВАЗ 21053 1,5

    ВАЗ 21055 1,5 д

    ВАЗ 21054 1,6 МП

    Разрез колеге ВАЗ 2105 по цене

    Nažalost, ovaj model nema školskih kolega …

    Рецензия власника ВАЗ 2105

    ВАЗ 2105, 1997г. Год

    ВАЗ 2105 купили смо напола с бюстгальтером от рожака 2010г. Година. Hitno mi je trebao autombil za moju obitelj, jer sam svoje nećake trebao odvesti u školu, nije bilo dovoljno novca, a u tom trenutku je moj rođak prodavao svoju «Lastavicu».Cijena je dogovorena, stigli su, odveli. U početku smo bili malo nepovjerljivi prema ovoj «Petici» — uostalom, domaćoj auto industrial, pa čak i stražnjem pogonu. Bojali su se da uopće neću moći upravljati komandama, a brat se bojao da nece moći normalno voziti i da će morati često popravljati. Pokazalo se da sve nije tako zastrašujuće. Navikao sam se na njega nakon par dana vožnje — volan nije toliko zategnut (stvarno zategnut samo u «Moskviču»), automotive je apsolutno poslušan i upravljiv. За релятивно малу запремину мотора, ВАЗ 2105 возможно и жустро, добро убрзава, это е важно за сигурность.Овьес е типично «жигули» и крут как би задржао автомобильный при уласку у завой брзином, а уедно е и довольно мекан — нема нелагоде на дугим путованжима. Салон je udoban, uvijek je bilo dovoljno mjesta i za djecu i za kupovinu. Ponekad je odvezla prijatelje — svi su se uklopili. Jednostavno je i prikladno koristiti električne prozore, ništa se ne zaglavi или zaškripi. Štednjak je odličan, zimi je u autu za 10 minuta bio «Taškent», možete sigurno voziti s отvorenim prozorima. Ne volim baš sam interijer — stolice su udobne, ali boja nekako nije baš dobra.Ali prestao sam obraćati pažnju, u redu. Опченито, путовали см 2 года, не жалим ни за чим. Да, bilo je popravaka — помпа за горо с этим покварила, наточила горы на лошой бензинской помпы. Promijenio sam i generator — na vrijeme sam primijetio da se baterija ispraznila, odmah sam pozvao šlep auto (на последнем автомобиле изгорела е бртва блок zbog pregrijavanja motora). Moj je brat jednom popravio nešto u ovjesu, još uvijek nisam razumio što tamo radi. Опценито, за почтовую установку ВАЗ 2105.

    Предности : niska cijena. Ниска потрошня. Vrlo jeftini rezervni dijelovi. Ručni mjenjač.

    недостачи : ružna presvlaka.

    Влада, Москва

    ВАЗ 2105, 2007

    Поздрав свима. Имам ВАЗ 21053 из 2007г., Возио сам ВАЗ 2109 из 1990г., Недавно сэм купио «петику», гледао сам пуно автомобила, али найшао сам на некэ с пуно проблема. На tržištu su uglavnom samo Logani, postojao je i Classic, ali sve je vrlo tužno.Я jednog dana moj prijatelj je rekao da zna gdje se petica prodaje. Okupio se, stigao и pogledao. ВАЗ 2105 Je Plava, Njegovana, Glazba Je Pristojna, Karoserija nije pokvarena i kabina nije u neredu. Što je najvažnije, uopće nije trulo. Разговарали смо о томе это и како, а отприлике тедан дана касние узео сам га, у овом тренутку га власник ние возио, на има другие автомобили. Кад сам га купио, почели су мразеви. Štednjak nije baš topao u usporedbi s «devetkom» (niska ploča), vjetrobransko staklo dugo ostavlja, ista brzina se oštro prebacuje.Йош jedan nedostatak je pomalo bučan u kabini. Mislim da je to zbog stanja na cestama (imamo ih poput ploče za pranje), antifriz također odlazi vrlo, vrlo polako, ne mogu pronaći gdje, pa čak i na velikim neravninama prednji lijevi uztačločlogua. Uskoro ću se pozabaviti elleration tih «zaliha». Я тако, у принципу, нормальный автомобиль, можно себе возити. Vjerujem da ovo nije najgora opcija i da nije stara ni godinama, ni početkom 80-ih. Slijedite na vrijeme i vozite pažljivo, a zatim automotivebilu treba puno time.ВАЗ 2105, добро постиже 100 км / ч, на пролете чу проверити ньегове права мощности, новый автомобиль може бити и више, али саде е зима и застрашууе е возити брзо. Овай автомобильный препоручит чу као први онима коди тек починю возити. Сад имам 20 лет, за мое године ово е odgovarajući automotive. Dobro raspoloženje svima vama.

