Стук в подвеске гранта: Скрипы и стуки передней подвеске Лада Гранта при езде по неровностям

Содержание

Скрипы и стуки передней подвеске Лада Гранта при езде по неровностям

Комфорт при поездке на автомобиле Лада Гранта складывается из многих факторов, один из которых – работа передней подвески. Стук, шум, «пробои» подвески влияют и на безопасность движения, поэтому своевременная диагностика поломок этого узла просто необходима. Провести ее лучше в сервисном центре, но некоторые неисправности можно установить и самостоятельно.

Вероятные причины неисправности подвески

Вид на переднюю подвеску «из под колеса»

Неприятный скрип передней подвески Лада Гранта, «пробои» в ее работе кроются в неисправности элементов этого узла автомобиля. Условно их можно разделить на две группы: стойка амортизатора с содержимым и все остальные. Причина выделения стойки в отдельную категорию вызвана увеличенной на нее нагрузкой: она выполняет одновременно функцию верхнего рычага и гасит вертикальные вибрации колеса.

К основным причинам неисправностей телескопической стойки относятся следующие:

  1. Ослабление крепления ее верхней опоры к несущему кузову.
  2. Разрушение резинового буфера.
  3. Течь жидкости из амортизатора, задиры на его штоке, повреждение хромового покрытия штока.

    Амортизатор потёк (необходима замена)

  4. Негерметичность клапанов сжатия и отдачи в амортизаторе, наличие в его жидкости посторонних предметов.

На фото: рычаг нижний в сборе с шаровой

Возможны также повреждения шаровой опоры, обычно вызванные завышенным ресурсом ее работы или установкой некондиционной детали. Изношенные резиновые втулки в стабилизаторе и растяжках также скажутся на плавности хода подвески. Поломка основной пружины маловероятна, но естественный износ или установка нестандартной модели могут стать причинами потери упругости подвески в целом.

Самостоятельная диагностика неисправностей в передней подвеске

Существует несколько объяснений даже одному симптому поломки, поэтому выявить истинную причину неисправности лучше на автостанции.

Можно выделить следующие группы признаков отклонений в работе передней подвески:

  • Самопроизвольное отклонение от прямолинейного движения, «рыскание» машины.
  • Шумы, стуки, «пробои» при езде по неровным дорогам.
  • Заниженный ресурс элементов подвески, быстрый выход их из строя.

«Отбилась» краска на стойке и стойка начала ржаветь

К первой группе относятся обычно неисправности стабилизатора устойчивости. Визуально можно осмотреть всю подвеску и, если нет признаков вмятин, деформаций, то стоит проверить установку углов схода/развала передних колес. Внешне их отклонение наблюдается в неравномерном износе протектора передних колес, но для появления стертости шин потребуется определенное время.

Есть шанс и установить на слух эту поломку: при вхождении в поворот будет слышен скрип резины, а руль при этом обычно не возвращается в исходное положение самостоятельно.

Входит в число временных неисправностей автомобиля Лада Гранта скрип в передней подвеске, если он вызван эксплуатацией машины по загрязненной или песчаной дороге. В этом случае возможно попадание частиц песка в резиновые уплотнители (сайлентблоки) стабилизатора или растяжек. После мойки шумы пропадают.

Подвеска «проще не бывает» — это только плюс.

Подвеска «проста до безобразия», краб, стойка, нижняя шаровая, два сайлентблока — и всё, вот и вся её капиталка.

После любых работ, которые связаны с отсоединением ступицы от стойки, необходимо делать сход-развал. На крайний случай можно попробовать нанести зубилом метки на стойке и на развальном болте (он сверху).

Стук при езде по неровностям

Нехарактерен и стук в подвеске при езде по неровностям: Лада Гранта хоть и не является автомобилем повышенной проходимости, но вполне способна преодолевать небольшие ухабы. Обычно стуки возникают при ослаблении крепежа, момента затяжек гаек, износе шаровой опоры или стойки амортизатора.

Если ресурс работы элементов подвески слишком короткий, то причин обычно две: низкое качество используемых деталей или слишком динамичный, агрессивный стиль езды.

Также стоит обратить внимание на соответствие передних колесных дисков и самих покрышек с рекомендованными изготовителем.

Устройство подвески Лада Гранта

Устройство передней подвески (схема)

1 — чехол; 2 — шаровая опора;
3 — стопорное кольцо;
4 — гайка подшипника ступицы;
5 — защитный колпак; 6 — ступица;
7 — подшипник ступицы; 8 — поворотный кулак;
9 — диск тормозного механизма переднего колеса;
10 — щит тормозного механизма;
11 — гайка; 12 — эксцентриковый (регулировочный) болт;
13 — поворотный рычаг;
14 — пружина передней подвески;
15 — шток амортизатора; 16 — верхняя чашка пружины;
17 — верхняя опора амортизаторной стойки;
18 — гайка штока амортизатора;
19 — подшипник верхней опоры амортизаторной стойки;
20 — прокладка пружины;
21 — буфер хода сжатия передней подвески;
22 — защитный кожух; 23 — телескопическая стойка;
24
— вал привода переднего колеса;
25 — кронштейн крепления подушки штанги стабилизатора поперечной устойчивости;
26 — растяжка передней подвески;
27 — штанга стабилизатора поперечной устойчивости;
28 — стойка стабилизатора поперечной устойчивости;
29 — рычаг передней подвески

В этом автомобиле применена независимая подвеска с одним рычагом, к которому прикручивается нижняя часть поворотного кулака. Его верх монтируется к стойке амортизатора, работа которой отличается от многих аналогичных узлов на отечественных автомобилях. При повороте рулевого колеса происходит вращение кулака со стойкой амортизатора и размещенной на нем пружиной. Шнек амортизатора, прикрученный через подшипник к верхней опоре стойки, остается неподвижным.

Шаровая опора обеспечивает гибкое сочленение поворотного кулака и рычага подвески. Угол развала колес регулируется традиционно для переднеприводных версий автомобилей ВАЗ – гайкой с эксцентриком на основной стойке амортизатора, в месте соединения ее с поворотным кулаком. От курсовых колебаний подвеска удерживается благодаря общему стабилизатору поперечной устойчивости и растяжкам с обеих сторон подвески.

Подробно на фото

Все элементы подвески на фото снизу

  1. штанга стабилизатора поперечной устойчивости;
  2. резинометаллический шарнир поперечного рычага;
  3. амортизаторная стойка;
  4. растяжка;
  5. кронштейн растяжки;
  6. гайка крепления растяжки к кронштейну;
  7. шаровая опора амортизаторной стойки;
  8. шарнир поперечной устойчивости;
  9. поперечный рычаг;
  10. скоба крепления штанги стабилизатора

Слабые места подвески

В влажную погоду не всегда возможно увидеть дефект стойки амортизатора

Если осуществляется самостоятельный ремонт, например, замена шаровой опоры, то необходимо внимательно затягивать болты крепления. В поворотном кулаке, к которому крепится опора, нет сквозных отверстий: болт вворачивается в сам кулак. Излишнее усилие при затяжке чревато поломкой болта.

Стук в передней подвеске может появиться и по этой причине.

Для надежной и продолжительной работы подвески необходимо соблюдать скоростной режим машины, заявленный в ее техническом паспорте. Также регулярное проведение ТО поможет исключить появление шумов, стуков и увода от прямолинейного движения.

Лада гранта стук в передней подвеске tnvd-auto.ru

Стук в передней подвеске на мелких кочках – определяем причины и варианты их устранения

Посторонние шумы в подвеске могут свидетельствовать о поломке какого-либо ее узла. Но как определить, какая именно деталь нуждается в замене или ремонте? Ниже мы рассмотрим наиболее распространенные причины появления стуков при езде по неровностям, способы их диагностики и варианты устранения.

Содержание

  1. Неисправность в системе рычагов
  2. А подвеска ли стучит – проверяем рулевое управление
  3. Когда стучат опоры?
  4. С шаровыми не шутят
  5. Какие еще узлы вызывают стуки?

Неисправность в системе рычагов

Очень часто проблема заключается в износе сайлентблоков рычагов. В результате их износа система начинает «люфтить» и стучать. Вместе с этим ухудшается управляемость автомобилем, соответственно, безопасность движения сильно снижается. Для выявления неисправностей сайлентблоков вам понадобится домкрат и монтировка.

Прежде всего нужно поддомкратить колесо, чтобы полностью его вывесить. Затем воспользуйтесь монтировкой как рычагом, прилагая нагрузку к рычагам подвески в разных направлениях, т.е. расшатывая их из стороны в сторону. Если обнаружен люфт с глухим постукиванием, значит с диагнозом вы не ошиблись. Таким же образом нужно проверить рычаги второго колеса.


Как правило, детали изнашиваются равномерно. Поэтому, если вы обнаружили проблемы с одной стороны, наверняка они имеются и с другой стороны в большей или меньше степени. Для устранения проблемы нужно просто заменить сайлентблоки (резинометалличесакие шарниры). На схеме выше изображен рычаг передней подвески с сайлентблоками Лада Веста.

Заменить шарниры можно даже самостоятельно. Для этого прежде всего необходимо демонтировать рычаги. Чтобы вытащить старые шарниры из рычагов и установить новые, понадобится специальное приспособление, предназначенное именно для вашей марки и модели автомобиля.

А подвеска ли стучит – проверяем рулевое управление

Когда стучат опоры?

Если при езде по ямам, кочкам и прочим неровностям слышен глухой стук слева или справа, причина может заключаться в износе опоры амортизаторной стойки. Она представляет собой резиновую прокладку-демпфер, через которую нагрузка от амортизатора передается кузову. Со временем резинка изнашивается и утрачивает эластичность, что и приводит к появлению стуков.

Чтобы убедиться в том, что диагноз поставлен верно, нужно замерить зазор между опорой и пластинчатым ограничителем. Он должен находиться в пределах 8-10 мм. Если зазор увеличен, опору необходимо менять. Надо сказать, что доступ к опоре, как правило, затруднен. Чтобы демонтировать ее, нужно освободить верхнюю часть амортизатора, как, к примеру, на автомобиле ВАЗ Калина (ниже на фото).


Иногда в автомобиле стучат стойки, т.е. амортизаторы. Стуки обычно появляются при езде по кочкам, а также при входе в поворот, когда нагрузка приходится на испорченный амортизатор. Так как амортизаторы редко выходят из строя парно, стук раздается только с одной стороны. Чтобы убедиться, что амортизатор вышел из строя, надо надавить на крыло всем весом. Когда со стороны колеса автомобиль «просядет» резко отпустите его. Если кузов вернулся в исходное положение без раскачки, значит амортизатор рабочий. Если же кузов некоторое время раскачивается вверх/вниз, значит амортизатор необходимо заменить.
Еще одной причиной стука является износ опорного подшипника. Определить эту неисправность можно по более звонкому звуку, который слышен при езде по прямой дороге. Во время поворотов звук исчезает, но на руле может ощущаться вибрация. У некоторых автомобилей, таких как Рено Логан, подшипник расположен близко к капоту, поэтому определить неисправность можно даже когда автомобиль стоит. Для этого надо просто открыть капот, начать раскачивать автомобиль из стороны в сторону и послушать опору. Если слышен хруст и стук, значит проблема заключается в подшипнике.

Чтобы визуально оценить состояние подшипника и заменить его, необходимо демонтировать амортизаторную стойку и опору.

Иногда стук возникает по причине слабо затянутой гайки опоры. Поэтому прежде всего подтяните гайку и проверьте, не исчез ли стук.

С шаровыми не шутят

Причиной стуков и скрипов зачастую является износ шаровых опор. Это очень ответственная деталь в виде шарнира, которая соединяет ступицу колеса с рычагом подвески. Правда, стучат шаровые обычно только на заднепроходных автомобилях с простой подвеской. На переднеприводных машинах неисправность проявляется в виде скрипа. Исключением являются случаи, когда износ достигает критического значения, т.е. шарнир начинает просто болтаться в корпусе.

Чтобы убедиться в неисправности шаровой, нужно вывесить колесо, нажать на педаль тормоза и попробовать повернуть колесо влево и вправо. Если имеется люфт и стук, значит шаровую необходимо менять. Надо сказать, что у некоторых автомобилей, таких, к примеру, как Лада Гранта или ВАЗ 2110, шаровая крепится на болтах, соответственно, заменить ее не составит труда. Но иногда встречаются опоры, которые впрессованы в рычаг (Mercedes CLS W219 или SsangYong Rexton). Соответственно, их замена выполняется вместе с рычагом, даже если он еще в хорошем состоянии.

Если же люфт не выявлен, нужно проверить состояние пыльника. Дело в том, что зачастую причиной появления шума в шаровых является попадания грязи под шарнир. Поэтому в шарнир нужно добавить смазку и заменить пыльник.

Разрыв шаровой опоры (вырывание шарнира из корупса) может стать причиной ДТП, так как в этом случае колесо выворачивает, и автомобиль падает на асфальт. Поэтому при появлении первых признаков износа ее необходимо менять.

Какие еще узлы вызывают стуки?

Если вы проверили все вышеописанные узлы, но причину стуков так и не выяснили, обратите внимание на втулки стабилизаторов. Как правило, их износ сопровождается не только стуком на кочках, но и скрипом. К слову, именно по этой причине чаще всего скрипит задняя подвеска.

На некоторых автомобилях, таких как Форд Фокус или Рено Дастер, опоры двигателя представляют собой целый механизм, имеющий резиновые втулки. Поэтому причиной стука может стать износ втулок. Определить неисправности опор можно только визуально, внимательно осмотрев все узлы крепления двигателя.

Скрипы и стуки в передней подвеске Лада Гранта: причины и диагностика

Комфорт при поездке на автомобиле Лада Гранта складывается из многих факторов, один из которых – работа передней подвески. Стук, шум, «пробои» подвески влияют и на безопасность движения, поэтому своевременная диагностика поломок этого узла просто необходима. Провести ее лучше в сервисном центре, но некоторые неисправности можно установить и самостоятельно.

Вероятные причины неисправности подвески

Вид на переднюю подвеску «из под колеса»

Неприятный скрип передней подвески Лада Гранта, «пробои» в ее работе кроются в неисправности элементов этого узла автомобиля. Условно их можно разделить на две группы: стойка амортизатора с содержимым и все остальные. Причина выделения стойки в отдельную категорию вызвана увеличенной на нее нагрузкой: она выполняет одновременно функцию верхнего рычага и гасит вертикальные вибрации колеса.

К основным причинам неисправностей телескопической стойки относятся следующие:

  1. Ослабление крепления ее верхней опоры к несущему кузову.
  2. Разрушение резинового буфера.
  3. Течь жидкости из амортизатора, задиры на его штоке, повреждение хромового покрытия штока.

Амортизатор потёк (необходима замена)

На фото: рычаг нижний в сборе с шаровой

Возможны также повреждения шаровой опоры, обычно вызванные завышенным ресурсом ее работы или установкой некондиционной детали. Изношенные резиновые втулки в стабилизаторе и растяжках также скажутся на плавности хода подвески. Поломка основной пружины маловероятна, но естественный износ или установка нестандартной модели могут стать причинами потери упругости подвески в целом.

Самостоятельная диагностика неисправностей в передней подвеске

Существует несколько объяснений даже одному симптому поломки, поэтому выявить истинную причину неисправности лучше на автостанции.

Можно выделить следующие группы признаков отклонений в работе передней подвески:

  • Самопроизвольное отклонение от прямолинейного движения, «рыскание» машины.
  • Шумы, стуки, «пробои» при езде по неровным дорогам.
  • Заниженный ресурс элементов подвески, быстрый выход их из строя.

«Отбилась» краска на стойке и стойка начала ржаветь

К первой группе относятся обычно неисправности стабилизатора устойчивости. Визуально можно осмотреть всю подвеску и, если нет признаков вмятин, деформаций, то стоит проверить установку углов схода/развала передних колес. Внешне их отклонение наблюдается в неравномерном износе протектора передних колес, но для появления стертости шин потребуется определенное время.

Есть шанс и установить на слух эту поломку: при вхождении в поворот будет слышен скрип резины, а руль при этом обычно не возвращается в исходное положение самостоятельно.

Входит в число временных неисправностей автомобиля Лада Гранта скрип в передней подвеске, если он вызван эксплуатацией машины по загрязненной или песчаной дороге. В этом случае возможно попадание частиц песка в резиновые уплотнители (сайлентблоки) стабилизатора или растяжек. После мойки шумы пропадают.

Подвеска «проще не бывает» — это только плюс.

Подвеска «проста до безобразия», краб, стойка, нижняя шаровая, два сайлентблока — и всё, вот и вся её капиталка.

После любых работ, которые связаны с отсоединением ступицы от стойки, необходимо делать сход-развал. На крайний случай можно попробовать нанести зубилом метки на стойке и на развальном болте (он сверху).

Стук при езде по неровностям

Нехарактерен и стук в подвеске при езде по неровностям: Лада Гранта хоть и не является автомобилем повышенной проходимости, но вполне способна преодолевать небольшие ухабы. Обычно стуки возникают при ослаблении крепежа, момента затяжек гаек, износе шаровой опоры или стойки амортизатора.

Если ресурс работы элементов подвески слишком короткий, то причин обычно две: низкое качество используемых деталей или слишком динамичный, агрессивный стиль езды.

Также стоит обратить внимание на соответствие передних колесных дисков и самих покрышек с рекомендованными изготовителем.

