Тест лада: Запись на тест-драйв — Официальный сайт LADA

Содержание

дилер LADA в г. Москва (Москва и МО)

Дилер*

Яхрома-Лада, Москва, Яхрома, Шлюзовой переулок, д. 1

Модель*

Выберите автомобильGranta седанGranta лифтбекGranta хэтчбекGranta универсалGranta CrossGranta Drive ActiveVesta седанVesta CrossVesta SWVesta SW CrossVesta SportXRAY XRAY CrossLargus универсалLargus CrossНовый Largus универсалНовый Largus CrossНовый Largus фургонNiva Niva Off-roadNiva Travel

* Поля, обязательные для заполнения
** Отправляя сообщение, я выражаю свое согласие и разрешаю компании АО Яхрома-Лада, а также, по их поручению, третьим лицам осуществлять обработку моих персональных данных (фамилия, имя, отчество, год, месяц, дата и место рождения; адрес, номер паспорта и сведения о дате выдачи паспорта и выдавшем его органе; образование, профессия, место работы и должность; домашний, рабочий и мобильный телефоны; адрес электронной почты и другие данные, требуемые для отправки сообщения), включая сбор, систематизацию, накопление, хранение, уточнение, использование, распространение (в том числе трансграничную передачу), обезличивание, уничтожение персональных данных, в целях связанных с возможностью предоставления информации о товарах и услугах, которые потенциально могут представлять интерес, а также в целях сбора и обработки статистической информации и проведения маркетинговых исследований. Согласие на обработку персональных данных в соответствии с указанными выше условиями я предоставляю на 10 (десять) лет. Я уведомлен и согласен с тем, что указанное согласие может быть мной отозвано посредством направления письменного заявления заказным почтовым отправлением с описью вложения, либо вручено лично под подпись.

Электронная форма записи на тест-драйв

Отправляя сообщение, я выражаю свое согласие и разрешаю ПАО «АВТОВАЗ», а также, по их поручению, третьим лицам осуществлять обработку моих персональных данных (фамилия, имя, отчество, год, месяц, дата и место рождения; адрес, номер паспорта и сведения о дате выдачи паспорта и выдавшем его органе; образование, профессия, место работы и должность; домашний, рабочий и мобильный телефоны; адрес электронной почты и другие данные, требуемые для отправки сообщения), включая сбор, систематизацию, накопление, хранение, уточнение, использование, распространение (в том числе трансграничную передачу), обезличивание, уничтожение персональных данных), в целях связанных с возможностью предоставления информации о товарах и услугах, которые потенциально могут представлять интерес, а также в целях сбора и обработки статистической информации и проведения маркетинговых исследований. Согласие на обработку персональных данных в соответствии с указанными выше условиями я предоставляю на 10 (десять) лет. Я уведомлен и согласен с тем, что указанное согласие может быть мной отозвано посредством направления письменного заявления заказным почтовым отправлением с описью вложения, либо вручено лично под подпись.
Политика конфиденциальности

Спасибо за проявленный интерес к тест-драйву автомобилей LADA!
К сожалению, данный сервис временно недоступен.

//
В соответствии с Указом Президента Российской Федерации от 02.04.2020 N 239 «О мерах по обеспечению санитарно-эпидемиологического благополучия населения на территории Российской Федерации в связи с распространением новой коронавирусной инфекции (COVID-19)», постановлением правительства Санкт-Петербурга от 5 июня 2020 года № 384 «О внесении изменений в постановление Правительства Санкт-Петербурга от 13.03.2020 № 121,
//
Правительство Санкт-Петербурга постановляет:
1. Внести в постановление Правительства Санкт-Петербурга от 13.03.2020 №121 «О мерах по противодействию распространению в Санкт-Петербурге новой коронавирусной инфекции (COVID-19)» следующие изменения:
||
<<……….>>
1.4 Дополнить постановление пунктом 2-5.5 следующего содержания:
|||
«2-5.5. Осуществлять розничную торговлю автотранспортными средствами при условии соблюдения следующих требований:
— обеспечения одновременного нахождения в помещениях объекта розничной торговли не более 10 посетителей;
отказа от проведения тестовых поездок автотранспортных средств;
— обеспечения регулярной дезинфекции выставочных образцов автотранспортных средств, а также дезинфекции автотранспортных средств перед их передачей покупателю».
|||
<<……….>>

Выбирайте! У нас в наличии

96 автомобилей.
Все LADA уже с ПТС!