    Предности : jeftin, автомобили идеи на власть новац. Доступность резервных диелова. Самопомоч.

    недостачи : pomalo bučno.Događa se da je električar hirovit.

    Олег, Кострома

    ВАЗ 2105, 2010

    Zašto sam uzeo ВАЗ 2105? Nekoliko je razloga za to: mekoća, dobra vidljivost «klasike». Jednostavnost mijenjanja brzina bez stiskanja kvačila, jer je ručka mjenjača spojena izravno na mjenjač. Svia mi se izgled VAZ 2105 više nego 2107. Ružna rešetka 2107 kvari cijeli izgled. Нека инструмент табла ВАЗ-а 2105 и слабость одного из 2107-е, али одсуство роштиля ми е пуно важное.А тахометар — зашто е, поготово йер то више ние расплиняч. Иначе, автомобили су потпуно идентични — и изнутра и извана. Скупщина — Вазовская. Odnosno, ovdje nema «dionica» skupštine Iževska. Da, pretinac za rukavice je malo iskrivljen, stražnji odbojnik je nešto niži lijevo nego desno. То типично за све найновие «классике». Takav je transporter. Након куповине направлене «антикорозивно», ставите добру заштиту, грияна огледала, глазбу и добро затамните. Боя — «кварц». Što se tiče vzačkih performance, svi sve znaju, ovdje se ništa nije promijenilo od 70-ih.Automobil ide glatko, meko, ugodno. При большом брзинаме захтэван е за добро направлен колапс, иначе е бацити (уосталом, погон е страга, аэродинамика е лоша). Pogodno za obiteljske izlete u ladanjsku kuću — sve će stati, a dovoljan razmak od tla (posbno na 14 diskova) omogućuje vam puno dalje nego što očekujete. Снага мотора белая ж е врло удобно изненаđена. 1.6 бризгалка дословно искаце испод вас. ВАЗ 2105 jede, наравно, попуть дизельске локомотив, односно «Ниве» — буосталом, мотор je u biti isti.Программа se može «izmijeniti», bit će puno manje hrane, ali to nisam učinio, jer smatram da bi automotive trebao biti na zalihi. Potrošnja mi je bila oko 13-15 litara. Али započinje у bilo kojem mrazu s pola okreta. Kad sam nakon prve godine rada promijenio svijeće, bile su ugodne crvenkaste boje. Dakle, sve je normalno. Automobil ima dobru zvučnu izolaciju, motor se praktički ne čuje pri malim brzinama. Od prednosti je i nezahtjevna za kvalitetu goriva, kakvoću ulja, pa, sločno. У мотора je lanac pa se nigdje ništa neće pokvariti.За двое года посадки ВАЗ-2105 проезд до самого себя 9000 км. Nikad se ništa nije pokvarilo, osim jedne jedine «болести» — motora peći. Како мраз, так и зввиждук. Stoga sam neprestano svraćao tražeći garanciju da ću ga promijeniti. Općenito себе для liječi instaliranjem motora na ležaj, ali bio sam lijen da to učinim. Ukupno: dobar, vrlo pouzdan, čak i udoban automotive s dobrom preglednošću i atraktivnom cijenom u to vrijeme.