Устройство подвески Лада Гранта

Устройство передней подвески (схема)

В этом автомобиле применена независимая подвеска с одним рычагом, к которому прикручивается нижняя часть поворотного кулака. Его верх монтируется к стойке амортизатора, работа которой отличается от многих аналогичных узлов на отечественных автомобилях. При повороте рулевого колеса происходит вращение кулака со стойкой амортизатора и размещенной на нем пружиной. Шнек амортизатора, прикрученный через подшипник к верхней опоре стойки, остается неподвижным.

Шаровая опора обеспечивает гибкое сочленение поворотного кулака и рычага подвески. Угол развала колес регулируется традиционно для переднеприводных версий автомобилей ВАЗ – гайкой с эксцентриком на основной стойке амортизатора, в месте соединения ее с поворотным кулаком. От курсовых колебаний подвеска удерживается благодаря общему стабилизатору поперечной устойчивости и растяжкам с обеих сторон подвески.

Подробно на фото

Все элементы подвески на фото снизу

  1. штанга стабилизатора поперечной устойчивости;
  2. резинометаллический шарнир поперечного рычага;
  3. амортизаторная стойка;
  4. растяжка;
  5. кронштейн растяжки;
  6. гайка крепления растяжки к кронштейну;
  7. шаровая опора амортизаторной стойки;
  8. шарнир поперечной устойчивости;
  9. поперечный рычаг;
  10. скоба крепления штанги стабилизатора

Слабые места подвески

В влажную погоду не всегда возможно увидеть дефект стойки амортизатора

Если осуществляется самостоятельный ремонт, например, замена шаровой опоры, то необходимо внимательно затягивать болты крепления. В поворотном кулаке, к которому крепится опора, нет сквозных отверстий: болт вворачивается в сам кулак. Излишнее усилие при затяжке чревато поломкой болта. Стук в передней подвеске может появиться и по этой причине.

Для надежной и продолжительной работы подвески необходимо соблюдать скоростной режим машины, заявленный в ее техническом паспорте. Также регулярное проведение ТО поможет исключить появление шумов, стуков и увода от прямолинейного движения.

Я заметил непонятный стук, доносившийся с правой стороны передней части автомобиля. Так как нет у меня дома оборудованной ямы, я поехал в сервис, где ребята сказали, что у моей машины полетела шаровая опора. Не самая дорогостоящая из запчастей автомобиля. Замена также не потребовала больших финансовых вложений.

Появился стук при прохождении кочек на переднем левом колесе, также при торможении руль тянет влево, а при разгоне вправо. Выяснили, что имеет люфт рулевой наконечник со стороны рулевой тяги.

Стук в передней подвеске лада гранта

На чтение 4 мин. Просмотров 20 Обновлено

Здравствуйте друзья. Такая вот проблема возникла странная. Даже не знаю в чем дело. Вибрация от колеса идет при ударе в яму даже незначительную. Ощущение что сейчас колесо отвалится)) вибрация сильная кратковременная, именно колеса или чего то там еще. Может резина уже изношена? На ней есть шишки небольшие, изза чего на скорости от 70 идет вибрация на биение. Заменил опорники вместе с подшипником, удары стали еще сильнее ощущаться( а старые подшипники были сильно разбиты и был люфт большой. Может жесткая конструкция этих Savi дает такой эффект?

Грешу на чашечки в стойке. Нижняя развернута крыльями кверху.»(«-положить визуально влево. А верхняя чашка так же лежит кстати. Или все же стойкам хана? Дампы. Сжимаешь шток, а он не выходит сам. Яйца заменены, рычаги затянуты. Только резинки старые остались в сабле. Спасибо всем. Всех грешу на слишком большое колесо и старую резину 195-55-16. Кстати рейка так же новая. 14 года. Попалась от приоры 4.1:(

При появлении посторонних стуков в подвеске движущегося автомобиля Лада Гранат необходимо сразу же установить их источник независимо от того, постоянный это стук или появляется только при проезде неровностей. Диагностировать исправность узлов трансмиссии по издаваемым ими шумам довольно трудно. Если вам не удалось точно определить источник шума (стука) в подвески или трансмиссии, обратитесь к квалифицированному специалисту. Вышедшие из строя узлы трансмиссии отремонтируйте или замените.

Проверять состояние подвески лучше на автомобиле Лада Гранта ВАЗ 2190, установленном на эстакаду, смотровую яму или подъемник, а если такой возможности нет, можно выполнить проверку состояния подвески на свободной ровной площадке, хотя и с меньшими удобствами. В любом случае вам понадобится помощник.

Возможные причины стуков в подвеске на автомобиле Лада Гранта / Lada Granta ВАЗ 2190 и способы их устранения.

Неисправны амортизаторные стойки

Замените или отремонтируйте амортизаторные стойки

Ослаблены гайки крепления штанги стабилизатора поперечной устойчивости автомобиля; изношены подушки и резинометаллические шарниры (сайлентблоки)

Подтяните гайки крепления штанги; при износе резиновых подушек замените их, замените поврежденные детали стабилизатора поперечной устойчивости автомобиля

Повреждение, деформация резинометаллических шарниров (сайлентблоков) рычагов, верхних опор амортизаторных стоек

Замените рычаги, верхние опоры стоек

Износ шаровых опор рычагов передней подвески

Замените шаровые опоры

Повышенный зазор в подшипниках ступиц передних колес

Большой дисбаланс колес

Сделайте балансировку колеса

Деформация колесного диска

Осадка или поломка пружины подвески

Износ резинометаллических шарниров (сайлентблоков) рычагов задней подвески

Замените резинометаллические шарниры (сайлентблоки)

Стук от «пробоя» подвески вследствие разрушения буферов сжатия

Замените поврежденные буфера

Частые «пробои» задней подвески из-за перегрузки задней оси.

Не допускайте перегрузки.

Возможные причины стуков (шумов) трансмиссии на автомобиле Лада Гранта / Lada Granta ВАЗ 2190 и способы их устранения.

Шум при выключенном сцеплении

Износ подшипника выключения сцепления или отсутствие в нем смазки.

Замените подшипник выключения сцепления.

Шум при выключенном сцеплении

Деформация или выход из строя деталей ведомого диска сцепления.

Замените ведомый диск сцепления.

Шум в коробке передач

Недостаточный уровень маслаИзнос или разрушение подшипников или шестерен.

Проверьте уровень масла, при необходимости долейте.

Замените поврежденные детали

Шум при переключении передач

Неполное выключение сцепления.Износ синхронизаторов.

Замените поврежденные детали.Замените изношенные детали.

Стук в начале движения автомобиля

Износ шарниров равных угловых скоростей.Увеличенный зазор в зацеплении шестерен главной передачи.

Замените неисправные шарниры равных угловых скоростей.

Отрегулируйте зазор в зацеплении шестерен главной передачи.

Стук в начале движения автомобиля

Износ наружного шарнира равных угловых скоростей.

Замените неисправный шарнир равных угловых скоростей.

Гранта 13 года, пробег 99, на кочках сильные стуки идут, сильно напрягает, колеса 195/50/15
Все родное по ходовой, только шаровые поменял.
У сестры калина 14г, по кочкам вообще тихо, стуков вообще нет
У кого так было?

Меняй резину на больший профиль

0

0 Рейтинг ответа: 0

Как вариант. Рулевой карданчик

0

0 Рейтинг ответа: 0

Мб шаровые бракованные были, ромашки посмотри

0

0 Рейтинг ответа: 0

Так же фигня, на ямах или кочках стуки и в руль отдает

0

0 Рейтинг ответа: 0

Так же было пробег 157000, поменял ромашки, шаровые, рулевые наконечники, опорники, втулки на «тяге стабилизатора» и яйца. Теперь такая тишина. Кстати, рулевой карданчик подтяни

0

0 Рейтинг ответа: 0

Рулевые наконечники и ромашки смотри
И сход-развал не забудь

0

0 Рейтинг ответа: 0

Стук задней подвески лада гранта

В предыдущей записи писал про то, что на ТО попросил протянуть ходовку. Причина в появившемся недавно глухом стуке сзади справа при проезде неровности. После ТО ни чего не изменилось. Сам перетряхнул багажник. Ни чего не болтается, не стучит. Проверил крепление запаски. Все в норме. Где искать этот стук?

Mileage: 3900 km

В моем случае стук сзади по неровной дороге был из за вывалившегося вентиляционного клапана багажника, который настукивал застряв между бампером и кузовом.

1) Стучал у меня глушак в последней подвесной резинке вылечилось заменой.
2) Стук был из за ослабщего хомутика прижима тросика ручника в задней балке- вылечилось подогнул подложел резинку.
3) Замок багажник — регулировал подложил резинку под петлю и выкрутил побольше отбойники резинки.
4) что то еще есть побрякивает несильно думаю колодки в барабанах. пока незнаю где копать сам.

у меня это оказалось всего лишь замок крышки багажника постукивал в закрытом положении о петлю, скобку перемотал изолентой и побольше выкрутил упорные резинки на крышке.

у меня это оказалось всего лишь замок крышки багажника постукивал в закрытом положении о петлю, скобку перемотал изолентой и побольше выкрутил упорные резинки на крышке.

Точно. Сейчас ехал, свернул на гравийку и открыл с кнопки багажник. Стук пропал. Теперь буду его устранять. Всем спасибо.

Такая же фигня была. Резинки чуть выкрутил, замок смазал и все.

может трос ручника скрепит.не пробывал загинать проушины

Скрип троса ручника я победил уже давно. Тут именно глухой стук. Как будто что-то в багажнике катается и постукивает. На мазде предыдущей было похожее, когда верхнее крепление стойки ослабло. Но здесь все в порядке. Начинаю грешить на вентиляционный клапан под бампером. Читал, что он частенько вылетает и брякает. Вот только добираться до него тяжело. Может еще кто что подскажет. Если нет, придется снимать бампер…

Задняя подвеска автомобиля полунезависимая, выполнена на упругой балке с продольными рычагами, цилиндрическими пружинами и телескопическими амортизаторами двустороннего действия.

Балка задней подвески состоит из двух продольных рычагов, соединенных поперечиной U — образного сечения.

Такое сечение обеспечивает соединителю (поперечине) большую жесткость на изгиб и меньшую — на кручение.

Соединитель позволяет рычагам перемещаться относительно друг друга в небольших пределах. Рычаги выполнены из трубы переменного сечения, — это задает им необходимую жесткость

К заднему концу каждого рычага приварены кронштейны для крепления амортизатора, щита заднего тормозного механизма и оси ступицы колеса.

Спереди рычаги балки закреплены болтами в съемных кронштейнах лонжеронов кузова.

Подвижность рычагов обеспечивается резинометаллическими шарнирами (сайлент-блоками), запрессованными в передние концы рычагов.

Нижняя проушина амортизатора крепится к кронштейну рычага балки. К кузову амортизатор прикреплен штоком с гайкой.

Эластичность верхнего и нижнего соединений амортизатора обеспечивают подушки штока и резинометаллическая втулка, запрессованная в проушину.

Шток амортизатора закрыт гофрированным кожухом, защищающим его от грязи и влаги. При пробоях подвески ход штока амортизатора отграничивается буфером хода сжатия, выполненным из эластичной пластмассы.

Пружина подвески своим нижним витком опирается на опорную чашку (стальную штампованную пластину, приваренную к корпусу амортизатора), а верхним — упирается в кузов через резиновую прокладку.

На фланце рычага балки установлена ось ступицы заднего колеса (она крепится четырьмя болтами).

Ступицу с запрессованным в нее двухрядным роликовым подшипником удерживает на оси специальная гайка. На гайке выполнен кольцевой буртик, который надежно стопорит гайку путем его замятия в проточку оси.

Подшипник ступицы закрытого типа и не требует регулировки и смазки в процессе эксплуатации автомобиля.

Пружины задней подвески делятся на два класса: А — более жесткие, В — менее жесткие.

Пружины класса A маркируются коричневой краской, класса B — синей.

С правой и с левой стороны автомобиля должны устанавливаться пружины одного класса.

В передней и задней подвеске устанавливаются пружины одного класса. В исключительных случаях допускается установка пружин класса B в задней подвеске, если в передней установлены пружины класса A.

Установка пружин класса A на заднюю подвеску не допускается, если в передней установлены пружины класса B.

Проверка состояния подвески

Оценить техническое состояние подвески можно во время движения автомобиля. При движении на небольшой скорости по неровной дороге подвеска должна работать без стуков, скрипов и других посторонних звуков.

После переезда через препятствие автомобиль не должен раскачиваться.

Проверку подвески лучше совместить с проверкой состояния шин и подшипников ступиц колес.

Односторонний износ протектора шины свидетельствует о деформации балки задней подвески.

1. Подготавливаем автомобиль к выполнению работы.

Проверять работоспособность амортизаторов лучше после продолжительной поездки, пока рабочая жидкость в амортизаторах не остыла.

2. Энергично раскачиваем заднюю часть кузова автомобиля в вертикальном направлении.

Если по инерции кузов продолжает совершать колебания (более двух: вверх и вниз), после того как его перестали раскачивать, значит, неисправен один или оба амортизатора.

Чтобы выявить неисправный амортизатор, повторяем проверку, прикладывая усилия сначала с одной стороны автомобиля, а затем с другой.

Такая проверка позволяет выявить только неисправные амортизаторы.

Проверить эффективность гашения колебаний амортизаторами можно только на специальном стенде.

3. Осматриваем амортизаторы подвески — подтекание жидкости из амортизаторов не допускается.

Амортизаторы следует заменять парой, даже если второй амортизатор задней подвески исправен.

4. Визуально проверяем состояние резинометаллических шарниров крепления амортизаторов 1 и рычагов балки заднего моста 2.

Шарниры с односторонним выпучиванием резины, разрывами и трещинами заменяем.

5. Проверяем затяжку гаек крепления деталей подвески, при необходимости подтягиваем их.

6. Осматриваем детали подвески. Деформация и усталостные трещины в деталях подвески не допускаются.

Поврежденные детали заменяем.

Пружины, как и амортизаторы, заменяйте парами.

Моменты затяжки резьбовых соединений задней подвески

Если вы собираетесь ездить зимой на автомобиле, неплохо было бы проверить состояние ходовой части и трансмиссии, чтобы не пришлось заниматься ремонтом прямо на дороге, в грязной снежной жиже. Любой владелец Granta может сэкономить и время, и деньги, если проверит авто самостоятельно. Сегодня речь — о ходовой и трансмиссии.

LADA > Granta

Cover granta var2.indd

Проверку ходовой части и трансмиссии выполняем через каждые 15 тыс. км пробега.

Работу выполняем на смотровой канаве или эстакаде.

На деталях ходовой части (колесах, рычагах подвесок, стабилизаторе поперечной устойчивости, балке задней подвески, амортизаторах и пружинах подвесок) и трансмиссии (валах приводов передних колес) не должно быть деформаций, трещин и других механических повреждений, влияющих на форму и прочность деталей.

Поочередно вывешивая передние колеса (при этом автомобиль должен быть надежно зафиксирован на опорной стойке), проверяем состояние подшипников ступиц колес.

Используйте опорные стойки только заводского изготовления.

Колесо от руки должно вращаться равномерно, без заеданий и стуков.

Granta 38 4 новый размер

Убеждаемся в отсутствии люфта (стука). При наличии стука на переднем колесе просим помощника нажать педаль тормоза. Если при этом стук пропал, значит, неисправен подшипник ступицы, а если стук остался — то, скорее всего, изношена шаровая опора.

Подшипники ступиц передних и задних колес не регулируются и при наличии люфта подлежат замене.

Для проверки исправности шаровой опоры вставляем монтажную лопатку между рычагом подвески и корпусом шаровой опоры. Не повредите при этом чехол шаровой опоры.

Granta 39 1 новый размер

При наличии люфта в соединении заменяем шаровую опору.

Granta 39 2 новый размер

Шаровые опоры с порванными, потрескавшимися чехлами заменяем.

Для проверки сайлент-блока рычага передней подвески…

Granta 39 3 новый размер

…и пытаемся сдвинуть рычаг вдоль его оси и вдоль оси болта. Если рычаг перемещается свободно, без усилий, значит, сильно изношен или поврежден сайлент-блок рычага и его необходимо заменить. Разрывы, растрескивания и выпучивание резиновой втулки сайлент-блока недопустимы.

Granta 39 4 новый размер

Разрывы, растрескивания выпучивание резины сайлент-блоков недопустимы.

Granta 39 5 новый размер

При обнаружении разрывов, растрескиваний и сильной деформации на резиновых подушках и втулках их необходимо заменить.

Поочередно вывешивая задние колеса, проверяем состояние подшипников ступиц задних колес. Колесо от руки должно вращаться равномерно, без заеданий и стуков.

Для проверки состояния сайлент-блоков рычагов задней подвески…

Granta 39 6 новый размер

Если рычаг перемещается свободно, без усилий, значит, сильно изношен или поврежден сайлент-блок рычага и его необходимо заменить.

Granta 39 7 новый размер

Пружины подвесок не должны иметь повреждений. Разрывы, растрескивания и сильная деформация резиновых втулок, подушек и буферов сжатия амортизаторов недопустимы.

Не допускается подтекание жидкости из амортизаторов. Незначительное «отпотевание» амортизатора в верхней его части при сохранении характеристик не является неисправностью.

При осадке или разрушении резинового элемента верхней опоры телескопической стойки передней подвески опору необходимо заменить.

Granta 39 8 новый размер

Поочередно вращая и поворачивая передние колеса (при вывешенной передней части автомобиля)…

Granta 40 1 новый размер

Granta 40 2 новый размер

Потрескавшиеся, порванные или потерявшие эластичность чехлы подлежат замене.

Проверяем отсутствие течи масла из коробки передач через сальники внутренних шарниров приводов. При наличии течи заменяем сальники.