Выберите модельGrantaVestaXRAYLargus2121 (4×4)2131 (4×4)

Выберите КППМеханическаяАвтомат

Выберите объем двигателя1.6л1.7л1.8л

Выберите тип кузоваседануниверсалхэтчбеккроссоверлифтбек

Отправляя сообщение, я выражаю свое согласие и разрешаю ПАО «АВТОВАЗ», а также, по их поручению, третьим лицам осуществлять обработку моих персональных данных (фамилия, имя, отчество, год, месяц, дата и место рождения; адрес, номер паспорта и сведения о дате выдачи паспорта и выдавшем его органе; образование, профессия, место работы и должность; домашний, рабочий и мобильный телефоны; адрес электронной почты и другие данные, требуемые для отправки сообщения), включая сбор, систематизацию, накопление, хранение, уточнение, использование, распространение (в том числе трансграничную передачу), обезличивание, уничтожение персональных данных), в целях связанных с возможностью предоставления информации о товарах и услугах, которые потенциально могут представлять интерес, а также в целях сбора и обработки статистической информации и проведения маркетинговых исследований. Согласие на обработку персональных данных в соответствии с указанными выше условиями я предоставляю на 10 (десять) лет. Я уведомлен и согласен с тем, что указанное согласие может быть мной отозвано посредством направления письменного заявления заказным почтовым отправлением с описью вложения, либо вручено лично под подпись.
Политика конфиденциальности

Запись на тест-драйв LADA | Лада-Центр – официальный дилер LADA в СПб

Запись на тест-драйв LADA | Лада-Центр – официальный дилер LADA в СПб

Отправляя сообщение, я соглашаюсь с политикой обработки персональных данных, выражаю свое согласие и разрешаю АО «АВТОВАЗ», а также, по их поручению, третьим лицам осуществлять обработку моих персональных данных (фамилия, имя, отчество, год, месяц, дата и место рождения; адрес, номер паспорта и сведения о дате выдачи паспорта и выдавшем его органе; образование, профессия, место работы и должность; домашний, рабочий и мобильный телефоны; адрес электронной почты и другие данные, требуемые для отправки сообщения), включая сбор, систематизацию, накопление, хранение, уточнение, использование, распространение (в том числе трансграничную передачу), обезличивание, уничтожение персональных данных), в целях связанных с возможностью предоставления информации о товарах и услугах, которые потенциально могут представлять интерес, а также в целях сбора и обработки статистической информации и проведения маркетинговых исследований. Согласие на обработку персональных данных в соответствии с указанными выше условиями я предоставляю на 10 (десять) лет. Я уведомлен и согласен с тем, что указанное согласие может быть мной отозвано посредством направления письменного заявления заказным почтовым отправлением с описью вложения, либо вручено лично под подпись.

Отправляя сообщение, я соглашаюсь с политикой обработки персональных данных, выражаю свое согласие и разрешаю АО «АВТОВАЗ», а также, по их поручению, третьим лицам осуществлять обработку моих персональных данных (фамилия, имя, отчество, год, месяц, дата и место рождения; адрес, номер паспорта и сведения о дате выдачи паспорта и выдавшем его органе; образование, профессия, место работы и должность; домашний, рабочий и мобильный телефоны; адрес электронной почты и другие данные, требуемые для отправки сообщения), включая сбор, систематизацию, накопление, хранение, уточнение, использование, распространение (в том числе трансграничную передачу), обезличивание, уничтожение персональных данных), в целях связанных с возможностью предоставления информации о товарах и услугах, которые потенциально могут представлять интерес, а также в целях сбора и обработки статистической информации и проведения маркетинговых исследований. Согласие на обработку персональных данных в соответствии с указанными выше условиями я предоставляю на 10 (десять) лет. Я уведомлен и согласен с тем, что указанное согласие может быть мной отозвано посредством направления письменного заявления заказным почтовым отправлением с описью вложения, либо вручено лично под подпись.

Отправляя сообщение, я соглашаюсь с политикой обработки персональных данных, выражаю свое согласие и разрешаю АО «АВТОВАЗ», а также, по их поручению, третьим лицам осуществлять обработку моих персональных данных (фамилия, имя, отчество, год, месяц, дата и место рождения; адрес, номер паспорта и сведения о дате выдачи паспорта и выдавшем его органе; образование, профессия, место работы и должность; домашний, рабочий и мобильный телефоны; адрес электронной почты и другие данные, требуемые для отправки сообщения), включая сбор, систематизацию, накопление, хранение, уточнение, использование, распространение (в том числе трансграничную передачу), обезличивание, уничтожение персональных данных), в целях связанных с возможностью предоставления информации о товарах и услугах, которые потенциально могут представлять интерес, а также в целях сбора и обработки статистической информации и проведения маркетинговых исследований. Согласие на обработку персональных данных в соответствии с указанными выше условиями я предоставляю на 10 (десять) лет. Я уведомлен и согласен с тем, что указанное согласие может быть мной отозвано посредством направления письменного заявления заказным почтовым отправлением с описью вложения, либо вручено лично под подпись.