    Предности : поузданость. Мекоча.Pregled. Успередна удобность кабине. Čišćenje. Lijepa peć. Kad sam ga uzeo, postojala je cijena od 99 tisuća za recikliranje. Сада, наравно, тога више нема.

    недостачи : zastarjela konstrukcija. Loša aerodinamika. Минимальная удобность у салона.

    Александар, Самара

    ВАЗ 2105, 1996

    Изврстан Автомобиль за Почетник. ВАЗ 2105 nije tako šteta trljati, grebati, udarati. Ekonomično, moja potrošnja bila je negdje oko 8 litara na 100 km AI-92 u град.Rezervni dijelovi za tri kopejke, u bilo kojem štandu. Vozio sam vrlo dobro preko polja s четверо людей у ​​kabini, a zimi se nisam mogao pomaknuti iz vedra neba, proklizao (gumica na čičak, na kojoj sam vozio gotovo bez skidanja 2 godine). Било я довольно удобности на зимским гумираним гумама Goodyear, али недостаяла я звуковая изоляция, посебно с можим 4-minobacačem. Ako je brzina veća od 90 km / h, morali ste vikati da putnik čuje. Nije bilo ozbiljnijih kvarova za cijelo vrijeme vlasništva autombila, osim slučaja kada je automobil odvezao prijatelju, «naletio» je na njega bez posljedica dodavanja ulja, gladovanja ulja i klina motora.Ne žalim se na pouzdanost. Bila su само два тренута када se VAZ 2105 покренуо выше от 10 минут, а затем nakon dvotjedne neaktivnosti zimi. To su činili i prije. А сада приятел има седам у 2005. и готово сэ све срушило.

    Предности : Способность котрлябно по снайегу. Ефтиноча. Najjeftiniji dijelovi. Прибыльность. Велики размак од тла. Можете себе поправить у поля, на колену.

    недостачи : neugodno pristajanje.Loša izolacija. Odvratan nosač brisača. Лоша сигурность. Нема кабинский фильтр. Tahometra nema.

    Александр, Москва

    ВАЗ 2105, 1996

    Tijekom godina na VAZ-u 2105 premotao sam nešto manje od 55 tisuća kilometara — gotovo isto kao kad sam ga kupio. Без посебне верховного автомобилиста, jednom sam putovao u Finsku (2010. godine), dva puta u Bjelorusiju u Vitebsku (2010. i 2011. godine). Tamo bih otišao kasnije, ali stjecajem okolnosti to nije bilo moguće.Za cijelo pzdoblje rada nije prošlo samo 1 put — gotovo odmah, u jesen 2011., baterija prethodnog vlasnika bila je prekrivena «bakrenim bazenom». Изглед ВАЗ 2105 за C ocjenu. Još uvijek volim ovu sjeckanu nespretnost. Jedinica udobnosti — za stražnju sofu (s djevojkom je vrlo ugodno) и uvijek radnu peć — pa bih uopće stavio 0. 4 zbog pouzdanosti — pretpostavljam da sam samo imao sreće. Слушаючи приче других «Классиководов», razumijem da nisam popravljao (nisam akumulirao ni zbirku rezervnih dijelova).Učinak vožnje VAZ 2105 za 3 — ovdje morate shvatiti da pokušavam objektivno procijeniti technički i općenito umoran automotive. Мой патлиджан на Шелл-овом полусинтетиком у мотора и властью минеральным водом у кутии и стражном осовином покреце с тихо на -20 и не стой с кольцем кад се креча. Али у своих 18 лет 120 на obilaznici za njega — krstarenje brzinom. Ako je need, vozio sam pola prstena na 130 i do 140, još uvijek ga je moguće ubrzati (s konstruktivnim mjenjačem sa 150 i 4 brzine).Da — tutnji (4500 o / min при 120), da — u nedostatku navike, putnici se boje, ali otišao sam više od jedne godine i znam da je moj automotive sposoban za to. Сигурность — у студеном выше года, када сэм восцио брзином од око 60 км / ч и удаленность от око 1,5 — 2 пути до дворишного лука, швато сам да ми Mini Cooper, возеци это управление из овог лука, нечестое положение. Doista sam usporio do 40-te i uzeo ga na brod. Prst mi je bio izbijen na ruci, kolega koji je sjedio na suvozačkom mjestu nije dobio modricu.Jeste li pomogli? Можда е помогло.