Подробнее с устройством, техобслуживанием и ремонтом Lada Granta можно ознакомиться в нашей Википедии (ссылка)

Почему на «Гранте» при повороте стук в колесе 🦈 avtoshark.com

Во время езды по неровным дорогам, а также из-за неправильной затяжки, фиксация гаек ослабевает, из-за чего на поворотах и во время проезда неровностей в подвеске слышится стук. Это очень опасный симптом, ведь если гайка открутится полностью, то подвеска выйдет из строя, и автомобиль потеряет управляемость.

Lada Granta — современный автомобиль, выпущенный отечественным производителем и максимально соответствующий западным стандартам. Но, как ни старались конструкторы, а проблемы остались. Одна из них — стук в районе колеса на «Ладе Гранте» при повороте руля.

Почему колесо при повороте издает звук

При повороте руля стук в районе колеса на «Ладе Гранте», а также другие посторонние звуки, не свойственные исправному автомобилю, обычно вызваны несколькими причинами. Рассмотрим их подробнее.

Неправильное схождение

Если схождение выставлено неправильно, автомобиль при движении уводит в сторону. Чем сильнее отклонение от нормы, тем громче скрип покрышек как в повороте, так и во время прямолинейного движения. Возникает он из-за цепляния подкрылка или кузова о колесо.

Неправильный развал

Это уже угол монтажа колес по отношению к дорожной поверхности. Идеальным вариантом на «Гранте» является перпендикулярная установка. Если развал будет отрицательный, то это приведет к повышенному износу внутренней кромки шины при прямолинейном движении или нестабильности при маневрах.

Все это также может приводить к скрипам, колесо будет цеплять за локер или кузов.

Неправильный кастор

Кастором называют расположенный в длину наклонный осевой поворотный угол. Другими словами — черта, проложенная через обе точки фиксации стойки. Если при взгляде сбоку ось поворота колеса завернута в сторону кормы автомобиля, речь идет о положительном касторе. Чем больше кастор смещен сюда, тем более стабильно «Гранта» будет вести себя на дороге, но от этого возрастет усилие на руль при поворотах. Автомобиль даже может приподниматься, создавая совсем нежелательный боковой крен. Естественно, что такой момент сопровождается скрипом.

Изношен наружный ШРУС

Если при повороте руля слышен хруст в районе колес «Гранта», это может быть граната. Проверить это можно, выставив машину на ровной площадке и вывернув колеса в одну из сторон до упора. Затем надо попытаться плавно тронуться с места. Хруст при повороте руля выдаст повреждение внешнего шарнира.

Не закреплен или поврежден локер (подкрылок)

Локеры, конечно, изолируют колесные арки и снижают шум в салоне. Если сзади «Гранты» установка подкрылков проводится основательно, с поднятием машины и использованием дополнительных крепежей, то в передней части дело обстоит иначе. Здесь больше места, детали заводятся в пазы без дополнительных крепежей.

Замена деталей колес

Часто они ослабевают и трутся о колесо, что вызывает скрип колеса при повороте «Гранты».

Поврежден опорный подшипник

Деталь расположена между опорой и верхней чашкой пружины. Чтобы проверить опорный подшипник, надо положить руку на виток переднего амортизатора. Затем попросить товарища покрутить руль влево, вправо. Металлический лязг и отдача в руку укажут на повреждение элемента.

Деформирована рулевая тяга

Деформация определяется после визуального осмотра — изменяется форма тяги, которая цепляется за какую-либо часть кузова. Это вызывает стук в районе колеса на «Ладе Гранте» при повороте руля.

Изношена шаровая опора

Если пластиковая втулка шаровой опоры изношена, то появляется люфт пальца опоры, из-за чего во время проезда небольших неровностей появляется звук глухих ударов. Ведь нижний рычаг подвески смещается относительно поворотного кулака, а затем приближается к нему, издавая при ударе стук.

Не затянута одна из гаек подвески

Во время езды по неровным дорогам, а также из-за неправильной затяжки, фиксация гаек ослабевает, из-за чего на поворотах и во время проезда неровностей в подвеске слышится стук. Это очень опасный симптом, ведь если гайка открутится полностью, то подвеска выйдет из строя, и автомобиль потеряет управляемость.

Изношены резиновые уплотнители и сайлентблоки

Резинотехнические изделия обеспечивают ограниченный диапазон передвижения деталей подвески друг относительно друга без столкновения. Однако когда они изношены, диапазон движения деталей увеличивается и они иногда сталкиваются друг с другом, что и приводит к появлению стуков.

Замена деталей

Также изношенные подушки и уплотнители становятся причиной скрипов во время поворота, резкого разгона или торможения.

Деформирован кузов

Деформация кузова нарушает работу всей подвески. Из-за этого сбиваются настройки кастора, развала и схождения, что приводит к соприкасанию между собой элементов. В результате они начинают скрипеть или стучать. Кроме того, часть деталей (сайлентблоки и другие резинки) перекашивает, и они в движении тоже начинают шуметь. А при сильной деформации кузова само колесо нередко цепляет кузов или детали подвески, что тоже приводит к появлению скрипов и стуков.

Что делать

Очевидно, что надо проверить и устранить конкретную неисправность. Если не соответствует нормам схождение, ключом на 13 ослабляют соединения рулевых тяг. Затем вращением специальных втулок выставляют необходимое значение. В конце фиксаторы затягиваются моментом 19,1-30,9 Н.м.

Инструкция, как проверять развал на «Ладе Гранте»:

  1. Автомобиль установить на стенд.
  2. «Прокачать» подвеску сверху вниз, прикладывая усилие в 40-50 кгс несколько раз, сначала к заднему бамперу, потом к переднему — колеса должны располагаться продольно оси машины.

Ремонт своими руками

Если угол развала имеет отклонение, надо его настроить. Для этого следует ослабить обе регулировочные гайки. Обычно поворачивают верхний болт — если он закис, заранее обрабатывают ВД-40. По окончании корректировки фиксаторы затягиваются моментом 88,2 Н.м.

Другие повреждения:

  • Если причина хруста в ШРУСе, то необходимо заменить пыльник и гранату.
  • Чтобы устранить стук или скрип из-за повреждения деталей подвески (шаровые опоры или различные резинки), необходимо провести полную диагностику подвески и заменить поврежденные элементы, после чего отрегулировать углы схода, развала и кастора.
  • Ослабленный локер надо основательно закрепить.
  • Разрушенный опорный подшипник и тягу надо заменить.
  • Деформированный кузов исправляют в специализированных центрах. Если геометрия сильно изменена, каркас заменяют целиком.

Если колесо «Гранты» при повороте издает звук, надо срочно выявить причину и устранить ее.

Стук в передней подвеске — причины стука и способы их устранения


Появление шума и стуков во время езды является признаком возникновения неисправностей и поломок в ходовой части автомобиля. Дальнейшее движение на машине может закончиться достаточно плачевно. Если удастся определить источник стука в передней подвеске, то многие поломки можно будет устранить самостоятельно.

Источников неприятных звуков в передней подвеске много, и далеко не во всем виновата именно система подвески и амортизации. Греметь могут изношенные детали рулевой системы, тормозов и даже двигателя. Именно поэтому требуется комплексная диагностика автомобиля.

Появился стук в заднем колесе при торможении Лада Гранта

Автомобиль: Лада Гранта. Спрашивает: Павел. Тормозная система: Без АБС Симптомы: слышен стук в районе заднего левого колеса при торможении.

Появился стук на автомобиле Лада Гранта при торможении. Стук слышен в районе заднего левого колеса. Я думал сорвал накладку тормозной колодки, были холода и пару раз колодки примерзали. Я снял барабан чтобы заменить колодки, а накладки стоят на своих местах, распорная планка тоже сидит плотно, не брякает.

Подергал стабилизатор, продольный рычаг, амортизатор, стуков и люфта нет. Пошатал вывешенное колесо в горизонтальной и вертикальной плоскостях, стука нет. Что еще может быть?

Ответ эксперта

The following two tabs change content below.
У меня был аналогичный стук, похожий на звук «ДУК-ДУК-ДУК». Звук такой же как на видео, только послабее.

С меньшей долей вероятности можно предположить, что в попал камушек в барабан, но это очень редкий случай.

Если у вас именно такой звук, то это почти стопроцентно тормозная колодка цепляет барабан. Осталось выяснить почему это происходит.

Изношенные или не верно установленные колодки

Изношенный задний тормозной барабан — на свалку Изношенные задние тормозные колодки — на свалку
Вы когда снимали барабан, то смотрели на состояние износа тормозных колодок? Скорее всего у Вас либо на колодке, либо на барабане появились канавки, или нарушилась их геометрия. Необходимо снова снять задний барабан и провести более тщательную профилактику.

Часто такой звук возникает из-за того, что тормозные колодки своим торцом задевают за барабаны.

Правильно установленные задние тормозные колодки

Поломка тормозного цилиндра

Проверьте работу тормозного цилиндра

Также в моей практике случались случаи, когда виной появления посторонних звуков при торможении являлся неисправный тормозной цилиндр или распределитель тормозов. В данном случае, Вам необходимо поднять машину на подъёмнике, или вывесить оба колеса, и посмотреть с напарником, как схватывают задние колёса.

Тормозной цилиндр может подклинивать, и давать резкий удар колодкой в барабан. А потом в результате того же клина, колодка медленно возвращается на место, и слышны посторонние звуки.

Поломка распределителя тормозов

Распределитель тормозных усилий

Также и неисправный распределить (в народе «Колдун») может неверно распределять тормозные усилия. В данном случае при резком торможении у Вас может «заносить зад», в результате юза одного из задних колёс. Распределитель заклинивает и даёт резкую нагрузку на колодку одного из колёс, а потом не отпускает. Это является симптомом данной поломки.


Источники стука в рулевой системе

Как ни странно, но часто виновником стука в передней части авто становятся отдельные детали рулевой системы. Шарнирные соединения в рулевых тягах и наконечниках со временем изнашиваются, в них появляются зазоры. Из-за этого при движении по ухабистой дороге отчетливо слышатся шумы и стуки.

  1. Чтобы проверить исправность рулевых наконечников, понадобится эстакада или смотровая яма. В некоторых моделях дотянуться до рулевого наконечника можно с внешней стороны колеса. Для диагностики лучше воспользоваться помощью напарника. Его задача — резкими короткими движениями поворачивать рулевое колесо влево-вправо. В это время следует положить ладонь руки на наконечник – наличие люфта будет передаваться стуком в руку. Дополнительно можно взяться на наконечник и поднять его вверх-вниз, даже небольшой износ можно почувствовать при такой диагностике.
  2. Аналогичным образом следует оценить состояние рулевых тяг. Взявшись рукой за тягу, автомобилист ощутит наличие зазоров в шарнирном соединении. Кроме того, сильными и резкими движениями от колеса к рулевой рейке и обратно можно подтвердить наличие износа детали.

Для замены рулевой тяги и наконечника потребуется специальный съемник и набор накидных и рожковых ключей. Перед работой следует очистить детали от песка и грязи, а затем обработать разъемные соединения «жидким» ключом типа WD-40.

Стук и скрип сзади при торможении на автомобилях LADA

02 октябрь 2020 LadaOnline 32 975
Сталкивались, когда-нибудь с ситуацией, когда при торможении сзади автомобиля появляются посторонние шумы (стуки, удары, скрипы)? Такая проблема может встречаться на любом автомобиле Лада (например, Калина, Приора, Гранта, Ларгус, Нива, Веста или XRAY). Расскажем про возможные решения этой неисправности.

Чаще всего посторонний шум сзади при торможении возникает при большом износе расходников (тормозные барабаны или колодки №3). Стук может появляться при закусывании колодок. При разборке тормозного барабана также обратите внимание на состояние тормозного цилиндра №1, который может подклинивать. Меняем колодки на новые.

В некоторых случаях виновником становятся изношенные стяжные пружины №2 и №7, которые со временем растянулись или лопнули. В результате нормальная работа задних тормозов нарушается.

Еще одной причиной стука сзади может быть трос ручника или его выскочившая пружина №14. Осмотрите все детали, а ручник подтяните.

Иногда причиной недуга может быть разболтавшийся подшипник задней ступицы. В этом случае шум (шоркает и постукивает) сзади появляется во время торможения на малой скорости.

Последняя причина, с которой приходилось сталкиваться многим владельцам машин — слишком длинные колесные болты. Например, более длинная секретка цепляет при торможении и появляется стук. Решение: заменить его на более короткий.

На автомобилях платформы B0 (Lada Largus, XRAY, Renault Logan, Sandero и др) со временем появляется скрип в задних тормозных механизмах. Причина: колодка трет о тормозной щит. Снимаем фиксатор и отводим колодку, видим место потертости. Зачищаем эти проблемные места и смазываем консистентной смазкой. Подробней на видео:

А вам приходилось сталкиваться со стуком сзади при торможении автомобиля? Каким образом вы устранили эту проблему? Решаем подобные проблемы в комментариях или на форуме. А если скрип при торможении исходит из передней части, то скорей всего этот шум издают передние тормозные колодки, которые следует заменить парой на более качественные.

Ключевые слова: тормоза lada xray | тормоза лада веста | тормоза лада ларгус | тормоза лада гранта | тормоза лада калина | тормоза лада приора | тормоза нива | универсальная статья

2 1

Обнаружили ошибку? Выделите ее и нажмите Ctrl+Enter..

Похожие материалы

  • Что делать если стучат гидрокомпенсаторы на автомобилях Лада
  • Неисправности тормозной системы Лада Ларгус и способы их решения
  • Выбираем лучшие передние тормозные колодки Лада Ларгус (опрос, отзывы)

Продолжение про щелчки при торможении. — Лада Гранта, 1.6 л., 2013 года на DRIVE2

Итак, в прошлой записи я писал, что наблюдал легкие стуки или щелчки при легком торможении (сзади). Отписываюсь о продолжении истории…

А продолжения особо и не было. Ездил, никуда не лазил. В отпуске накатал около 3 тыс.км. Вернулся на работу, а там коллега рассказывает как менял на своей приоре задние ступичные подшипники (пробег 30 ткм, как у меня) и после этого у него началось…да, да, те самые щелчки при торможении. Напомню, у меня тоже они появились после вмешательства (замены тросов ручника у дилера по гарантии). Коллега ездил повторно на сервис, ему разобрали, посмотрели, собрали. Щелчки вроде прошли, а потом опять начались…) Он в 3-й раз поехал, опять ничего не нашли…)

Тут надо сказать, что я-то к этому времени уже и ЗАБЫЛ что у меня щелкало! Т.е. у меня просто прошли симптомы, либо стали очень не заметны (я не замечаю уже несколько недель).

В природе стука я так и не разобрался, но очевидно, что он появляется после вмешательства (снятия барабанов или еще чего) и скорее всего пройдет само и у коллеги (о чем ему и поведал).——

Добавлено через месяц Щелчки опять появились. Раздражает немного…лезть не хочется. (хотя, может и поеду к дилеру, если будут явно и постоянно наблюдаться).

——

Запись еще три месяца спустя.

Щелчков нет. Забыл когда были…Ничего не делал. Барабаны не снимал.

Пробег: 32000 км

Подводим итоги

Качественная работа тормозов в авто — это одна из самых важных особенностей безопасной поездки. Если эксплуатация машины доставляет определенные трудности или дискомфорт в части торможения, следует сразу обратиться на СТО и решить проблему. Иначе можно столкнуться с неприятными ситуациями, когда торможение окажется неэффективным в сложный момент и не сможет предоставить необходимые особенности работы. Учитывая важность тормозной системы для безопасности, лучше не шутить с этим узлом и вовремя выполнять все работы. Скрип и скрежет может возникнуть в том случае, если вы не соблюдаете важные требования производителя по части обслуживания авто.

Простая замена колодок в самом начале проявлений скрипа может сэкономить вам деньги, время, а также обеспечить вашу безопасность. Чтобы полностью избежать неприятностей, достаточно вовремя выполнять осмотр и реагировать на все неприятные проявления. Поведение машины, а также звуковые эффекты неполадок также могут стать важным моментом по части диагностики автомобиля. Зачастую именно эти моменты являются важным предвестником проблем. Что вы предпринимаете, если автомобиль начинает издавать какие-либо противоестественные звуки?

в общем, проблема заключается в том, что при торможении: допустим, перед светофором издается стуки из задних барабанов, можно назвать даже — щелчки, эта проблема появилась после замены колодок, потом купил другие и все прошло) через несколько недель опять появилось, выкинул колодки и купил другие, не прошло и несколько недель и теперь с этими также, не пойму, в чем проблема, может, кто сталкивался с такой неисправностью?

(барабаны ровные почти без выработки)

и еще чем ниже скорость тем сильнее слышно

Лада гранта при торможении стук сзади

Загадка вот появилась.Появилось пару недель назад…Подкатываешься к светофору например, легкое торможение, скорость около 30…И слышно стук- или щелчок (как-будто сзади). Иногда повторяется с периодичностью примерно равной обороту колеса (как мне показалось). 2-3 раза щелкнет и потом не слышно… Иногда 1 раз щелкнет (стучок такой). При обычной езде не слышно ничего, про более сильном торможении тоже не слышно. Именно при легком торможении, и обычно на малых скоростях.

При езде по кочкам не слышно (на медленной скорости, или на быстрой — не важно)…Крепление колес проверил — все затянуто.

Что может быть?

Из того что было недавно — в конце апреля меняли тросы ручника у дилера. Может после этого появилось…Или чуть позже.

Появление стука при нажатии на педаль тормоза не распространенное, но все же имеющее место явление. При этом диагностировать причину стука достаточно сложно.