Отправляя сообщение, я соглашаюсь с политикой обработки персональных данных, выражаю свое согласие и разрешаю АО «АВТОВАЗ», а также, по их поручению, третьим лицам осуществлять обработку моих персональных данных (фамилия, имя, отчество, год, месяц, дата и место рождения; адрес, номер паспорта и сведения о дате выдачи паспорта и выдавшем его органе; образование, профессия, место работы и должность; домашний, рабочий и мобильный телефоны; адрес электронной почты и другие данные, требуемые для отправки сообщения), включая сбор, систематизацию, накопление, хранение, уточнение, использование, распространение (в том числе трансграничную передачу), обезличивание, уничтожение персональных данных), в целях связанных с возможностью предоставления информации о товарах и услугах, которые потенциально могут представлять интерес, а также в целях сбора и обработки статистической информации и проведения маркетинговых исследований. Согласие на обработку персональных данных в соответствии с указанными выше условиями я предоставляю на 10 (десять) лет. Я уведомлен и согласен с тем, что указанное согласие может быть мной отозвано посредством направления письменного заявления заказным почтовым отправлением с описью вложения, либо вручено лично под подпись.

Длительный тест Lada Vesta Cross: отзыв после 3500 км

В конце 2018 года в редакцию на долговременный тест пришла Lada Vesta Cross. О достоинствах и недостатках, которые удалось выявить за три месяца эксплуатации этого автомобиля, и пойдет речь.

Олег Калаушин

Lada Vesta Cross 1.8 MT Цена: 864 900 р. В продаже: c 2017 г.

Кому как, а нам прошедшая зима очень понравилась. И в первую очередь тем, что она была снежной. Посудите сами. Сугробы во дворах, не чищенные магистрали, снежная каша во время оттепелей — все это сильно напрягало рядовых автолюбителей. Добраться из точки А в точку Б, а потом еще и там запарковаться порой было очень сложно. Более или менее комфортно чувствовали себя в таких условиях лишь владельцы внедорожников и кроссоверов. На фоне рядовых седанов и хетч-бэков они были просто королями дорог. Впрочем, относительно неплохо себя ощущали и те, у кого автомобиль был хоть и не полноприводной, но с хорошим дорожным просветом. Там, где было не пробиться на легковушке, с определенными трудностями, но все же проезжали переднеприводные кроссоверы. Как-никак, а увеличенный дорожный просвет позволял им не грести бампером, как отвалом, переметы и не висеть на брюхе в колее cо спрессованным снегом. К таким счастливчикам относились и мы, потому как, хоть Lada Vesta Cross и является седаном, именно приставка Cross делает его в прямом и переносном смысле выше соплеменников. И былая зима это хорошо проиллюстрировала.

Экран мультимедиа на солнце бликует.

В свое время мы имели уже достаточно положительный опыт общения с Lada Vesta. Все нам тогда понравилось в машине (а провела она у нас полгода), за исключением одного: то, как своенравно вела себя роботизированная коробка, заслуживало написания отдельной статьи. Именно поэтому на сей раз мы решили взять машину «на ручке». И нужно сказать, не прогадали. Тандем 1,8‑литрового, 122‑сильного двигателя с 5‑ступенчатой коробкой оказался на редкость удачным. Придраться к избирательности коробки или к ходам кулисы невозможно — все четко. Лишь однажды, когда ночью после оттепели ударил сильный мороз, наутро воткнуть какую-либо из передач было очень сложно. Водичка из луж, которых было на дорогах днем ранее огромное количество, попала в открытые сочленения, а морозец прихватил ее, тем самым заблокировав ход соединений. Кулису, конечно же, разработали, но факт остается фактом. Видимо, все же защита моторного отсека от летящей снизу грязи и воды недостаточна.

Подлокотник лишен регулировки, но имеет отсек для хранения.

Мороз под –20 °С в один из дней стал причиной того, что водительская дверь, после того как машину открыли после ночной стоянки, напрочь отказывалась закрываться. Ее можно было только притворить. Мы уже было собрались ехать в сервисный центр, но произошло чудо. После того как салон автомобиля прогрелся, все встало на свои места и больше не повторялось.