    Предности : jeftinost rezervnih dijelova. Nepretenciozna ovjes. «Старая школа».

    недостачи : технички и морально застарио. Недостаток звука. Трули.

    Дмитрий, Санкт-Петербург

    ВАЗ 2105, 1999

    Па, что можно оценивать на ВАЗ-2105 за 30 тисуча? Судечи по рецензияма, očekivao sam puno gore, ali za 10 tisuća km promijenio sam samo diodni most i ulje.Sada kočnica curi iz rezervoara (puknula), i tako ide bez проблема. ВАЗ 2105 покрестье како требуется (хвала претодному власнику на электроничком пальце). Na primjer, kod -33 za mene ga pokreće jedini iz grupe). БМВ-ови и Фордови из 80-го мира. Održavanje 100%, stražnja strana povučena je dizalicom i čekićem, poklopac je kupljen korišten za 500 rubalja. WHA je poput WHA, ne vidim ništa kriminalno u tome, zašto ih svi toliko proganjaju. Osim toga, zimi cane dobro voziti VAZ 2105 na отvorenim parkiralištima, bočno ulazeći u zavoje.Udobnosti, naravno, nema, sigurnost je niska, dinamika nije sjajna, ali ovo nije Mercedes za 1 milijun, što od njega očekujete. ВАЗ 2105 свой новач оправдава за 300%. Za cijenu beskorisnog «iPhonea» dobivamo cijele Zhiguli, na kojima se možete kretati i naučiti voziti. A ako imate sa sobom tisuću rubalja, čekić i kliješta, uvijek možete popraviti bilo koji kvar, a uz to ćete imati i pivo za pivo. Općenito, zadovoljan sam, i to ne zato što je prvi. Спортивный корак VW Golfa IV.

    Предности : rezervni dijelovi u bilo kojem supermarketu.Cijena. Vozi i vozi cijelo vrijeme, neznatno manje nego potpuno slomljena.

    недостачи : uska pasivna сигурность. Удобность.

    Дмитрий, Воронеж

    ВАЗ 2105, 2010

    Плюсы — sve jeftino. Suspenziju možete promijeniti sa svakom plaćom. 4 амортизатора, 4 куглице, ястучичи — за sve sam на плато 3000 рублей. Čarobna «vječnost» резервных диелова. Sve što sam već promijenio još se nije slomilo. Iznenaujuće je, ali za 35 t.km koliko sam vozio. Promijenio sam odmah nakon kupnje samo 1 amortizer, 2 kuglice i 1 timensku pločicu. Od ozbiljnijeg, morao sam promijeniti motor peći, радиатор, генератор, kvačilo. Авто за чайник. Морате схватити знаност вожнье автомобилибила од самог дна. Едино ćete tako naučiti kotrljati se bočno, a ne kotrljati se bočno kada to trebate. Научить это как нападать на мужской снежне наносе. Нече вам бити жао да себи прикачите мртви автомобильный и одвучете га до найближег сервиса. Nećete imati strah ni da ćete oštetiti lakiranje.Изврсна видливость. Pa, ozbiljno, sve možete vidjeti. Предни ступовы на ВАЗ 2105 врло на уски. Problemi nastaju pozamašnih traka blata. Сада о контраима ВАЗ-2105. Каросерия. Četiri godine prag на страни возца zahrđao je по šavu. U 5. Годины почтового ящика на сувозацкой стране. Сада е корозия велика као шака и автомобили не перем намерно како не бих био тужан. Эргономия. Moja je visina 187 см. Лада жэ у мэни развивала комплекс краткодлаке дугоноге наказе.Или наместите ноге и управляте умом, или приложите руку и котачичем обришите характерные пруге на траперикама. Мало сам pretjerao, ali nisam otišao daleko od istine. Свиесть о несигурности. Postoji mali strah da će hladnjak poteći, spremnik s kočnicom puknuti, slavina štednjaka teći i kotač se ispuhati. Sustav hlađenja. Само сам огорчена на нью. Sve je započelo sa spomenutom slavinom za štednjak — poplavila je policu za odlaganje i sve obloge ispod nje. Moje kratke ruke dobro su mi došle za zamjenu.Sve stezaljke moraju se zategnuti prije svake sezone. Чак и ако их на вриеме затемнете, на этом я дале капнути на генератор, четке или диодни мосте бити прекривени или све скупа, попут модих. Опценито, ово е слабая страна ВАЗ-2105. Свака част. Односно, потпуно одсуство таких. Сви настоящие нокаутираты ваши Жигули. Квачило. Или нисам приятель с ним или сам neispravan, али квачило нема фиксни положай. Uvijek se pokupi na različitim mjestima. Сигурность. Из тог разлога имам стра од панике због путаня по региджи и велике далжине.