Давайте разберемся от куда берется этот стук и как решить данную проблему.

Тормозная система является одной из основных, обеспечивающих безопасность движения. Именно ею осуществляется замедление автомобиля вплоть до остановки.

Наибольшее распространение на автомобилях получила система с гидравлическим приводом, когда усилие водителя, посредством рабочей жидкости передается на тормозные механизмы, установленные на ступицах колес.

Что касается самих механизмов, то на авто используется два их типа – сейчас все большее распространение получают дисковые механизмы, в которых колодки – элементы, осуществляющие замедление, взаимодействуют с диском, установленным на ступицу колеса.

Раньше более частыми в использовании были барабанные механизмы, в которых колодки помещались внутрь барабана, замедление в таких механизмах производилось за счет разжатия колодок, в результате чего они прижимались к внутренней поверхности барабана.

Но полностью от использования барабанных механизмов не отказались, поскольку в них хорошо реализована стояночная тормозная система.

Поэтому многие авто спереди укомплектовываются дисковыми механизмами, а сзади – барабанными.

Обслуживание системы с гидравлическим приводом сводится к периодической замене колодок, поскольку они в результате взаимодействия стираются.

Поэтому проверка состояния дисков и барабанов необходима.

В приводе проверяется состояние трубопроводов, выполняется визуальный осмотр на наличие подтеков, контролируется уровень жидкости.

Часто после ремонтных работ требуется прокачка привода тормозов, для удаления воздуха из трубопроводов, ведь его наличие может сказаться на работоспособности системы.

Поскольку тормозная система не включает большое количество элементов, то считается, что она вполне надежна и при привальном уходе и обслуживании доставлять проблем не должна.

Крутите барабан или стук сзади при торможении. — Лада Калина Хэтчбек, 1.4 л., 2010 года на DRIVE2

Недавно ездил в Йошкар-Олу и обратно, поезда прошла спокойно не считая того момента что постоянно затягивало окна. Кажется, новый радиатор печки все-таки течет. Будем проверять.

На следующий день после поездки появился стук при сильном торможении.Долго не мог понять откуда. Казалось что спереди. К тому же недавно менял диски, боялся что треснул один из них.

Решил что нужно на яму смотреть.

К сожалению, в ближайшее время сделать это не получалось.Грешу, катался так, особо сильно не гнал, сильно не тормозил.

В один прекрасный день перед работой решил заглянуть за заднее колесо колесо, благо теперь литье и есть щели, не знаю почему, что то подсказало это сделать.

И увидел я следующее:

Естественно сразу в голове-срочно менять.Не дай бог заклинит на ходу.

Поехал в магазин. Долго думал что покупать — алюминий или сталь.Изучил вопрос, решил не утяжелять и купил алюминий завод, новые колодки, комплект новых пружин, попутно решил заменить свечи.

Процесса замены нет к сожалению, делала спеша и один.

1. Открутить щиток резонатора2. Снять резинку-держатель глушителя3. Ослабить ручник4. Снять колеса, барабаны5. Заменить на новые естественно.6. Отрегулировать и затянуть ручник

7. Вернуть резинку и щиток резонатора

Свернул одну шпильку, держащую щиток

Пока не знаю что делать. На ушко намотал хомут пластиковый, чтобы при стуке не бренчало и стучал пластик.

При смене свечей прокрутилась резьба около одного колодца, фиксирующая катушку зажигания.Как так-не понял, даже сил не прикладывал.

Ну и самое ужасное-в крайнем цилиндре свеча в масле сверху.

Грешу на прокладку клапанной крышки.Будем посмотреть в общем, машинка скучать не дает)

На этом пока все, по крайней мере на сегодня)

Всем удачи на дороге)

Стук при нажатии на педаль тормоза

Появление стука при нажатии на педаль тормоза не распространенное, но все же имеющее место явление. При этом диагностировать причину стука достаточно сложно.

Давайте разберемся от куда берется этот стук и как решить данную проблему.

Тормозная система является одной из основных, обеспечивающих безопасность движения. Именно ею осуществляется замедление автомобиля вплоть до остановки.

Наибольшее распространение на автомобилях получила система с гидравлическим приводом, когда усилие водителя, посредством рабочей жидкости передается на тормозные механизмы, установленные на ступицах колес.

Что касается самих механизмов, то на авто используется два их типа – сейчас все большее распространение получают дисковые механизмы, в которых колодки – элементы, осуществляющие замедление, взаимодействуют с диском, установленным на ступицу колеса.

Раньше более частыми в использовании были барабанные механизмы, в которых колодки помещались внутрь барабана, замедление в таких механизмах производилось за счет разжатия колодок, в результате чего они прижимались к внутренней поверхности барабана.

Но полностью от использования барабанных механизмов не отказались, поскольку в них хорошо реализована стояночная тормозная система.

Поэтому многие авто спереди укомплектовываются дисковыми механизмами, а сзади – барабанными.

Обслуживание системы с гидравлическим приводом сводится к периодической замене колодок, поскольку они в результате взаимодействия стираются.

Поэтому проверка состояния дисков и барабанов необходима.

В приводе проверяется состояние трубопроводов, выполняется визуальный осмотр на наличие подтеков, контролируется уровень жидкости.

Часто после ремонтных работ требуется прокачка привода тормозов, для удаления воздуха из трубопроводов, ведь его наличие может сказаться на работоспособности системы.

Поскольку тормозная система не включает большое количество элементов, то считается, что она вполне надежна и при привальном уходе и обслуживании доставлять проблем не должна.

Но это не всегда так. Даже в такой, казалось бы, простой по конструкции системе могут возникать проблемы.

Одной из самых распространенных проблем является появление стука при нажатии на педаль.

Особенности стуков при торможении

Данный стук может иметь разный характер – доноситься с разных сторон авто, появляться на определенной длине выжима педали, быть повторяющимся или одиночным.

Зачастую стук появляется после проведения обслуживающих работ с механизмами системы.

Одной из особенностей сложности выявления данного стука является то, что необязательно тормозная система их издает.

Причиной может быть также привод колес, подвеска, рулевой механизм, подвеска силовой установки. Поэтому выявить причину появления стука иногда бывает очень сложно.

Одной из особенностей этого явления является то, что зачастую стук образуется только при наполовину выжатой педали.

Или же педаль выжимается полностью, к примеру, при интенсивном торможении, то никаких звуков не появляется.

Также часто упоминается, что стук больше проявляется при движении на малых и средних скоростях.

В некоторых случаях он не проявляется, пока тормозные механизмы не нагреются.

То есть, при начале движения ничего не слышно, но после нагрева – неприятный звук появляется.

Также он может быть периодическим, некоторое время его слышно, затем стук исчезает, но потом появляется снова.

Если авто оснащено системой АБС, причиной может являться именно она.

Хотя сейчас многие авто и оснащаются системой самодиагностики АБС, она не всегда может показать неисправность. То есть, никаких сигналов данная система не подает, но при этом АБС неисправно.

Далее опишем самые частые причины появления стука при нажатии на педаль тормоза. Сначала будут указаны элементы самой тормозной системы, в которых может появиться данная неисправность.

Естественно, зачастую причиной стука являются неисправности в тормозных механизмах.

Поиск причины может облегчиться, если стук появляется с какой-то определенной стороны.

Причины стука в тормозных механизмах

Разберемся с механизмами.

Одной из самых распространенных причин стука является износ посадочных мест под направляющие суппорта дисковых механизмов.

При этом появляется люфт суппорта, при торможении он начинает вибрировать, что выливается в появление стука.

Решается проблема достаточно просто – заменяются направляющие.

Стук может появиться и из-за подклинивания поршня суппорта. При торможении жидкость начинает давить на поршень, но он стопорится в цилиндре до тех пор, пока возрастающее давление жидкости все же не вытолкнет его из цилиндра.

При этом поршень ударяет по колодкам и прижимает их, этот удар и является причиной стука.

В данном случае нужно снятие суппорта, извлечение поршня для оценки состояние его поверхности, а также поверхности цилиндра.

При обнаружении следов коррозии, зеркало цилиндра нужно тщательно зачистить, а сам поршень заменить.

Еще одна причина стука кроется в том, что тормозной диск «повело» из-за перегрева, при этом он изгибается.

Во время торможения колодки, доходя до мест изгиба, ударяются о него, чем и вызвано появление стука.

В домашних условиях проверить диск на наличие изгиба без соответствующего практически невозможно.

Однако бывают и исключения.

Однако косвенным признаком данной неисправности может служить неравномерный износ колодок.

Что касается барабанных механизмов, то там тоже достаточно мест, где может появиться стук. Одним из таковых является механизм стояночного тормоза.

Поскольку под авто трос управления механизмом делится на две части, ведущие к механизмам, то вполне возможно, что одна из частей троса ослабилась.

Из-за этого механизм привода ручного тормоза находится в послабленном состоянии, а при нажатии на педаль тормоза в данном механизме колодки расходятся.

Между ними и упорной планкой ручника может появиться люфт, который и приводит к появлению стука.

Как вариант, стучать о кузов может распределительная планка, от которой отходят тросы к механизмам. Если один из тросов не натянут, эта планка может вибрировать, при этом ударяясь о кузов.

Причиной стука может стать также фиксатор колодки. Если он выскочит, то колодка сможет перемещаться, что приведет к возможности ее удара о тормозной барабан.

Насчет АБС, то проверить, является ли она причиной стука достаточно просто – нужно вытянуть предохранитель, который отвечает за работу АБС. У каждой марки авто он находиться в разных местах, нужно смотреть схему.

При этом данная система перестанет работать, но тормозные механизмы будут работающими. Если после этого стук исчезнет – проблемы с АБС и следует обращаться в сервис.

Теперь пройдемся по другим элементам, которые могут вызвать стук при торможении. Одной из причин может стать банальное послабление крепления колеса. При этом оно будет люфтить при торможении и ударятся о ступицу.

Следует также проверить и саму ступицу на наличие люфта. При сильно изношенном подшипнике ступицы вполне возможно появление стуков при торможении.

Следующая составляющая авто, которую следует проверить – подвеска.

Изношенные сайлентблоки и втулки могут оказаться причиной данной проблемы. Износ сайлентблоков рулевого механизма тоже может привести к появлению стуков.

Напоследок следует проверить крепление двигателя. Послабление его на одной из подушек запросто может обеспечить стук.

В целом же, при появлении стуков следует начинать проверку от педали тормоза и идти к механизмам. Причем осматривать и проверять нужно внимательно. Даже небольшой люфт может привести к появлению такой проблемы.

Попутно также следует оценить состояние всех элементов авто, располагающихся возле ступиц, или подсоединяющийся к ней.

Стуки в узлах системы подвески и амортизации

Наибольшее количество стуков обнаруживается в системе подвески и амортизации. Для поиска неисправности необходимо будет заглянуть под автомобиль – без смотровой ямы или подъемника обойтись не удастся.

Стук в сайлентблоках

В первую очередь следует проверить исправность сайлентблоков в рычагах подвески автомобиля. Для этого понадобится плоская монтировка. С ее помощью можно определить износ сайлентблоков, перемещая рычаг, как в продольном, так и в поперечном направлении. Наличие люфтов, а также дефекты резиновой оболочки приводят к появлению стуков.

Некоторые рычаги выполняются в разборном варианте. Тогда заменить сайлентблоки можно самостоятельно. Для этого придется полностью демонтировать рычаг, а затем при помощи специального приспособления с оправкой выдавить сайлентблок наружу. Новую деталь лучше смазать маслом для снижения трения при установке. Внутреннюю посадочную поверхность рычага следует очистить от ржавчины и загрязнений. Установка нового сайлентблока производится тем же приспособлением, что и демонтаж.

Стук в шаровых опорах

В ряде подвесок на рычагах используются шаровые опоры, которые соединяют рычаг со ступицей или амортизаторной стойкой. Для диагностики источника стука нужно вывесить одну сторону автомобиля, а затем взяться за колесо двумя руками и пошатать его влево-вправо. Одновременно нужно наблюдать за поведением шаровой.

Чтобы проверить свои подозрения, можно воспользоваться монтировкой или мощной отверткой с плоским жалом. При наличии люфта шаровая опора требует замены.

Вы можете наглядно посмотреть, как определить неисправную шаровую опору, на видео в конце этой статьи.

Если в качестве крепежа используются болты и гайки, то работу можно выполнить прямо под машиной. Когда производитель закрепил шаровую опору на рычаге при помощи заклепок, то узел нужно будет предварительно демонтировать. Используя сверло и электродрель, заклепки удаляются, а новые шаровые крепятся болтами и гайками.

Неразборные рычаги необходимо полностью заменить. Попытки переделать их в разборные конструкции могут дорого обойтись владельцу авто.

Стук стоек амортизаторов

Следующим проблемным местом в подвеске автомобиля становится стойка амортизатора. Глухой стук в передней подвеске может свидетельствовать о дефекте одного из элементов стойки.

Простейшая диагностика амортизаторов выполняется путем поочередного качания левой или правой передней части машины. При этом ладонь руки нужно опереть на верхнюю часть стойки, которая обычно выходит наружу в моторном отсеке. Наличие стуков автомобилист сразу же почувствует. Более подробно о способах проверки стоек мы писали в статье как проверить амортизаторы.

Разбитый опорный подшипник также часто издает неприятные звуки при движении. Определить его неисправность можно визуально.

Стук в передней подвеске Калины: устранение неисправностей

Стук в передней подвеске Калины требует проведения полной диагностики ходовой части автомобиля. Именно на подвеску оказывают особое негативное воздействие дефекты покрытий дорог, различные ямы и вмятины. Скрипом или стуком подвески выражается какая-либо из поломок механизма ходовой части, которая нуждается в ремонте.


Вернуться к оглавлению

Особенности подвески Калины

При детальном осмотре подвески Калины можно увидеть гидравлические амортизационные стойки, которые крепятся на кулак поворотный в нижней части, являясь основой всей конструкции узла. Болт, находящийся в верхней части кулака поворотного, позволяет производить корректировку элемента развала.

В узле верхняя часть проходит через отверстие, которое находится в имеющемся кронштейне. Кузовная часть оснащена брызговиком, к которому зафиксирован верх стойки с помощью трех гаек. За счет имеющейся эластичности этого узла превосходно гасится высокочастотная вибрация. При этом происходит характерное покачивание стойки подвески Калины при осуществлении рабочего хода.

Передняя подвеска автомобиля Лада Калина является телескопической, обладающей полной независимостью.

Подвеска Калины, для которой характерно наличие конических или витых пружин, обеспечивает особую плавность хода машины за счет наличия стабилизатора. Это позволяет не нарушать и поперечную устойчивость авто. Такая функция выполняется и рычагами, которые относятся к поперечным растяжкам. Подшипник для поворота стойки должен обеспечивать поворот колес.


Вернуться к оглавлению

Характеристики конструкции

Важная техническая характеристика передней подвески Калины — наличие элементов амортизатора в стойке. В конструкции автомобиля нижний рычаг и поворотный кулак в паре скреплены одновременно с поперечиной, относящейся к передней подвеске, что осуществляется при наличии шаровой опоры. Аналогично за счет сайлентблоков происходит стыковка тормозных колодок с подвеской.

Для регулировки угла оси поворота в подвеске используются шайбы, которые располагаются в соединении, образуемом рычагом и растяжкой. Фиксировать подшипник радиально-упорный можно к колесному приводу с помощью гайки. Делая ремонт передней подвески Калины, обязательно необходимо учитывать, в какой степени возможен процесс регулировки узлов и деталей конструкции.

Для ступиц Лады Калины характерно наличие гаек крепления, которые являются взаимозаменяемыми. Они могут иметь только правую резьбу. Наличие штанги, являющейся стабилизатором, обеспечивает устойчивость поперечной, отвечая за нее. Ее колено, имеющее резиновые шарниры, должно закрепляться к подвеске при использовании сайлентблоков со стойками. Закрепление торсионной частью к кузову обеспечивается при наличии кронштейнов.

Необходимо принять во внимание, что для конструкции подвески от водителя иногда требуется проведение определенных мероприятий, которые направлены на процесс усиления элементов опор стоек (стаканов). Это позволяет увеличить пробег, не опасаясь, что будет возникать постукивание подвески.

Схема улучшенной подвески

Калина оснащена подвеской ССАЗ. Вместе с тем установка на авто моделей сс20 или KAYABA связано с их наилучшими характеристиками, при этом первой гарантируется неслышная работа, которая сочетается с высокой надежностью.


Вернуться к оглавлению

Причины скрипа и стука подвески автомобиля

О возникших неисправностях в узлах Лады Калины свидетельствуют скрип или стук. Чаще гремит передняя подвеска. Это связано с тем, что она подвержена поломкам больше, чем задняя. Среди различных элементов автомобиля, неисправность которых может вызвать проблемы с подвеской и стук в ней, являются следующие.

  1. ШРУСы.
  2. Амортизаторы.
  3. Подшипники.
  4. Рулевая тяга и реактивная.
  5. Выхлопная труба.
  6. Уплотнитель резиновый и др.

Стук могут издавать такие детали, как шаровые опоры, сайлентблоки, рычаги передней подвески, кулак поворотный, крепежные болты. Без осуществления диагностики нельзя точно установить причины скрипа либо стука в подвесках, чтобы эффективно выполнить ремонт.

Выявить, почему слышен стук, поможет только проведение визуальной диагностики Лады Калины традиционным способом. Скрип или стук подвески может быть связан лишь с лопнувшей резинкой, поэтому торопиться воспользоваться услугами СТО не стоит, на это может уйти слишком много времени и денег.