На обычной «Весте» тут не припарковаться, а на версии Cross с 203 мм клиренса легко.

Вообще, если говорить об эксплуатации Vesta Cross, то к зимним условиям она подготовлена очень неплохо. Начнем с того, что в любой мороз машина заводилась, что называется, «с полпинка» даже после длительной стоянки. Удалять наледь с лобового стекла при наличии электроподогрева очень удобно. Ждать, когда лед сам сойдет, конечно, придется долго, но снимать скребком подтаявший намного проще. Нравится и то, что все сиденья в машине имеют подогрев. А передние так и вовсе многоступенчатый. Сами сидушки очень комфортные, об их правильном профиле говорит тот факт, что даже после многочасовых перегонов из-за руля выходишь совершенно спокойно, а не кряхтя и потирая спину.

Изображение с камеры заднего вида выводится с динамической разметкой, помогающей при парковке.

Несмотря на подросший дорожный просвет, Vesta Cross не утратила свойственной всему семейству Vesta хорошей управляемости. Она все так же хорошо рулится и очень прогнозируема. Разве что плавность хода на неровной дороге чуть утратила. Потряхивает машину на колдобинах ощутимо. И лежачих полицейских при наличии задних пассажиров лучше объезжать: как ни стараешься их мягко и аккуратно проехать, все одно со второго ряда слышится недовольство. При этом водителю и переднему пассажиру эта искусственная неровность сильного дискомфорта не доставляет.

Лючок бензобака блокируется центральным замком. Бензин можно лить 92-й.

Эксплуатация автомобиля проходила как в городе, так и на трассах. На шоссе расход топлива по маршрутному компьютеру (эти данные, кстати, несколько расходятся с заявленными, как обычно) составлял порядка 7,5 л, что можно признать вполне умеренным аппетитом, но в городе он возрастал практически двое. Впрочем, этого следовало ожидать: вечные пробки из-за неубранных дорог. Что ни старт с места, то с пробуксовкой, потому как под колесами либо снег, либо наледь. Отсюда и увеличенный расход топлива. Система контроля тяги, конечно, старалась удерживать ведущие колеса в зацеплении на таком покрытии, но полностью избавиться от проскальзывания не получалось. Опять же приходилось много елозить на парковках, где порой уровень снежной каши был чуть ли не по пороги. А это опять повышенные обороты двигателя и взметающие ввысь снег буксующие колеса. С другой стороны, совались в такую «глушь» не многие, а посему место благодаря большому дорожному просвету всегда удавалось найти. Так что расход топлива в городе под 13 литров вполне понятен. Благо, хоть бензин Vesta Cross потребляет 92‑й, а не более дорогой. Да и на заправку часто заезжать не требовалось: бак в 55 литров обеспечивает машину довольно большим запасом хода, а если еще и под пробку напузырить…

Длительный тест Lada Vesta Cross позволил нам выявить как сильные, так и слабые стороны этого автомобиля. И сильных куда больше. А слабых, честно говоря, как таковых и не было. Разумеется, будь машина у нас дольше, то, вероятнее всего, какие-либо неисправности и вылезли бы. Но в прошлый раз Vesta у нас была полгода, и за то время ничего с ней так и не произошло, хотя набегала она тогда немало, даже побывала за Полярным кругом. Vesta Cross пробежала порядка 3,5 тыс. км, причем в руках разных водителей, с разным стилем езды, разной комплекции и разного возраста. И каждый из тех, кто с ней общался, выказывал в большей степени положительные эмоции. А весь негатив сводился лишь к пожеланиям что-то улучшить, а не изменить кардинально. Кто-то сетовал на отсутствие кожаной оплетки на руле «за такие деньги», кто-то хотел видеть цифры на маршрутном компьютере побольше, а кому-то не нравилось, что при открытии водительской двери не разблокируются остальные двери и багажник, а сами двери слабо фиксируются в открытом положении. Хотя, по большому счету, это все относится к придиркам. Что-что, а придираться мы все умеем. А вот сделать что-то стоящее сильны не многие. И глядя на Lada Vesta Cross, приятно осознавать, что таковые все же есть.