    Предности : u прегледу.

    недостачи : u прегледу.

    Андрей, Омск

    Рейтинги | Рейтинг

    Всемирной кубической ассоциации | Всемирная ассоциация кубов

    Область WorldAfricaAsiaEuropeNorth AmericaOceaniaSouth AmericaAfghanistanAlbaniaAlgeriaAndorraAngolaAntigua и BarbudaArgentinaArmeniaAustraliaAustriaAzerbaijanBahamasBahrainBangladeshBarbadosBelarusBelgiumBelizeBeninBhutanBoliviaBosnia и HerzegovinaBotswanaBrazilBruneiBulgariaBurkina FasoBurundiCabo VerdeCambodiaCameroonCanadaCentral African RepublicChadChileChinaColombiaComorosCongoCosta RicaCôte d’IvoireCroatiaCubaCyprusCzech RepublicDemocratic Народная Республика KoreaDemocratic Республики CongoDenmarkDjiboutiDominicaDominican RepublicEcuadorEgyptEl SalvadorEquatorial GuineaEritreaEstoniaEswatiniEthiopiaFederated Штаты MicronesiaFijiFinlandFranceGabonGambiaGeorgiaGermanyGhanaGreeceGrenadaGuatemalaGuineaGuinea BissauGuyanaHaitiHondurasHong KongHungaryIcelandIndiaIndonesiaIranIraqIrelandIsraelItalyJamaicaJapanJordanKazakhstanKenyaKiribatiKosovoKuwaitKyrgyzstanLaosLatviaLebanonLesothoLiberiaLibyaLiechtensteinLithuaniaLuxembourgMacauMadagascarMalawiMalaysiaMaldivesMaliMaltaMarshal л IslandsMauritaniaMauritiusMexicoMoldovaMonacoMongoliaMontenegroMoroccoMozambiqueMyanmarNamibiaNauruNepalNetherlandsNew ZealandNicaraguaNigerNigeriaNorth MacedoniaNorwayOmanPakistanPalauPalestinePanamaPapua Новый GuineaParaguayPeruPhilippinesPolandPortugalQatarRepublic из KoreaRomaniaRussiaRwandaSaint Китса и NevisSaint LuciaSaint Винсента и GrenadinesSamoaSan MarinoSão Тома и PríncipeSaudi ArabiaSenegalSerbiaSeychellesSierra LeoneSingaporeSlovakiaSloveniaSolomon IslandsSomaliaSouth AfricaSouth SudanSpainSri LankaSudanSurinameSwedenSwitzerlandSyriaTaiwanTajikistanTanzaniaThailandTimor-LesteTogoTongaTrinidad и TobagoTunisiaTurkeyTurkmenistanTuvaluUgandaUkraineUnited арабского EmiratesUnited KingdomUnited StatesUruguayUzbekistanVanuatuVatican CityVenezuelaVietnamYemenZambiaZimbabwe

    Файлы cookie помогают нам предоставлять наши услуги.


    Добавить комментарий

    Ваш адрес email не будет опубликован.