Если самостоятельный визуальный осмотр подвески не позволил выявить реальную причину скрипа или стука, то автомобиль обязательно должен пройти полную диагностику и последующий ремонт. Это позволит выявить причины, по которым возникает стук подвески.

Важно знать, как можно самостоятельно провести диагностику всех неисправностей. Проще проводить диагностику задней, а не передней подвески, поскольку осмотр не усложняется наличием большого количества сложных элементов управления.


Вернуться к оглавлению

Диагностика состояния комплектующих и устранение неисправностей

После проведения визуального осмотра подвески автомобиля Лада Калина, который позволит выяснить причину стука, можно будет переходить к демонтажу неисправных элементов. Например, автомобильных амортизаторов. Диагностику производят, расположив машину над смотровой ямой или с применением домкрата. Особое внимание уделяют элементам, прилегающим к кузову либо к автомобильной раме.

Диагностика предполагает тщательный осмотр элементов подвески, наличия на них различных повреждений, трещин и разрывов. При выявленном прорыве резиновой защиты рулевого наконечника обязательно следует сделать ее ремонт. Резиновые уплотнители осматривают на наличие механических повреждений, определяют те участки, где имеются разрывы и трещины.

В результате обрыва глушителя в подвеске будет слышен стук. Для выявления причины таких звуков, которая может крыться в выхлопной трубе, глушитель следует покачать в разные стороны. Это быстрый способ диагностики передней подвески. После его проведения можно переходить к ремонту подвески.

Ходовая часть автомобиля Лада Калина, как и любого другого, должна находиться в исправном состоянии, что обеспечит безопасность эксплуатации транспортного средства.

Передняя подвеска состоит из: 1 — гайка крепления верхней опоры стойки; 2 — болт; 3 — верхняя опора стойки передней подвески; 4 — подшипник верхней опоры стойки; 5 — верхняя изоляционная прокладка пружины; 6 — пружина передней подвески; 7 — защитный кожух; 8 — телескопическая стойка в сборе; 9, 10 — гайки крепления стойки к поворотному кулаку; 11 — болт с эксцентриком; 12 — болт; 13 — поворотный кулак; 14 — вал привода переднего колеса; 15 — штанга стабилизатора; 16 — растяжка; 17 — рычаг; 18 — шаровая опора; 19 — ступица; 20 — гайка крепления ступицы; 21 — тормозной диск; 22 — буфер хода сжатия передней подвески; 23 — верхняя чашка пружины; 24 — ограничитель хода сжатия верхней опоры стойки; 25 — ограничитель хода верхней опоры стойки; 26 — гайка крепления стойки стабилизатора; Н — контрольный размер

Устранять различные неисправности, которые возникают в передней подвеске автомобиля Лада Калина, можно, если известна их причина. При неисправных стойках передней подвески, которые могут стучать, их следует заменить. В некоторых случаях их возможно и отремонтировать.

Если в ходе диагностики было выявлено, что ослаблены болты, которые фиксируют штангу стабилизатора, обеспечивающего поперечную устойчивость, к автомобильному кузову, то их необходимо подтянуть. Изношенные подушки растяжек из резины либо штанги подвергают замене.

Если ослаблено крепление верхней опоры стойки подвески Лада Калина, то необходимо подтягивать гайки, фиксирующие это узел. Если в передней подвеске проявляется разрушение резиновой опоры стойки, то нужно осуществить ее замену. Если резинометаллические шарниры (сайлентблоки) износились, следует поставить новые.

Наличие неисправности стоек штанг стабилизатора требует замены. При осадке с поломкой пружины передней подвески ее следует поменять. При разрушении буфера хода сжатия он подвергается демонтажу с последующей установкой нового. При увеличенном дисбалансе колес следует обратиться в шиномонтажную мастерскую, чтобы специалисты устранили выявленную неисправность.

Американский ученый: стук в грант

Статуя Улисса С. Гранта в парке Золотые Ворота, Сан-Франциско (Wikimedia Commons)

Я с подозрением отношусь ко всем памятникам и верю в демонтаж тех, которые рассказывают искаженные истории о нашем национальном прошлом, подавляют его ужасы и позолочают его ошибки, заключая их в трагическое достоинство. Все это делают памятники Конфедерации, и они больше не должны господствовать над нами в общественных парках, на городских площадях или в залах Капитолия.Даже если я знаю, что в долгосрочной перспективе для нас было бы лучше и здоровее прийти к такому выводу упорядоченным и официальным образом, я также знаю на собственном опыте непримиримость всех тех американцев, которые так глубоко влюблены в притворство. рыцарство — чтобы украсть фразу Марка Твена — Роберта Э. Ли и всех остальных. Поэтому всякий раз, когда я узнаю, что статуя Конфедерации каким-то образом была потревожена в эти дни беспорядков, я думаю: Он определенно ждал этого.

Затем, на следующее утро после 19 июня, в день празднования освобождения от рабства, я узнал, что Улисс С.Грант стал жертвой давно назревшей войны против тирании неверных воспоминаний, когда протестующие сбросили его бюст в парке Золотых ворот Сан-Франциско. И мое самодовольное иконоборчество внезапно уступило место сначала праведному негодованию, потом растерянности. Вместо того, чтобы сдаться Гранту, Ли предпочел бы умереть «тысячей смертей», но он сдался, потому что Грант сокрушил армию Северной Вирджинии железной волей и «бульдожьей хваткой», как Авраам Линкольн повелел ему это сделать. .Грант — это тот человек, который, что бы он ни делал — а он потерпел неудачу во многих вещах, — придумал, как выиграть Гражданскую войну, тем самым сохранив Соединенные Штаты и обеспечив освобождение четырех миллионов порабощенных людей.

Большинство памятников имеют тенденцию выполнять то, что Бертольт Брехт обвинил в совершении традиционной драмы: разрушая нашу способность к действию, а не пробуждая ее, оставляя у нас ощущение, что человеческое существо закреплено, а не способно к изменениям. Это источник моего недоверия.Год назад, несмотря на мою двойственность, я участвовал в открытии новой статуи Гранта в его альма-матер, Вест-Пойнт. Я надеялся, что этот новый памятник начнет переломить ситуацию. Армия, как и вся страна в целом, влюбилась в этих ярких кавалеров, изображенных по всей стране из бронзы, гранита и мрамора, беззаботно игнорируя тот факт, что их проигранное дело было «одним из худших, за которое когда-либо боролся народ». и тот, для которого было наименьшее оправдание «.

Кто это судил? Грант в своих личных мемуарах , написанных, когда он умирал, и опубликованных посмертно в 1885 году.Он ходил в школу и служил вместе со многими из тех, против кого он сражался в Гражданской войне, но личные отношения не отвлекали его от этой элементарной истины. Это достойно памятника? Многие думали так, хотя многие думали, что Ли этого заслуживает.

Я провел десятилетия своей жизни, изучая Гранта по его книге, сравнивая его недостатки и ошибки с его триумфами и успехами, доказывая его ценность с коллегами и учениками, часто сопротивляющимися его негероическому, недраматическому, откровенно американскому героизму.Лиз, Дж. Э. Б. Стюарт и Стоунволл Джексоны с их аристократическими манерами, шляпами с перьями и накидками с алой подкладкой, их безрассудными и обреченными подвигами — почти всегда более привлекательны для военных (и не только), чем для военных. убогий парень, который вообще не хотел идти в армию, но каким-то образом обнаружил, к своему удивлению, как и все остальные, что он хорош в одной из наименее гламурных профессий в мире: ведении войн. По правде говоря, это настолько мрачная, но, к сожалению, необходимая работа, что мы заваливаем ее всевозможными романтическими глупостями и хотим, чтобы ее главные герои выглядели смелыми и дерзкими, а не агентами разрушения, которыми они являются.

Причина, по которой Грант был свергнут вместе с отцом Джуниперо Серра и Фрэнсисом Скоттом Ки, не совсем ясна. Были повреждены и другие памятники в парке, в том числе один из писателей Мигеля де Сервантеса. Один из протестующих в Интернете правильно заметил, что до войны у Гранта был раб. Грант, чей отец был аболиционистом, женился на семье рабовладельцев, приобрел Уильяма Джонса от своего тестя и в конечном итоге освободил его. Во многих отношениях Грант был человеком своего возраста, невольно захваченным слишком многими своими предрассудками, предположениями и ошибками, точно так же, как мы сами, неосознанно, пойманы в ловушку, независимо от того, насколько прогрессивными мы себя считаем.Как и все довоенные американцы, в большей или меньшей степени, на Севере и на Юге, Грант проснулся и обнаружил, что он причастен к американскому рабству, точно так же, как мы причастны к несправедливости, которую видим, и всем тем несправедливостям, к которым мы не можем.

Тем не менее, Грант в решающей степени превзошел свою эпоху. Его приверженность отмене смертной казни росла медленно, неуклонно, пока он не стал одним из самых решительных защитников эмансипированных. Родившись в мире, в котором, как он писал, «тема рабства почти не беспокоила общественное мнение, он ушел, применив свой особый гений, чтобы покончить с этим.Он избежал моральных ограничений своего времени, когда оно имело значение и способствовало реализации более справедливого, более равноправного, даже слишком хрупкого будущего.

Грант был монументальным? Он был велик? Это вообще правильные вопросы? Измерение величия — это салонная игра, и нынешние кризисы связаны с реальной жизнью, реальными людьми, настоящими страданиями после многих лет невыполненных обещаний, годами лжи, которые кажутся вечной правдой в бронзе и граните. Может быть, на памятниках стоит сразу запекать граффити, фишки и дефекты.Может быть, подобно скульптурам Родена, они должны казаться в процессе выхода из своих блоков — или, возможно, поднимаются, как морские существа из глубины, бьются, но цепко, как-то приближая нас к свету, немного ближе к истине. .

Прочтите статью Элизабет Д. Самет о прошлогоднем открытии статуи Гранта в Вест-Пойнте здесь .

Разрешение, необходимое для перепечатки, воспроизведения или другого использования.

Элизабет Д.Самет — редактор The Annotated Memoirs of Ulysses S. Grant и профессор английского языка в Военной академии США. Мнения, которые она здесь выражает, не отражают официальную политику или позицию Министерства армии, Министерства обороны или правительства США.

Закон 1994 года о борьбе с насильственными преступлениями и обеспечении правопорядка. Министерство юстиции США Информационный бюллетень Закон 1994 года о борьбе с насильственными преступлениями и обеспечении правопорядка представляет двухпартийный продукт шести лет упорной работы.Это самый крупный законопроект о преступлениях в истории страны и обеспечит 100000 новых полицейских офицеров, 9,7 млрд долларов на финансирование тюрем и 6,1 млрд долларов на финансирование профилактические программы, которые были разработаны при значительном участии опытные полицейские. Закон также значительно расширяет способность правительства решать проблемы, вызванные иностранцами-преступниками. Закон о преступности предусматривает дополнительное финансирование ФБР, DEA на 2,6 миллиарда долларов. INS, поверенные США и другие компоненты Министерства юстиции, а также федеральные суды и казначейство.Несколько из Ниже кратко излагаются наиболее важные положения законопроекта: Основные положения уголовного законодательства Штурмовое оружие Запрещает изготовление 19 штурмовых орудий военного образца, штурмовых оружие с особыми боевыми характеристиками, модели «подражание» и некоторые магазины боеприпасов большой емкости более десяти патронов. Смертный приговор Расширяет федеральную смертную казнь до 60 правонарушений, в том числе убийства террористов, убийство сотрудника федеральных правоохранительных органов, крупномасштабный оборот наркотиков, перестрелки, приводящие к гибели и угоны автомобилей, повлекшие смерть.Домашние насильники и огнестрельное оружие Запрещает продажу огнестрельного оружия лицам, принадлежащим семье, и владение им. судебные запреты на насилие. Лицензирование огнестрельного оружия Ужесточает федеральные стандарты лицензирования для торговцев огнестрельным оружием. Мошенничество Создает новые категории мошенничества в страховании и телемаркетинге. Расширяется Федеральная юрисдикция по делам, которые не связаны с использованием доставки услуги для совершения мошенничества. Обеспечивает особые улучшения при вынесении приговора за мошенничество в отношении пожилых людей.Групповые преступления Обеспечивает новые и более жесткие наказания за насильственные преступления и преступления, связанные с торговлей наркотиками. совершено членами банды. Иммиграция Предусмотрены усиленные наказания за контрабанду иностранцев, незаконное возвращение после депортация и другие преступления, связанные с иммиграцией. (См. Часть II). Несовершеннолетние Санкционирует судебное преследование взрослых лиц 13 лет и старше, обвиняемых в определенных тяжкие насильственные преступления. Запрещает продажу или передачу огнестрельного оружия другим лицам. владение несовершеннолетними определенными видами огнестрельного оружия.Утроит максимум штрафы за использование детей для распространения наркотиков в охраняемых зона, то есть школы, детские площадки, видео-галереи и молодежные центры. Регистрация преступников, совершивших сексуальное насилие Требует от штатов принятия законодательных или нормативных актов, которые требуют определены как насильственные сексуальные хищники или осуждены за преступления, связанные с сексуальным насилием, должны быть зарегистрированы в соответствии с законом соответствующего штата правоохранительные органы в течение десяти лет после выхода из тюрьмы.Требует государственных тюремных чиновников, чтобы уведомить соответствующие органы об освобождении таких частные лица. Требует, чтобы государства уголовно наказывали тех, кто не регистр. Государства, которые не создают системы регистрации, могут иметь Деньги федерального гранта уменьшены. Повторные сексуальные преступники Удваивает максимальный срок лишения свободы для рецидивистов сексуальных преступлений. признан виновным в совершении федеральных преступлений на сексуальной почве. Три удара Обязательное пожизненное заключение без возможности условно-досрочного освобождения по федеральным правонарушители с тремя или более судимостями за тяжкие тяжкие преступления или преступления, связанные с незаконным оборотом наркотиков.Жертвы преступлений Позволяет жертвам федеральных насильственных и сексуальных преступлений выступать в вынесение приговора нападавшим. Усиливает потребность в сексе правонарушители и растлители малолетних должны выплатить компенсацию своим жертвам. Улучшает Федеральный фонд потерпевших от преступлений и программы, связанные с потерпевшими, поддерживает. Другой Создает новые преступления или ужесточает наказания за: перестрелку, использование полуавтоматическое оружие, преступления на сексуальной почве, преступления против пожилые люди, торговля огнестрельным оружием между штатами, кража и контрабанда огнестрельного оружия, поджоги, преступления на почве ненависти и межгосударственное насилие в семье.Иммиграционные инициативы Закон о преступности содержит специальные положения о правоприменении, касающиеся иммиграция и криминальные иностранцы. Эти программы выделены здесь: 1,2 миллиарда долларов на пограничный контроль, преступную депортацию иностранцев, реформу убежища и центр слежения за инопланетянами. 1,8 миллиарда долларов на возмещение штатам за лишение свободы нелегальных иностранцев-преступников. (См. Гранты Государственной программы помощи иностранцам в уголовных преступлениях (SCAAP) в разделе III).Усиленные штрафы за неспособность покинуть Соединенные Штаты после приказ о депортации или возвращение после депортации. Ускоренная депортация иностранцев, не являющихся законными постоянными жителями и которые осуждены за тяжкие преступления. Законодательные полномочия для супругов, подвергшихся жестокому обращению, и супругов с детьми, подвергшимися жестокому обращению ходатайствовать о предоставлении постоянного места жительства или о приостановлении депортации. Грантовые программы на 1995 год Большинство этих программ разрешены на шесть лет, начиная с 1 октября. 1994 г.Некоторые из них представляют собой гранты по формуле, присуждаемые штатам или местностям на основе численность населения, уровень преступности или другое сочетание факторов. Многие из них конкурсные гранты. Все гранты потребуют подачи заявки и администрируется Министерством юстиции, если не указано иное. В качестве всегда, все средства на 1996-2000 годы подлежат ассигнованию Конгресс. Реализация Брэди Конкурсная программа грантов для штатов на обновление криминальных историй сохраняются таким образом, чтобы обеспечить соблюдение Закона Брэди.1 00 миллионов долларов присвоено в 1995 году. Кроме того, Закон Брэди разрешает 1 00 миллионов долларов за 1996 финансовый год. 50 миллионов долларов из этой суммы разрешено израсходовать из Целевой фонд Закона о борьбе с насильственными преступлениями. Бирн Грантс Программа грантов по формуле для штатов для использования в более чем 20 законах правоохранительных органов, включая усилия целевых групп по борьбе с наркотиками на уровне штатов и на местах. 450 миллионов долларов было выделено на программу грантов по формуле в 1995 году. 550 долларов США. миллионов, утвержденных в 1996-2000 годах как по формуле, так и по усмотрению.Сообщество полиции Конкурсная грантовая программа (Программа COPS) для размещения 100000 сотрудников полиции на улицах в программах охраны общественного порядка. 1,3 миллиарда долларов доступны в 1995. В 1996-2000 годах утверждено 7,5 миллиардов долларов. Общественные школы Программа грантов по формуле, администрируемая Министерством здравоохранения и Социальные услуги для взрослых после школы, в выходные и летом программы для молодежи из групп риска. 25,9 миллиона долларов в наличии в 1995 году. 567 миллионов долларов. утвержден в 1995-2000 гг.Исправительные учреждения / учебные лагеря Формула и конкурсная программа грантов для государственных исправительных учреждений на строить и эксплуатировать исправительные учреждения, в том числе учебные лагеря и другие альтернативы тюремному заключению, чтобы гарантировать, что дополнительное пространство будет доступны для помещения и содержания в тюрьмах преступников, совершивших насильственные преступления. Пятьдесят процентов денег, которые будут отложены для тех штатов, которые принимают верность приговора законы (преступники должны отбыть не менее 85% срока наказания) или которые соответствовать другим условиям.24,5 миллиона долларов конкурентных средств, доступных для учебные лагеря в 1995 году. В 1996-2000 годах санкционировано 7,9 миллиарда долларов. Суды по наркотикам Программа конкурсных грантов для поддержки государственных и местных судов по наркотикам, которые предоставлять надзор и специализированные услуги правонарушителям с реабилитационный потенциал. 29 миллионов долларов доступны в 1995 году. 971 миллион долларов. утвержден в 1996-2000 гг. Семейные и общественные школы Программа конкурсных грантов, администрируемая Департаментом Образование для местных и общественных организаций, чтобы помочь улучшить общее развитие молодежи из групп риска, живущей в бедных и высокопреступных сообщества.Эта программа предназначена как для школьных, так и для внешкольных занятий. виды деятельности. 11 миллионов долларов США доступны в 1995 году. 232 миллиона долларов США утверждены в 1996-2000 гг. Горячая линия Конкурсная грантовая программа, администрируемая Министерством здравоохранения и социальных служб для открытия национальной горячей линии по вопросам домашнего насилия. 1 миллион долларов утвержден в 1995 году. 2 миллиона долларов утвержден в 1996-2000 годах. Совет по профилактике Обеспечивает финансирование Президентского совета по профилактике для координации новые и существующие программы предупреждения преступности.1,5 миллиона долларов доступны в 1995 г. На конкурсные гранты в 1996-2000 гг. Разрешено выделение 88,5 млн. Долларов. Гранты SCAAP Программа грантов по формуле для возмещения штатам расходов на содержание под стражей криминальные инопланетяне. 130 миллионов долларов доступны в 1995 году. 1,67 миллиарда долларов разрешено в 1996-2000 гг. Насилие против женщин Программа грантов по формуле для поддержки усилий полиции и прокуратуры и услуги жертвам в случаях сексуального насилия или домашнего злоупотреблений, а также для других программ, которые усиливают правоприменение и предоставлять услуги жертвам в таких случаях.26 миллионов долларов доступны в 1995. 774 миллиона долларов на гранты по формуле и более 200 миллионов долларов на конкурсные гранты, утвержденные в 1996-2000 гг. Грантовые программы на 1996-2000 гг. Все программы, доступные в 1995 году, продолжаются. Все программы администрируется Министерством юстиции, если не указано иное. Финансирование на 1996-2000 гг., Как всегда, подлежит ассигнованию Конгресс. Приюты для женщин, пострадавших от побоев Конкурсная грантовая программа, администрируемая Министерством здравоохранения и социальных служб для приютов для женщин, подвергшихся побоям, и других домашних мероприятия по предотвращению насилия.Разрешено 325 миллионов долларов. Капитальные улучшения для предотвращения преступности в общественных парках Конкурсная грантовая программа, администрируемая Министерством внутренних дел для штатов и населенных пунктов для программ по предупреждению преступности на национальном и общественные парки. Разрешено 15 миллионов долларов. Сообщество экономического партнерства Конкурсная программа, администрируемая Министерством здравоохранения и Социальные службы для кредитных линий на развитие сообщества корпораций для стимулирования бизнеса и возможностей трудоустройства для малообеспеченные, безработные и частично занятые лица.270 миллионов долларов авторизованный. Блочные гранты по предупреждению преступности 377 миллионов долларов США выделено для нового местного гранта по предупреждению преступности программа будет распространена среди местных органов власти для использования в качестве местные потребности диктуют. К авторизованным программам относятся: программы борьбы с бандитизмом, спортивные лиги, клубы мальчиков и девочек, партнерства (триады) между пожилые люди и правоохранительные органы, партнерство полиции для детей и молодежи программы навыков. Правонарушители и молодежь из группы риска Конкурсная грантовая программа для государственных или частных некоммерческих организаций для поддержки разработки и эксплуатации проектов, чтобы обеспечить услуги по уходу за детьми в возрасте от 11 до 19 лет, которые бросили учебу школы, контактировали с системой ювенальной юстиции или под угрозой.Разрешено 36 миллионов долларов. Анализ ДНК Конкурсная программа грантов для штатов и населенных пунктов на разработку или улучшить возможности идентификации ДНК. Утверждено 40 миллионов долларов. An дополнительные 25 миллионов долларов разрешены ФБР для идентификации ДНК программы. Медикаментозное лечение 383 миллиона долларов на программы лечения наркозависимости в тюрьмах, в том числе 270 миллионов долларов в формульных грантах для штатов. Просвещение и профилактика с целью уменьшения сексуальных посягательств в отношении женщин Конкурсная грантовая программа, администрируемая Министерством здравоохранения и социальных служб для финансирования профилактических и образовательных программ в в виде обучающих семинаров, горячих линий, обучающих программ для специалистов и подготовка информационных материалов.205 миллионов долларов авторизованный. Закон о местном партнерстве Программа грантов по формуле, администрируемая Департаментом жилищного строительства и Городское развитие для населенных пунктов с целью повышения уровня образования, предоставления лечение наркозависимости и финансирование программ по предотвращению преступлений. Утверждено 1,6 миллиарда долларов. Образцовые интенсивные гранты Конкурсная грантовая программа для модельных программ профилактики правонарушений нацелены на районы с высоким уровнем преступности. Будет выбрано до 15 городов. Утверждено 625 миллионов долларов.Полицейский корпус Конкурсное финансирование полицейского корпуса (стипендии колледжа для студентов, которые соглашаются служить в полиции), а также гранты по формуле штатов на стипендии действующим сотрудникам правоохранительных органов. 100 долларов США миллиона долларов, утвержденных для полицейского корпуса, и 100 миллионов долларов США, утвержденных для стипендии правоохранительных органов без отрыва от производства. Прокуроры Конкурсная грантовая программа для государственных и местных судов, прокуратуры и общественные защитники. Разрешено 150 миллионов долларов.Правоохранительные органы в сельской местности Программа грантов по формуле для борьбы с преступностью и борьбы с наркотиками в сельских районах, включая целевые группы. Разрешено 240 миллионов долларов. Техническая автоматизация Конкурсная грантовая программа для поддержки технологических усовершенствований для правоохранительные органы и другие мероприятия по совершенствованию законодательства обучение правоприменению и информационные системы. Утверждено 130 миллионов долларов. Городской отдых для молодежи из групп риска Конкурсная грантовая программа, администрируемая Министерством внутренних дел населенным пунктам для предоставления мест отдыха и услуг в районах с высокий уровень преступности и предоставлять такие услуги в других областях, чтобы молодежь из группы риска.Утверждено 4,5 миллиона долларов. Для дополнительной информации Для получения дополнительной информации о Законе о насильственных преступлениях и правоприменении 1994 г., обратитесь в: Департамент правосудия Центр реагирования 1-800-421-6770 В столичном районе Вашингтона, округ Колумбия: 202-307-1480 24 октября 1994 г. NCJ FS000067