Грязезащита моторного отсека слабая — 3 месяца назад двигатель был чистым…

Эксплуатационные расходы

Пробег автомобиля за время теста 3500 км
Средний расход топлива 9,5 л/100 км
Периодичность техобслуживания 15 000 / 12 км/мес.
Стоимость ТО у официального дилера (ТО-1/ТО-2) 6300 / 8700 р.
Стоимость ОСАГО для данного автомобиля 11 069 р.
Стоимость каско для данного автомобиля 55 000 р.
Транспортный налог 3050 р./год
Стоимость 1 км с учетом пробега 20 000 км в год (топливо, ТО, ОСАГО, каско и транспортный налог) 7,7 р./км

Редакция рекомендует:






Хочу получать самые интересные статьи

Тест-драйв первой Lada Granta с автоматической коробкой передач

https://ria.ru/20120724/707482729.html

Тест-драйв первой Lada Granta с автоматической коробкой передач

Тест-драйв первой Lada Granta с автоматической коробкой передач — РИА Новости, 29.02.2020

Тест-драйв первой Lada Granta с автоматической коробкой передач

«АвтоВАЗ» начнет продажу Lada Granta с автоматической коробкой передач в августе 2012 года. Смотрите на видео РИА Новости тест-драйв первого отчественного серийного автомобиля с четыресхтупенчатой АКПП.

2012-07-24T11:10

2012-07-24T11:10

2020-02-29T15:43

/html/head/meta[@name=’og:title’]/@content

/html/head/meta[@name=’og:description’]/@content

https://cdnn21.img.ria.ru/images/sharing/article/707482729.jpg?7075342781582980208

тольятти

самара

самарская область

россия

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

2012

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

Новости

ru-RU

https://ria.ru/docs/about/copyright.html

https://xn--c1acbl2abdlkab1og.xn--p1ai/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

Тест-драйв первой Lada Granta с автоматической коробкой передач

«АвтоВАЗ» начнет продажу Lada Granta с автоматической коробкой передач в августе 2012 года. Смотрите на видео РИА Новости тест-драйв первого отчественного серийного автомобиля с четырехступенчатой АКПП.

2012-07-24T11:10

true

PT3M11S

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

наука — видео, эфир , экономика. видео — видео, ситуация в автопроме. июль 2012, тольятти, самара, автопром, видео, самарская область, россия

11:10 24.07.2012 (обновлено: 15:43 29.02.2020)

«АвтоВАЗ» начнет продажу Lada Granta с автоматической коробкой передач в августе 2012 года. Смотрите на видео РИА Новости тест-драйв первого отчественного серийного автомобиля с четыресхтупенчатой АКПП.

В.Путин проводит тест-драйв автомобиля Lada Kalina на трассе «Амур» :: Общество :: РБК

Премьер-министр РФ Владимир Путин отправился в путешествие на автомобиле Lada Kalina по федеральной трассе «Амур» на участке Чита – Хабаровск. Глава правительства намерен не только проинспектировать новую автомагистраль, но и проверить, насколько надежной окажется продукция АВТОВАЗа в поездках на дальние расстояния.

«ВАЗ выпускает самый массовый автомобиль в нашей стране, которым пользуются миллионы людей. Надо посмотреть, как он работает», – отметил российский премьер. В.Путин отметил также, что на желтую Lada Kalina в спортивной комплектации, которая была ему предоставлена для тест-драйва, установлена система ГЛОНАСС.

Ранее глава правительства заявил, что строительство новой трассы Москва – Санкт-Петербург необходимо для развития экономики. В.Путин отметил, что всегда приходится делать выбор между развитием и сохранением природы, однако правительство прислушивается к мнению экологов и готово искать альтернативу.

Накануне президент РФ Дмитрий Медведев дал поручение остановить вырубку Химкинского леса под строительство платной автодороги между Москвой и Петербургом.

689 автомобилей с пробегом в наличии

Автосалон ИЮЛЬ авто с пробегом

Автосалон «ИЮЛЬ» входит в группу компаний, которая свыше 20 лет работает как официальный дилер автомобилей марки «LADA». Подразделение функционирует с 2018 года и занимается покупкой и продажей легковых авто с пробегом в Екатеринбурге. Мы заботимся о наших покупателях, поэтому в автосалоне представлены только качественные транспортные средства.

За год работы салон вошел в ТОП крупнейших дилеров по продаже авто с пробегом и зарекомендовал себя как салон по продаже проверенных и надежных авто. 

Все автомобили с пробегом, представленные  в каталоге, полностью готовы для дальнейшей эксплуатации.

Безопасная сделка

Мы гарантируем юридическую чистоту и безопасность сделки по покупке или продаже автомобиля с пробегом.

Каждый автомобиль проходит тщательную предпродажную подготовку:

  1. Юридическая чистота сделки

    Каждый автомобиль проверяется на наличие юридических ограничений: ограничения или запрет на регистрационные действия, арест автомобиля, числится ли авто в угоне. Также авто проверяется на наличие залогов, кредитов и неоплаченных штрафов.

  2. Техническая проверка авто

    На данном этапе предпродажной подготовки проверяется техническое состояние подержанного автомобиля:

    • Тщательный осмотр кузова авто, проверка на незаконные вмешательства в конструкцию автомобиля
    • Проверка лакокрасочного покрытия б/у авто
    • Проверка б/у автомобиля на участие в ДТП
    • Определение реального пробега у б/у авто
    • Проверка технического состояние автомобиля
    • Проверка автомобиля по VIN и гос. номеру

Как купить авто с пробегом в автосалоне 

Чтобы выгодно приобрести подержанный автомобиль необходимо всего 3 шага:

  1. Выбрать авто с пробегом

    Воспользуйтесь фильтром поиска на сайте, указав желаемые критерии выбора: марку, модель, год выпуска, тип двигателя, цену и пробег. Также можно обратиться к менеджерам автосалона по телефону или с личным визитом, и они подберут хороший вариант из нашего автопарка.

  2. Уточните всю информацию по автомобилю

    Можно уточнить всю информацию по, заказав обратный звонок, или связаться с автосалоном по телефону +7 (343) 302-13-66. 

  3. Посетить автосалон

    В дилерском центре оформление продажи подержанных авто проходит от 1 часа. 

Автомобили в салоне «ИЮЛЬ авто с пробегом» – большой выбор различных марок, принятый нами через систему трейд-ин или выкуп б/у авто. Все автомобили прошли сервисную диагностику, чтобы вы могли быть уверены в техническом состоянии ТС.  

Преимущества покупки б/у автомобиля в автосалоне «ИЮЛЬ авто с пробегом»:

  • Более 200 автомобилей с пробегом в наличии
  • Полная проверка технического состояния ТС на профессиональном оборудовании по 77 пунктам.
  • Юридическая чистота сделки
  • Возможность приобретения б/у автомобиля в кредит даже без первоначального взноса
  • Удобные условия приобретения ТС  – оформление сделки от 1 часа.

Перед покупкой авто с пробегом клиенты могут испытать его в движении и пройти тест-драйв. Это позволит лично оценить характеристики автомобиля, его комфорт и надежность. Звоните, наши менеджеры обязательно подберут машину с учетом ваших пожеланий!

Флуоресцентная микроскопия с резонансным переносом энергии (FRET) — Общие понятия

Вводные понятия

Точное расположение и природа взаимодействий между конкретными молекулярными видами в живых клетках представляет большой интерес во многих областях биологических исследований, но исследованиям часто мешает ограниченное разрешение инструментов, используемых для изучения этих явлений. Обычная широкопольная флуоресцентная микроскопия позволяет локализовать флуоресцентно меченые молекулы в пределах оптического пространственного разрешения, определенного критерием Рэлея, примерно 200 нанометров (0.2 мкм). Однако для понимания физических взаимодействий между белками-партнерами, участвующими в типичном биомолекулярном процессе, относительная близость молекул должна быть определена более точно, чем позволяют традиционные методы оптической визуализации с дифракционным ограничением. Метод резонансной передачи энергии флуоресценции (чаще обозначаемый аббревиатурой FRET ) в применении к оптической микроскопии позволяет определять сближение двух молекул в пределах нескольких нанометров (см. Рисунок 1), расстояние, достаточно близкое для происходить молекулярные взаимодействия.

Типичные методы флуоресцентной микроскопии основаны на поглощении флуорофором света на одной длине волны (возбуждение) с последующим испусканием вторичной флуоресценции на более длинной длине волны. Длины волн возбуждения и излучения часто отделены друг от друга на десятки и сотни нанометров. Маркировка клеточных компонентов, таких как ядра, митохондрии, цитоскелет, аппарат Гольджи и мембраны, специфическими флуорофорами позволяет их локализовать в фиксированных и живых препаратах.Путем одновременного мечения нескольких субклеточных структур отдельными флуорофорами, имеющими отдельные спектры возбуждения и испускания, можно использовать специальные комбинации флуоресцентных фильтров для изучения близости меченых молекул в пределах одной клетки или участка ткани. С помощью этого метода молекулы, которые расположены ближе друг к другу, чем предел оптического разрешения, кажутся совпадающими, и эта очевидная пространственная близость подразумевает, что молекулярная ассоциация возможна. В большинстве случаев, однако, нормального разрешения флуоресцентного микроскопа с ограничением дифракции недостаточно, чтобы определить, действительно ли имеет место взаимодействие между биомолекулами.Флуоресцентный резонансный перенос энергии — это процесс, при котором происходит безызлучательная передача энергии от флуорофора в возбужденном состоянии ко второму хромофору в непосредственной близости. Поскольку диапазон, в котором может происходить передача энергии, ограничен приблизительно 10 нанометрами (100 ангстрем), а эффективность передачи чрезвычайно чувствительна к расстоянию между флуорофорами, измерения резонансной передачи энергии могут быть ценным инструментом для исследования молекулярных взаимодействий. .