Женский баскетбольный мяч в штате Огайо: Леди Баккис отбивает беспроигрышный результат, а затем проигрывает два подряд

И для болельщиков, и для тренеров сезон женского баскетбола в штате Огайо превратился в настоящие американские горки с невероятными взлетами, невероятными победами, обескураживающими падениями и невероятными потерями.Прошедшие полторы недели не стали исключением.

«Когда мы делаем броски рано, мы стараемся хорошо стрелять по мячу на протяжении всей игры», — сказал главный тренер Кевин МакГафф перед воскресным матчем с «Айовой». «Когда мы этого не делаем, мы боремся. Это повторяющаяся тема для нас».

Большой максимум был достигнут неделю назад в субботу в форме расстройства в Блумингтоне, когда Баккейз откатился к победе со счетом 70-51 над непобежденной 22-й Индианой.

«Сегодня мы действительно хороши в перестрелках», — сказал МакГафф.«Я думал, что это была самая сфокусированная из тех перестрелок, в которых мы участвовали за последнее время. Это то, что я сказал им позже. Я сказал:« Эй, здесь есть корреляция. Чем больше мы этим занимаемся и концентрируемся, он появится на корте ». «

Защитник-второкурсник Америст Алстон показал рекордные результаты в игре, обогнав штат Огайо с 29 очками. Младший нападающий Рэйвен Фергюсон добавил 18 очков со скамейки запасных, а старший нападающий Мартина Эллербе зафиксировал дабл-дабл с 10 очками и 10 подборами.

Игра

Олстон против Hoosiers помогла ей впервые в своей карьере получить награду «Десятка лучших игроков недели».

После бросков с площадки выше 53% в матче с Индией, в четверг непоследовательность в атаке «Баккейз» вернулась против № 16 штата Пенсильвания в Государственном колледже. Стремясь к своей третьей победе подряд над сильным соперником, команда МакГаффа показала результат хуже 30% на пути к поражению со счетом 66-42 от «Ниттани Лайонс».

«Мы не очень хорошо двигали мяч, что привело к потерям, которые они конвертировали в очки на другом конце поля», — сказал МакГафф. «Потом, когда нам сделали снимки, мы их пропустили.Многое собралось вместе, чтобы получился по-настоящему ужасный для нас вечер наступательного баскетбола ».

Алстон возглавил «Баккейз» с 12 очками, но выстрелил всего 4-17 с поля. Защитник второкурсник Кейт Крафт тоже замерз, бросив всего 2-10 очков и набрав 6 очков. Все попытки Крафта исходили из-за границы трехочковой.

После унылой стрельбы против Penn State, в воскресенье, когда штат Огайо вернулся на Value City Arena, чтобы принять Айову, надежды на выздоровление игры были высоки. Максимум сезона — 7 567 человек, но первая половина была сложной.

На этот раз оборона дала сбой, поскольку «Ястребиные глаза» поразили шесть трехочковых и множество открытых простоев на пути к лидерству 49-36 после двадцати минут.

«Очевидно, наша проблема была в обороне, — сказал МакГафф. «А Айова настолько хорош в нападении, что, если вы сделаете ошибки в защите, они заставят вас заплатить. Это наша худшая оборонительная половина, вероятно, за весь год».

Баккейз совершили яростный камбэк во втором тайме, сократив дефицит до двух, но просто не смогли получить достаточное количество остановок в защите и в конечном итоге проиграли — 81-74.

Алстон снова возглавил штат Огайо, обогнав трех игроков с двузначными числами с 24 очками. Эллерб добавил 17, а Фергюсон 11, поскольку команда упала до 12-9 в сезоне и 2-3 в игре Big Ten.

Бакки будут стремиться отомстить за потерю 15 очков в начале этого месяца, когда они поедут в Анн-Арбор, чтобы сыграть в Мичигане в четверг, прежде чем вернуться домой, чтобы принять штат Мичиган в воскресенье.

Ордер на запрещение удара в Техасе

Вопрос: Тук-тук?

A: Полиция

Q: Poilce, кто?

A: У нас есть ордер на обыск вашего дома.(Пнуть в дверь)

Может быть, именно этого люди ожидают от полиции, когда оформляют ордер на обыск в Техасе. Большинство людей видят этот тип взаимодействия по телевизору или в фильмах. Почти всегда все заканчивается тем, что дверь вышибают ногой, входит полиция с оружием наготове, людей вытаскивают из дома в наручниках и бросают в заднюю часть полицейской машины. Несмотря на то, что запретительные ордера в Техасе не могут быть проблемой, с которой вы сталкиваетесь каждый день, общественность знает об их существовании, и большинство людей дезинформированы.

Правило «Постучите и объявите»

Обычно, когда полиция отдает ордер на обыск в доме, она должна постучать в дверь и объявить о своем присутствии. Обычно они называют себя и ждут разумное количество времени, пока человек (люди) подойдут к двери. Эта политика может быть полезной для полиции и людей в доме. Полиция и местные жители будут меньше подвергаться риску, если они мирно откроют дверь. По сути, это сводит к минимуму риск для людей и имущества, когда полиция стучит и объявляет.Однако это не означает, что полиция должна стучать в любую ситуацию.

Нет ордеров на детонацию

Подобно процессу получения ордера, полицейский должен предоставить судье заявления под присягой или аффидевиты, чтобы запросить ордер на обыск. Аффидевиты должны предоставить судье достаточно информации, чтобы определить, существует ли вероятная причина для выдачи ордера на обыск. Когда дело доходит до ордера на отсутствие детонации, то дополнительное разрешение должно быть предоставлено судьей.Правовая стандартная полиция должна показать: разумное подозрение, что стучать и сообщать об их присутствии, при определенных обстоятельствах, было бы опасно или бесполезно, или что это помешало бы эффективному расследованию преступления, например, допустив уничтожение Доказательства .

Стучать или не стучать, вот в чем вопрос!

Иногда в ордере на обыск не указывается, является ли это ордером на запрещение или выталкивание. Обычно решение о том, стучать или не стучать, принимается во время исполнения ордера.Однако важно помнить, что если полиция не постучит, ей, скорее всего, придется объяснять это решение позже в суде. Полиции нужно обосновать свое решение не стучать и не объявлять. Часто такие решения полиции приходится принимать на ходу. Обстоятельства могут измениться в одно мгновение при исполнении ордера, в зависимости от того, на что он выдан.

Например, предположим, что полиция оформляет ордер на обыск в доме в поисках кокаина и оружия. Если оружие присутствует и о нем заранее известно полиции, судья, скорее всего, выдаст ордер на запрещение удара.Однако, если в ордере ничего не сказано, полиция может не стучать, потому что это может подвергнуть их опасности. Если полиция заявит о себе, это может дать людям внутри время, необходимое для того, чтобы схватить оружие. Кроме того, объявление и предупреждение может привести к тому, что жители уничтожат улики и / или спустят кокаин в унитаз.

Как и большинство вопросов уголовного права, каждый случай зависит от факта. Если полиция запрещает стук, они должны обосновать свое решение, основываясь на своих знаниях на тот момент.Простая «возможность» опасности или вера в то, что «торговцы наркотиками обычно обладают огнестрельным оружием», не означает, что это юридически оправдывает действия офицеров в ситуации, когда это невозможно. Опять же, безопасность офицеров очень важна, как и ваши права! Доказательства, полученные незаконным путем или с нарушением ваших прав, впоследствии могут быть неприемлемы против вас в суде.

Оптимизированная конструкция вставки для улучшенной визуализации и количественной оценки одиночных молекул с помощью CRISPR-Cas9

Культивирование и трансфекция клеток

Клеточные линии эмбриональной почки человека 293T (HEK293T) культивировали в модифицированной Дульбекко среде Игла (DMEM) с добавлением пенициллина / Стрептомицин (1%), 2 мМ L-глутамин и 10% фетальная бычья сыворотка (FBS).Клетки Erythroleukeemia 92.1.7 человека (Hel 92.1.7) поддерживали в среде 1640 Roswell Park Memorial Institute (RPMI) с идентичными добавками. Все клетки культивировали при 37 ° C и 5% CO 2 . Прилипшие клетки пассировали, дважды промывая колбы для культур клеток Т75 (Corning) стерильным фосфатно-солевым буфером (PBS) без кальция или магния, перед инкубацией с трипсином-ЭДТА (Thermo Scientific) в течение 5 минут при 37 ° C. Затем клетки ресуспендировали в полной среде DMEM перед пассированием при соответствующем разведении в свежей колбе.Суспензионные клетки (Hel 92.1.7) пассировали путем вращения клеток при 1200 об / мин в течение пяти минут перед повторным суспендированием в свежей полной RPMI, разведением в свежей среде и инкубацией.

Адгезивные клетки трансфицировали липофектамином 3000 (Thermo Scientific) в соответствии с инструкциями производителя. Вкратце, клетки высевали при плотности 1 × 10 5 в 12-луночные планшеты (Thermo Scientific) за 18 часов до трансфекции. Непосредственно перед трансфекцией клетки дважды промывали стерильным PBS перед инкубацией в Optimem.Использовали руководство px459 и плазмиду, экспрессирующую Cas9-puro (плазмида Addgene # 62988 была подарком от Feng Zheng), чтобы ввести ранее описанное руководство по нацеливанию C TubA1B или руководство по нацеливанию CXCR4 с элементами Cas9 в трансфицированные клетки 15,42 .

Суспензионные клетки трансфицировали с использованием системы электропорации Neon (Thermo). Вкратце, клетки ресуспендировали в конечном общем объеме 10 мкл, мкл буфера R с 1 мкл г тотальной ДНК (эквимолярная направляющая C px459 и донор) и всего 1 × 10 5 клеток.10 наконечников мкм L использовались с 2-кратными импульсами при ширине импульса 20 мс и 1450 В. Как описано в нашей предыдущей работе (Khan et al .2017), все эксперименты CRISPR включали полную панель элементов управления, включая «только донор». ‘условие, позволяющее установить, что флуоресценция была исключительно следствием включения CRISPR.

Для исследований сверхэкспрессии последовательность CXCR4-HaloTag CO, идентичная той, которая используется в исследованиях «нокаута», была клонирована в вектор сверхэкспрессии pcDNA3.1 и трансфицирована в дозе 25 нг на 35 мм чашку MatTek.Для поддержания эквивалентной эффективности трансфекции во всех экспериментах смеси для трансфекции собирали до конечной общей концентрации ДНК 1 мкг г с пустым вектором pGem-T-Easy.