Механизм резонансной передачи энергии флуоресценции включает в себя флуорофор донора в возбужденном электронном состоянии, который может передавать свою энергию возбуждения соседнему хромофору акцептора без излучения посредством диполь-дипольных взаимодействий на большие расстояния. Теория, поддерживающая передачу энергии, основана на концепции рассмотрения возбужденного флуорофора как колеблющегося диполя, который может подвергаться обмену энергией со вторым диполем, имеющим аналогичную резонансную частоту.В этом отношении резонансная передача энергии аналогична поведению связанных осцилляторов, таких как пара камертонов, колеблющихся на одной и той же частоте. Напротив, радиационная передача энергии требует испускания и повторного поглощения фотона и зависит от физических размеров и оптических свойств образца, а также от геометрии контейнера и путей волнового фронта. В отличие от радиационных механизмов, резонансный перенос энергии может дать значительный объем структурной информации о донорно-акцепторной паре.

Резонансный перенос энергии нечувствителен к окружающей оболочке растворителя флуорофора и, таким образом, дает молекулярную информацию, уникальную по сравнению с той, которая выявляется с помощью зависящих от растворителя событий, таких как гашение флуоресценции, реакции возбужденного состояния, релаксация растворителя или измерения анизотропии. Основное влияние растворителя на флуорофоры, участвующие в резонансной передаче энергии, — это влияние на спектральные свойства донора и акцептора. Безызлучательный перенос энергии происходит на гораздо больших расстояниях, чем эффекты растворителя на коротких расстояниях, а диэлектрическая природа компонентов (растворителя и макромолекулы хозяина), расположенных между задействованными флуорофорами, очень мало влияет на эффективность резонансной передачи энергии, которая в первую очередь зависит от расстояние между донорным и акцепторным флуорофором.

Явление резонансной передачи энергии флуоресценции не опосредовано испусканием фотонов и, кроме того, даже не требует, чтобы акцепторный хромофор был флуоресцентным. Однако в большинстве приложений и донор, и акцептор являются флуоресцентными, и возникновение передачи энергии проявляется в тушении донорной флуоресценции и уменьшении времени жизни флуоресценции, сопровождаемом также увеличением эмиссии флуоресценции акцептора. Эффективность процесса передачи энергии изменяется пропорционально обратной шестой степени расстояния, разделяющего молекулы донора и акцептора.Следовательно, измерения FRET можно использовать в качестве эффективной молекулярной линейки для определения расстояний между биомолекулами, помеченными соответствующим донорным и акцепторным флуорохромом, когда они находятся в пределах 10 нанометров друг от друга.

Гипотетический пример резонансной передачи энергии флуоресценции между двумя флуорохромами, прикрепленными к противоположным концам одного и того же макромолекулярного белка, представлен на рисунке 1. В нативной конформации (рисунок 1 (а)) два флуорофоров разделены расстоянием приблизительно 12 нанометров, слишком далеко для передачи энергии внутримолекулярного резонанса между флуорохромами.Однако, когда белок подвергается конформационному изменению (рис. 1 (b)), два флуорохрома сближаются гораздо ближе и теперь могут участвовать в молекулярных взаимодействиях FRET. На рисунке возбуждение донорного флуорохрома показано синим свечением вокруг желтой трехъядерной ароматической молекулы, в то время как соответствующая акцепторная эмиссия (рисунок 1 (b)) представлена ​​зеленым свечением, окружающим второй гетероциклический флуорохром справа. -ручная сторона белка.Измерения передачи энергии часто используются для оценки расстояний между участками макромолекулы и влияния конформационных изменений на эти расстояния. В этом типе экспериментов степень передачи энергии используется для расчета расстояния между донором и акцептором и получения структурной информации о макромолекуле.