Клонирование донорского вектора

TuBA1B Донорские плазмиды были созданы путем заказа синтетической ДНК gBlock (Integrated DNA Technologies) как для левого, так и для правого плеч гомологии и для каждой из тестируемых вставок (mEos 3.2, mEos 3.2 codon optimized, mEos 4b, mEos 4b оптимизированы по кодонам, HaloTag оптимизированы по кодонам и mEGFP).Оптимизация кодонов была выполнена с помощью онлайн-инструмента IDT. Каждый фрагмент был сконструирован с сегментом 20 п.н., перекрывающим соседнее плечо. Плечи и вставки гомологии клонировали в пустой каркас pGem-T-Easy с использованием набора HiFi Gibson Assembly (New England Biolabs).

2 мкл л из каждых 10 мкл л реакционного объема трансформировали в компетентные клетки, как описано в предыдущем разделе. Отдельные колонии отбирали после роста в течение ночи на планшетах с ампициллином, мини-препарировали (с использованием инструкций производителя, включенных в набор GeneJet — Thermo Fisher) и подвергали анализу EcoRI для проверки наличия вставки.Клоны, несущие вставку правильного размера, дополнительно проверяли секвенированием по Сэнгеру. Проверенные плазмиды были амплифицированы.

Донорские плазмиды для геномной инженерии CXCR4 были созданы путем субклонирования кодон-оптимизированных, mEos 4b, mEos 4b и HaloTag, а также mEGFP, синтезированных в виде gBlocks двухцепочечной ДНК (Integrated DNA Technologies), в донорный вектор CXCR4, описанный ранее с использованием XhoI и Ферменты рестрикции XbaI 42 .

Проточная цитометрия и сортировка одиночных клеток

Подтверждение и проверка нокаутов выполняли с использованием проточного цитометра Accuri C6 (BD Technologies).Образцы регистрировали в соответствии с прямым и боковым рассеянием, при этом положительная флуоресценция для этих экспериментов регистрировалась в канале FL-1. Сортировка отдельных клеток была очень тщательно проведена Мэттом Маккензи (TechHub) на сортировщике клеток BD FACSAria Fusion с соплом 100 мкм м при 20 фунт / кв. Дюйм. Ворота были установлены на самой яркой популяции клеток, чтобы гарантировать отбор клонов с высокой экспрессией.

Количественная ПЦР в реальном времени (qRT-PCR)

Чтобы изучить распространенность уровней экспрессии эндогенной мРНК в клетках CXCR4 CRISPR-tag и WT Hek293, мы провели количественную RT-PCR в реальном времени (qRT-PCR).Количественную оценку экспрессии генов проводили с использованием системы определения последовательности ABI Prism 7500HT (Applied Biosystems, Фостер-Сити, Калифорния, США) и технологии мастер-микса SYBR-green. Количественную оценку относительной экспрессии генов проводили в соответствии со сравнительным методом Ct с использованием GAPDH в качестве эндогенного контроля. Фрагменты, специфичные для метки mEGFP, Halo и mEos4b, были амплифицированы с использованием общего прямого праймера для CXCR4 (5′-GAGTCTTCAAGTTTTCACTCC-3 ‘) и следующих обратных праймеров, специфичных для метки (mEGFP — 5’GCTTCATGTGGTCGGGGTAGC; Halo — 5’AGTGCC- 3 ′; mEos4b — 5′-CGCGATTTCCATAGTGGAAGGC-3 ′.Эндогенный фрагмент CXCR4, не специфичный для метки, также амплифицировали с использованием прямого (5’-ATGGAGGGGATCAGTATATACAC-3 ‘) и обратного 5′-GCCACTGACAGGTGCAGCCTGTAC-3’) праймеров.

Вестерн-блоттинг

Клональные популяции размножали в 6-луночных планшетах (Thermo Scientific) перед лизисом в буфере NP-40 с ингибитором протеолиза (Sigma). Лизаты получали 30-минутной инкубацией на льду в NP-40 с ингибиторами протеаз (Sigma) перед последним 10-минутным вращением при 14000 rcf. Затем супернатант добавляли к 2-кратному восстанавливающему буферу для образца и кипятили в течение 5 минут.

Вестерн-блоты получали с помощью SDS-PAGE на гелях Bolt с градиентом 4–12% (Thermo Scientific). Гели запускали в течение 15 минут при 70 В и 45 минут при 125 В. После запуска каждый гель переносили на мембрану из поливинилидендифторида (PVDF) (Bio-Rad) с использованием системы переноса Turbo (Bio-Rad). После переноса мембраны блокировали 4% BSA в 0,1% физиологическом растворе с трис-буфером Tween-20 (TBST) и зондировали соответствующими первичными антителами. Вторичные инкубации проводили с использованием флуоресцентных антител (LiCor Instruments) в TBST.Флуоресцентные антитела против мышиных 680 и кроличьих 800 использовали для обнаружения с использованием Odyssey Fc (LiCor Instruments). Зонды тубулина и GAPDH использовали, как описано ранее. Антитела против CXCR4 Fusin C8352 (меченое антитело 1) и проверенный на нокаут ab124824 (меченое антитело 2) были получены от Thermo и Abcam соответственно. Наконец, для количественной оценки вестерн-блоттинга использовали Image Studio.

Функциональные анализы CXCR4

Клетки временно трансфицировали в соответствии с инструкциями производителя с использованием реагента для трансфекции FuGENE-HD (Promega, Висконсин, США) с плазмидной кДНК, кодирующей Gαi1 / Nluc (синтезированной GeneArt, Invitrogen) и Venus / Gγ2 (a. любезный подарок от профессора Кевина Пфлегера) через 24 часа после посева 350 000 клеток на лунку в 6-луночный планшет.Клетки собирали с x1 трипсин-ЭДТА (Sigma Aldrich) и высевали в 96-луночные планшеты с плоским дном, покрытые поли-D-лизином (Sigma Aldrich) (655089; Greiner Bio-One, Stonehouse, UK), по 30000 клеток / лунку в течение 24 часов. перед проведением анализа.

Для каждого анализа BRET среду удаляли из 96-луночных планшетов, содержащих CRISPR / Cas9-модифицированные клетки или клетки HEK293 дикого типа, и инкубировали с 1x забуференным солевым раствором HANK (1xHBSS; 25 мМ HEPES, 10 мМ глюкоза, 146 мМ NaCl, 5 мМ KCl, 1 мМ MgSO4, 2 мМ пируват натрия, 1.3 мМ CaCl2, 1,8 г / л глюкозы; pH 7,45) с добавлением 0,1% BSA в течение 1 часа при 37 ° C в атмосфере CO 2 . Затем добавляли фуримазин (Promega, Wisconsin, USA) до конечной концентрации 10 мкМ и инкубировали в течение 5 минут перед отфильтрованным световым излучением, которое измеряли при 460 нм (полоса пропускания 80 нм) и 535 нм (полоса пропускания 60 нм) непрерывно при 37 ° C. с использованием планшет-ридера PHERAStar FS (BMG Labtech). После 5 считываний CXCL12 (0,1 пМ – 100 нМ; Preprotech, Rocky Hill, США) или буфер (HBSS, содержащий 0.1% BSA) добавляли в лунки в трех повторностях, и BRET измеряли в течение следующих 25 циклов. Необработанные отношения BRET рассчитывали путем деления эмиссии 535 нм на эмиссию 460 нм с максимальным изменением BRET, используемым для анализа.

Для анализов цАМФ, HEK293T дикого типа или CRISPR / Cas9-модифицированный поддерживали, как описано для анализов BRET выше. В день анализа клетки собирали с фосфатно-солевым буфером Дульбекко (DPBS) с добавлением 0,2 г / л этилендиаминтетрауксусной кислоты (EDTA; Sigma Aldrich), предварительно нагретой до 37 ° C и повторно суспендированной в стимулирующем буфере (HBSS, содержащий 500 мкл). M 3-изобутил-1-метилксантин и 0.1% BSA) при 400000 клеток / мл. Производство цАМФ измеряли с использованием набора для обнаружения цАМФ LANCE® (PerkinElmer) в соответствии с инструкциями производителя. Вкратце, 5 мкл л клеток добавляли в двух экземплярах в белый 384-луночный планшет (ProxiPlate-384, PerkinElmer), содержащий только буфер (стимулирующий буфер, содержащий антитело против цАМФ Alexa Fluor® 647) или форсколин (0,5 мкМ мкМ). , Sigma-Aldrich) в отсутствие или в присутствии CXCL12 (1 мкМ – 1 мкМ М) в течение 45 минут при комнатной температуре.Затем реакцию останавливали добавлением буфера для обнаружения цАМФ, содержащего меченный Eu-W8044 стрептавидин и биотин-цАМФ. Затем планшеты инкубировали в течение 1 часа при комнатной температуре и измеряли флуоресценцию при 615 нм и 665 нм, соответственно, 50 мкм с после возбуждения при 320 нм с использованием считывающего устройства для микропланшетов EnVision 2102 (PerkinElmer).

Imaging (PALM and dSTORM)

Интересующие клоны были отображены на 35-миллиметровых тарелках MatTek (MatTek Corporation) на системе Nikon N-STORM (Andor iXon Ultra DU897U EMCCD, подставка Ti-E, Perfect Focus, лазерная кровать Agilent MLC400 ).Объектив 100x 1,49 NA TIRF использовался для каждого сбора данных, который затем был реконструирован с использованием ThunderSTORM 44 (максимальное правдоподобие, интегрированная подгонка PSF по Гауссу).

Клетки Hel 92.1.7 обрабатывали форболом 12-миристат 13-ацетатом (PMA) (Sigma) и тромбопоэтином (TPO — щедрый подарок Яна Хичкока) в течение ночи для стимулирования распространения и дифференцировки перед визуализацией. После посева на чашки MatTek клетки дважды промывали PBS перед обработкой буфером, стабилизирующим микротрубочки (MTSB — 80 мМ PIPES pH 6.8, 1 мМ MgCL 2 , 4 мМ EGTA) и 0,5% Triton-X100 в течение 30 секунд перед фиксацией ледяным метанолом при -20 ° C в течение 3 минут. Затем образцы промывали TBST и отображали в PBS для CRISPR-PALM.

Нокауты CXCR4 были помечены Janelia Fluor 549 (предоставлено лабораторией Lavis) до фиксации 45 . Клетки высевали на чашки MatTek 35 мм в течение ночи перед добавлением 250 нМ JF549 в полную среду DMEM и последующей 15-минутной инкубацией. Затем образцы промывали PBS и полной средой перед дальнейшим 30-минутным инкубированием в немеченой полной среде.Наконец, клетки промывали 3 раза PBS перед фиксацией в формалине в течение 10 минут. Для образцов, обработанных CXCL12, за 4 минуты до фиксации добавляли 100 нг (10 мк M) рекомбинантного человеческого CXCL12 (SDF-1 α , Thermo). Наконец, эти образцы были визуализированы в мигающем буфере (100 мМ меркаптоэтиламин-HCL, 1 г / мл каталазы, 50 г / мл глюкозооксидазы, PBS) при экспозиции 20 мс и мощности лазера приблизительно 120 кВт (выходная мощность лазера) (с низкой добавлена ​​подсветка уровня 405 при успешном переводе JF549 в темное состояние).Там, где использовался лазер активации 405, функция Auto Laser Power (Auto LP) системы N-STORM использовалась для согласованности во всех экспериментах. Auto LP постепенно увеличивает мощность активирующего лазера, чтобы поддерживать количество обнаружений на кадр во время сбора данных. Изображения были получены до тех пор, пока образец не был полностью обесцвечен, как показано на рис. S3.

Кластерный анализ

Изображения были реконструированы, как описано ранее Хан и др. . с помощью ThunderSTORM 44,46 .Перед кластерным анализом изображения были скорректированы (кросс-корреляции) и отфильтрованы для удаления обнаружений с погрешностями выше 75 нм. Дубликаты были удалены, и мигания, повторяющиеся в пределах 50 нм в последовательных кадрах, были объединены. Отфильтрованные обнаружения были кластеризованы с использованием кластеризации на основе сохраняемости, реализованной с использованием RSMLM и KNIME (рабочий процесс доступен по запросу) 47,48 . Плотность обнаружения оценивалась путем подсчета количества соседних обнаружений в пределах 20 нм, а порог стойкости был установлен на 10 обнаружений.Для каждого поля обзора было вырезано и проанализировано центральное 10 мкм м 2 . Кластеры с менее чем 10 обнаружениями были удалены из анализа. Площадь кластера определялась выпуклой оболочкой обнаружений внутри кластера.

Изображение и статистический анализ

Статистический анализ был выполнен с использованием GraphPad PRISM 6 со статистическими тестами, указанными в подписях к рисункам. Вкратце, значимость определялась с использованием либо двухфакторного дисперсионного анализа, либо однофакторного дисперсионного анализа с множественными сравнениями. n = 3 для выборок, если не указано иное, а полосы ошибок представляют собой стандартное отклонение среднего. Измерения FRC проводились с использованием недавно опубликованного плагина NanoJ-SQUIRREL 49,50 .

Функциональные данные

CXCR4 были нормализованы к максимальному ответу, генерируемому клетками HEK293T дикого типа, и проанализированы с использованием GraphPad Prism 7. Данные «концентрация-ответ» были сопоставлены с сигмоидальными кривыми, построенными с использованием нелинейной регрессии, предполагая наклон 1. Статистический анализ выполняли с использованием GraphPad. Призма 7 с использованием одностороннего дисперсионного анализа и теста множественных сравнений Даннета.Количество выполненных индивидуальных повторов указано в подписях к рисункам. Уровни значимости на основе звездочки определены следующим образом: ns p ≥ 0,05, * p ≤ 0,05, ** p ≤ 0,01, *** p ≤ 0,001, **** p ≤ 0,0001 .

Простой метод с использованием CRISPR-Cas9 для нокаута генов в линиях раковых клеток мышей

Общая стратегия

УСПЕХ основан на системе CRISPR / Cas9 для введения двухцепочечных разрывов в целевых геномных областях.Две направляющие РНК (гРНК) были разработаны для делеции гена полной длины. Целевую геномную область удаляли двумя плазмидами pX330, несущими последовательность гРНК, двумя 80-мерными ssODN и кассетой с тупым концом с последовательностью устойчивости к антибиотикам. Клоны единичных клеток были сформированы повторным высевом 3000 клеток в 10-сантиметровую чашку после высокого отбора антибиотиков, затем проверены с помощью ПЦР и прямого секвенирования. Процедура проиллюстрирована на рис. 1.

Рисунок 1

Схема УСПЕХ. УСПЕХ требует конструирования только 2 плазмид pX330 и 2 одноцепочечных олигодезоксинуклеотидов (ssODN) для удаления полной длины целевого гена из генома.Кассета с тупым концом и маркером селекции может быть использована для нокаута любого гена.

УСПЕХ-индуцированная гомозиготная делеция целевого гена

При установлении УСПЕХА для гомозиготной удаления полной длины целевого гена из генома мы сначала сравнили антибиотики для отбора клонов после введения двух плазмид pX330, кодирующих Cas9 и gRNA, двух ssODN, и маркер селекции с тупым концом для удаления Apolipoprotein d ( Apod ), поскольку ~ 18 т.п.н. длины гена Apod считались подходящими для демонстрации метода, а Apod — нелетальный ген 10 ( Инжир.2А). Клетки B16F10 имеют 4 копии хромосомы 16, в результате чего получается 4 копии Apod 9 . Сначала мы определили дозы антибиотиков для индукции гибели клеток B16F10 дикого типа; почти все клетки B16F10 были убиты 2,5 мг / мл неомицина, 400 мкг / мл гигромицина, 0,75 мкг / мл пуромицина или 4 мкг / мл бластицидина S (рис. S1). Зеоцин не может убивать клетки B16F10 дикого типа, не вызывая морфологических изменений. Высокая доза антибиотика, которая не вызывала морфологических изменений, использовалась в течение пяти дней для отбора клонов, в которых все аллели Apod были заменены маркерами отбора, чтобы избежать неожиданных эффектов.Вставка маркера отбора в ген Apod была обнаружена во всех обработанных антибиотиком клетках (фиг. 2A). Клоны Apod KO не были обнаружены в клетках, обработанных неомицином 4000 мкг / мл, которые показали эффективность 33,3% для 5′-сайта лигирования и 35,5% -ную эффективность для 3′-маркера, чтобы выбить маркер селекции в целевой геномной области (рис. S2A). Эффективность KI маркера селекции при обработке гигромицином 400 мкг / мл была лучше, чем при обработке неомицином (51,6% для 5 ‘и 24,7% для 3′ сайта лигирования) (рис.S2B). Два клона без аллелей дикого типа были получены после обработки гигромицином, но эти клоны не имели ожидаемого лигирования в 5′- и 3’-сайтах, что показано как — / — * на фиг. 2A. Обработка пуромицином 5 мкг / мл показала наивысшую эффективность KI маркера селекции (48,4% для 5 ‘и 54,8% для 3’ сайта лигирования), что привело к получению 4 клонов KO с ожидаемым лигированием в обоих сайтах (фиг. S2C). Высокая концентрация бластицидина S при 100 мкг / мл привела к образованию 8 клонов KO и 4 клонов KO без ожидаемого лигирования в обоих сайтах (рис.S2D). Затем мы исследовали, необходима ли высокая концентрация антибиотика для повышения эффективности выбивания маркера отбора в целевой геномной области. Низкая концентрация бластицидина S при 5 мкг / мл показала низкую эффективность KI маркера селекции (11,8% для 5 ‘и 26,9% для 3′), что привело к получению 1 клона KO и 6 клонов KO без ожидаемого лигирования в обоих сайтах, хотя 5 мкг / мл бластицидина S полностью убивал клетки дикого типа (рис. S1). Затем мы подтвердили лигирование между концом генома и кассетой, содержащей маркер отбора, прямым секвенированием ампликонов ПЦР в 5′- и 3’-областях в клонах KO, созданных обработкой высоким бластицидином S (рис.2Б). Ингибитор негомологичного соединения концов (NHEJ) не изменял количество выживших клеток после отбора бластицидина S (фиг. S2E). Наши результаты показали, что отбор с использованием бластицидина S 100 мкг / мл был высокоэффективным для гомозиготной делеции целевой области генома путем введения плазмиды pX330, ssODN и маркера селекции с тупым концом, и что наш метод лигировал геном и маркер селекции как дизайн ssODNs.

Фиг. 2

УСПЕХ индуцировал гомозиготную делецию целевого гена.( A ) Показан дизайн маркеров выбора. Эффективность включения маркера отбора рассчитывалась с использованием результатов генотипа 93 клонов. Стрелками показаны 80-членные ssODN, состоящие из 40-членной последовательности, гомологичной целевой геномной области, и другой 40-членной последовательности, гомологичной кассете с маркером селекции. В таблицах приведены результаты генотипирования 93 клонов. BSD, ген устойчивости к бластицидину S; HygR, ген устойчивости к гигромицину; NeoR, ген устойчивости к неомицину; PuroR, ген устойчивости к пуромицину.( B ) Схема лигирования между целевой геномной областью и кассетой с маркером селекции, как в 5 ‘, так и в 3’ сайтах. Лигирование анализировали прямым секвенированием. 5 ‘, 5’ сайт между геномной областью и кассетой; 3 ‘, 3’ сайт между геномной областью и кассетой; WT, аллель дикого типа; — / -, гомозиготно нокаутные клоны: — / — *, гомозиготно нокаутные клоны без обнаружения лигирования 5 ‘или 3’ сайтов между геномной областью и кассетой; % KI, процент нокаута в 93 клонах.

Тупой конец кассеты и ssODN имели решающее значение для повышения эффективности KI

Затем мы проверили, была ли форма конца ДНК, кодирующей маркер отбора, критической для создания клонов KO с использованием высокой концентрации бластицидина S. Хотя известно, что введение неразрезанной плазмиды с маркером селекции создает трансгенные клоны путем случайной интеграции плазмиды в геном 11 , неразрезанная плазмида с маркером селекции не позволяет клеткам образовывать колонии при высоком уровне доза антибиотика (рис.3А). Липкие концы ДНК, кодирующей маркер отбора, разрезанный NotI и AscI, показали пониженную эффективность по попаданию кассеты в целевой геном (26,9% для 5 ‘и 39,8% для 3’ сайтов, фиг. 3B и S3A). Кроме того, эффективность вставки кассеты, содержащей маркер селекции, снижалась без ssODN (36,6% для 5 ‘и 7,5% для 3’ сайтов, фиг. 3C и S3B). Более того, потеря ssODN или липких концов ДНК, кодирующих маркер отбора, вызвала неупорядоченное лигирование между целевой геномной областью и кассетой (рис.3B, C, S3A, B). Таким образом, ssODN и форма концов маркера селекции, кодирующего ДНК, были критическими для стимулирования правильно выровненного лигирования между целевыми геномными областями и кассетой.

Рисунок 3

Тупой конец кассеты с маркером селекции и одноцепочечными олигодезоксинуклеотидами (ssODN) были критически важны для повышения эффективности проникновения кассеты в геном. ( A , B ) Схемы нокаута целевого гена плазмидами pX330, ssODN и неразрезанной плазмидой с маркером селекции ( A ) или липкими концами ДНК, кодирующими маркер селекции, разрезанными NotI и AscI ( В ).( C ) Схема нокаута целевого гена плазмидами pX330 и ДНК с маркером селекции, гладко разрезанная EcoRV без ssODN. Изображения геля агарозы, показывающие результаты генотипирования. В таблицах приведены результаты генотипирования 93 клонов. 5 ‘, 5’ сайт между геномной областью и кассетой; 3 ‘, 3’ сайт между геномной областью и кассетой; WT, аллель дикого типа; — / -, гомозиготно нокаутные клоны: — / — *, гомозиготно нокаутные клоны без обнаружения лигирования 5 ‘или 3’ сайтов между геномной областью и кассетой; % KI, процент нокаута в 93 клонах.

Плечи гомологии увеличивают эффективность попадания кассеты с маркером селекции в целевую геномную область

Традиционные нацеливающие векторы состоят из маркеров селекции, фланкирующих плечи гомологии с целевыми геномными областями 12 . Чтобы сравнить эффективность КО для ssODN и плеч гомологии, мы сконструировали фрагмент ДНК, кодирующий ген устойчивости к неомицину (NeoR), который фланкировал плечи гомологии 250 п.н. (рис. 4). В то время как ssODN с кассетным кодированием NeoR обеспечивали низкую эффективность KO по сравнению с другими антибиотиками (рис.2A), ветви гомологии, лигированные с кассетой, кодирующей NeoR, значительно увеличили эффективность KI маркера селекции, что привело к образованию 8 клонов KO и 5 клонов KO без ожидаемого лигирования как в 5 ‘, так и в 3’ сайтах (63,4% для 5 ‘ и 64,5% для 3 ′, рис. 4 и S4). Мы подтвердили гомологичную рекомбинацию в 54 из 59 клонов для 5 ‘и в 59 из 60 клонов для 3’ путем секвенирования фрагментов ПЦР (рис. S4). Результаты показывают, что ветви гомологии увеличивают эффективность KI при выборе низкой дозы антибиотика.

Рисунок 4

Плечи гомологии улучшили эффективность попадания кассеты с маркером селекции в целевой геномный регион. Схема нокаута целевого гена плазмидами pX330 и маркером селекции, фланкированным по плечам гомологии 250 п.н. Изображения геля агарозы показывают результаты генотипирования. В таблице приведены результаты генотипирования 93 клонов. 5 ‘, 5’ сайт между геномной областью и кассетой; 3 ‘, 3’ сайт между геномной областью и кассетой; WT, аллель дикого типа; — / -, гомозиготно нокаутные клоны: — / — *, гомозиготно нокаутные клоны без обнаружения лигирования 5 ‘или 3’ сайтов между геномной областью и кассетой; % KI, процент нокаута в 93 клонах.

Множественные маркеры селекции не увеличивали эффективность получения клонов KO

Предыдущее исследование предлагало использовать два гена устойчивости к антибиотикам в качестве маркеров селекции для увеличения гомозиготных клонов KI из человеческих клеток HCT116 13 . Основываясь на исследовании, мы предположили, что 2 кассеты могут повысить эффективность создания клонов KO. Селекция антибиотиков с пуромицином и бластицидином S увеличивала эффективность попадания кассет с маркерами селекции в целевые области генома (38.7% для 5 ‘, 34,4% для гена устойчивости к 3’ бластицидину S (BSD) и 38,7% для гена устойчивости к 3 ‘пуромицину (PuroR), фиг. 5A и S5A). Однако генотипирование показало аберрантные размеры фрагментов и множественные полосы ампликонов почти во всех клонах (фиг. 5A и S5A). Таким образом, в нашем исследовании подход к выбору двух антибиотиков не увеличивал эффективность получения клонов КО по сравнению с отбором одного антибиотика. Мы также попытались создать клоны КО с помощью трех селекционных антибиотиков с гигромицином, пуромицином и бластицидином S (рис.5Б). Стратегия выбора трех антибиотиков снизила эффективность попадания кассет в целевые области генома (65,6% для 5 ‘, 55,9% для 3’ BSD, 36,6% для 3 ‘PuroR, 11,8% для гена устойчивости к гигромицину (HygR), фиг. 5B и S5B) по сравнению с выбором двух антибиотиков. Более того, подход к выбору трех антибиотиков также снизил эффективность создания клонов КО (рис. 5В). Результаты генотипирования показали аберрантные размеры фрагментов и полосы ампликонов почти во всех клонах, аналогично подходу к выбору двух антибиотиков (рис.5A, B, S5A, B). В совокупности гистограмма процентов KO, сравнивающих различные подходы, показывает, что множественные маркеры отбора не способствуют генерации клонов KO с использованием УСПЕХА (рис. 5C).

Рисунок 5

Маркеры множественной селекции не повысили эффективность получения клонов КО. ( A , B ) Схемы нокаута целевого гена плазмидами pX330, ssODN и кассетой с PuroR и BSD в качестве маркеров отбора ( A ) или с HygR, PuroR и BSD в качестве маркеров отбора ( В ).Концентрация антибиотиков для отбора составляет 100 мкг / мл BSD и 5 мкг / мл пуромицина ( A ) или 100 мкг / мл BSD, 5 мкг / мл пуромицина и 400 мкг / мл гигромицина ( B ). Изображения геля агарозы показывают результаты генотипирования. В таблице приведены результаты генотипирования 93 клонов. BSD, ген устойчивости к бластицидину S; HygR, ген устойчивости к гигромицину; PuroR, ген устойчивости к пуромицину; ssODN, одноцепочечные олигодезоксинуклеотиды. 5 ‘, 5’ сайт между геномной областью и кассетой; 3 ‘, 3’ сайт между геномной областью и кассетой; WT, аллель дикого типа; — / -, гомозиготно нокаутные клоны: — / — *, гомозиготно нокаутные клоны без обнаружения лигирования 5 ‘или 3’ сайтов между геномной областью и кассетой; % KI, процент нокаута в 93 клонах.( C ) Гистограмма процента нокаутов при сравнении различных подходов в этом исследовании.

SUCCESS сгенерировал нокаутный клон

Antxr2 в линии клеток рака яичников мыши ID8.

SUCCESS был достаточно использован для удаления целевой геномной области, отличной от Apod , в другой клеточной линии. Мы сконструировали gRNA и ssODN для удаления части Antxr2 в линии клеток рака яичников мыши ID8 (фиг. 6). Интеграция кассеты в целевой геномный регион в Antxr2 была обнаружена после отбора 200 мкг / мл бластицидина S (51.6% для 5 ‘, 44,1% для 3’), в результате чего получился 1 клон с нокаутом (фиг. 6 и S6). Взятые вместе, данные показали, что УСПЕХ является полезным методом редактирования генома в нескольких линиях раковых клеток.

Фигура 6

Оценка УСПЕХА в отношении мишени Antxr2 в линии клеток рака яичников мыши ID8-luc2. Приведена схема нокаута гена Antxr2 методом УСПЕХ. Изображения геля агарозы показывают результаты генотипирования. В таблице приведены результаты генотипирования 93 клонов.5 ‘, 5’ сайт между геномной областью и кассетой; 3 ‘, 3’ сайт между геномной областью и кассетой; WT, аллель дикого типа; — / -, гомозиготно нокаутные клоны: — / — *, гомозиготно нокаутные клоны без обнаружения лигирования 5 ‘или 3’ сайтов между геномной областью и кассетой; % KI, процент нокаута в 93 клонах.

Это тяжелая (панцирная) жизнь: работа на устричной ферме развивает характер. Но что, если бы мы могли сделать это проще?

Фермером, выращивающим моллюсков, нужно проводить долгие дни на ногах, переносить суровые погодные условия и поднимать тяжелые клетки.Все это требует времени. Но день на воде — это еще один доллар в вашем кармане, так что вы настаиваете и упорствуете. Я провел много дней на жаре и на морозе, оценивая, считая и упаковывая моллюсков и устриц для тех, кто нанимал на сезон. Хотя мне действительно нравилась работа, которую я делал, некоторые дни были тяжелыми. Я вспоминаю, как однажды собирал все клетки, которые мог, после того, как над фермой прошел ураган, который разорвал несколько клеток и отправил несколько других в ближайшую бухту. Несколько раз я ловил себя на том, что буксирую лодку джон, загруженную всем оборудованием, чтобы проработать целый день через несколько дюймов снежного покрова в почти ледяной воде.

Но что, если есть способы облегчить жизнь водникам? Что можно сделать, чтобы сократить время простоя на воде и повысить эффективность выращивания, сбора и сортировки моллюсков? Эти вопросы — причина, по которой я решил поступить в аспирантуру Университета Мэриленда. Моя цель исследования — разработать новые методы и способы оптимизации процесса выращивания моллюсков в аквакультуре. Благодаря общению и совместным исследованиям с производителями моллюсков я начинаю достигать этих целей.

Брендан Кэмпбелл приносит на берег собранные и отсортированные устрицы на закате после очередного рабочего дня в заливе Делавэр на устричной ферме. Фото: Крис Кэрол, Кейп-Мэй, Нью-Джерси

Развитие наземного сельского хозяйства за последние два столетия позволило создать впечатляющий объем производства для удовлетворения мировых потребностей в продовольствии. Такие инновации, как самоходная уборочная техника, генетическая модификация и химическая инженерия аммиачных удобрений, позволили добиться огромного роста в сельском хозяйстве.Что касается моря, ученые разработали быстрорастущую триплоидную устрицу, которая устойчива к болезням и вкладывает всю свою энергию в рост, а не на размножение. Предприниматели работали над оборудованием для автоматической сортировки, чтобы избавить от скуки и времени, которые нужно делать вручную. И все же аквакультура далека от земледелия по продуктивности.

Одной из промышленных инноваций в наземном земледелии является использование самоходных комбайнов. Эта модель среднего уровня может собирать до 500 бушелей кукурузы в час.Ведущий автоматический сортировщик устриц может сортировать не более 24 бушелей в час. Фото: Oxbo International Corporation, Байрон, Нью-Йорк

Работа в воде — это новая концепция, в которой есть проблемы. Работа на земле более интересна. Мы лучше понимаем механизмы, потому что живем в них. Однако в воде правила меняются. Все, что попадает в воду, должно быть устойчиво к воздействию соленой воды и организмов-обрастателей. Крепления должны быть надежными по всем размерам. Любой материал в воде должен быть достаточно прочным, чтобы выдерживать интенсивную волновую энергию.

Эти проблемы могут быть неприятными для фермеров. Например, потеря клеток на ферме из-за шторма — довольно частое явление, потому что силы, действующие на эти клетки, огромны. Кроме того, в сезон дождей фермы, расположенные в более свежих частях залива, подвергаются риску высокой смертности урожая, потому что вода становится слишком свежей, чтобы выжить. Устрицы требуют точного смешивания пресной и соленой воды, поэтому настои пресной воды нарушают этот баланс и могут убить урожай, а также нанести вред воспроизводству.Мы можем решить эти проблемы и добиться устойчивых улучшений в отрасли, но для этого потребуются усилия от фермеров, инженеров и ученых.

Моя текущая роль в развитии аквакультуры моллюсков заключается в понимании того, как поток воды взаимодействует с оборудованием, используемым в аквакультуре. Понимание того, как поток взаимодействует с снастями аквакультуры, важно для оптимизации роста моллюсков. Например, устрицы питаются суспензией, что означает, что они втягивают воду, содержащую микроскопический планктон и водоросли, чтобы питаться и расти.То, как вода течет вокруг устриц, влияет на то, как они могут питаться. Если поток слишком быстрый или слишком медленный, устрица не может хорошо питаться и не может расти так быстро. Чтобы моллюски питались как можно быстрее, я разрабатываю инструменты, которые фермеры могут использовать для проверки потока воды, проходящего через клетки для устриц.

Глыбы (вверху) используются для контроля потока. Чем быстрее растворяется гипсовый шар внутри, тем быстрее течет вода. Этот акселерометр (внизу) помещен в раковину устрицы, чтобы увидеть, насколько устрица движется в клетке для устриц.Фото любезно предоставлено Бренданом Кэмпбеллом

Эти инструменты недороги и просты в использовании, поэтому фермерам не нужно ограничивать бюджет. Устройство представляет собой просто гипсовый шар, который растворяется при прохождении воды. Расход можно определить по количеству растворенного со временем штукатурки. Если фермер может сказать, с какой скоростью вода движется через одну из их клеток, он может изменить расположение клеток или тип клетки, чтобы устрицы внутри могли жить в среде, которая позволяет им есть и расти так быстро, как возможный.Таким образом, собранная информация помогает окупить вложения в инструмент.

Каждый мяч сделан из бытовых материалов и стоит менее одного доллара. Они не добавляют летучие химические вещества в воду — растворяется менее 30 процентов штукатурки, и материал в основном состоит из гипса, который в основном состоит из сульфата кальция и иногда действует как баланс в резервуарах с пресной водой.

Я также работаю над использованием инструментов, которые могут показать, насколько вода перемещает устриц внутри клеток.В этом инструменте используется акселерометр, закрепленный внутри старой раковины устрицы. Акселерометр отслеживает, как далеко перемещается раковина каждую минуту, и напоминает количество движений, которые испытывает устрица в клетке. Промышленность считает, что чем больше устрица перемещается в клетке, тем глубже будет ее чашка и тем более востребованной она будет. Идея состоит в том, что чем больше устрица перемещается, концы раковины отламываются, поэтому вместо того, чтобы вырасти длинными и широкими, как блин, они становятся глубже, как чашка.Предоставление фермерам возможности видеть, как часто их устрицы перемещаются в клетках, поможет им лучше контролировать качество своей продукции.

Несмотря на проблемы, связанные с новаторским подходом к аквакультуре моллюсков, выгода огромна. Будущим поколениям фермеров, выращивающих моллюсков, возможно, не потребуется так много работать, чтобы заработать на жизнь, как когда-то мне; они могут вкладывать больше энергии в то, что растет внутри клеток, и меньше — на их подъем.

Фотография, вверху слева: Плохой день на устричной ферме в штате Мэн — эти плавающие клетки замерзли, и видны только поплавки.

Author:

Добавить комментарий

Ваш адрес email не будет опубликован.