Хотя флуоресцентный резонансный перенос энергии часто использовался для исследования межмолекулярных и внутримолекулярных структурных и функциональных модификаций белков и липидов, основным препятствием для реализации методов FRET-микроскопии в живых клетках было отсутствие подходящих методов мечения конкретных внутриклеточных белки с соответствующими флуорофорами.Клонирование зеленого флуоресцентного белка медузы ( GFP ) и его экспрессия в самых разных типах клеток стали критическим ключом к разработке маркеров как для экспрессии генов, так и для структурной локализации белка в живых клетках. Было разработано несколько вариантов мутации белка с различными спектрами, включая флуоресцентный белок, излучающий синий свет ( синий флуоресцентный белок , BFP ). Спектры возбуждения и излучения для нативных мутантов GFP и BFP достаточно разделены по длинам волн, чтобы быть совместимыми с подходом FRET.Рисунок 2 иллюстрирует стратегию обнаружения белок-белковых взаимодействий с использованием флуоресцентного резонансного переноса энергии и мутантных флуоресцентных белков. Если два белка, один из которых помечен BFP (донор), а другой — GFP (акцептор), физически взаимодействуют, то при возбуждении комплекса при максимальной длине волны поглощения будет наблюдаться повышенная интенсивность в максимуме эмиссии акцептора (510 нанометров). (380 нм) донора. Неспособность белков образовать комплекс не приводит к эмиссии акцептора (GFP) флуоресценции.

В сочетании с достижениями в области импульсных лазеров, микроскопической оптики и компьютерных технологий визуализации разработка методов маркировки, в которых донорные и акцепторные флуорофоры фактически являются частью самих биомолекул, позволила визуализировать динамические взаимодействия белков в живых клетках. В дополнение к изучению взаимодействий белковых партнеров, недавние применения флуоресцентного резонансного переноса энергии включают исследования активности протеаз, изменений потенциалов мембранного напряжения, метаболизма кальция и проведение высокопроизводительных скрининговых анализов, таких как количественная оценка экспрессии генов в одиночные живые клетки.

Принципы передачи энергии резонанса флуоресценции

Процесс резонансной передачи энергии ( RET ) может иметь место, когда донорный флуорофор в электронно возбужденном состоянии передает свою энергию возбуждения соседнему хромофору, акцептору. В принципе, если спектр излучения флуоресценции молекулы-донора перекрывает спектр поглощения молекулы-акцептора и они находятся в пределах минимального пространственного радиуса, донор может напрямую передавать свою энергию возбуждения акцептору через диполь-дипольные межмолекулярные соединения на большие расстояния. связь.Теория, предложенная Теодором Фёрстером в конце 1940-х годов, первоначально описывала молекулярные взаимодействия, участвующие в резонансной передаче энергии, и Фёрстер также разработал формальное уравнение, определяющее взаимосвязь между скоростью передачи, межхромофорным расстоянием и спектральными свойствами задействованных хромофоров.

Резонансная передача энергии — это безызлучательный квантово-механический процесс, который не требует столкновения и не требует выделения тепла. Когда происходит передача энергии, молекула-акцептор гасит флуоресценцию молекулы-донора, и если акцептор сам является флуорохромом, наблюдается повышенное или сенсибилизированное излучение флуоресценции (см. Рисунок 3).Это явление можно наблюдать, возбуждая образец, содержащий как донорные, так и акцепторные молекулы, светом с длинами волн, соответствующими максимуму поглощения донорного флуорофора, и детектируя свет, излучаемый с длинами волн с центром вблизи максимума излучения акцептора. Альтернативный метод обнаружения, быстро набирающий популярность, заключается в измерении времени жизни флуоресценции донорного флуорофора в присутствии и в отсутствие акцептора.

На рисунке 3 представлена ​​диаграмма Яблонского, иллюстрирующая связанные переходы между испусканием донора и поглощением акцептора при резонансном переносе энергии флуоресценции.Абсорбционные и эмиссионные переходы представлены прямыми вертикальными стрелками (зелеными и красными соответственно), а колебательная релаксация — волнистыми желтыми стрелками. Связанные переходы показаны пунктирными линиями, что указывает на их правильное расположение на диаграмме Яблонского, если они возникли в результате опосредованных фотонами электронных переходов. В присутствии подходящего акцептора донорный флуорофор может передавать энергию возбужденного состояния непосредственно акцептору, не испуская фотон (показано синей стрелкой на рисунке 3).Получающееся в результате сенсибилизированное флуоресцентное излучение имеет характеристики, аналогичные спектру излучения акцептора.

Чтобы произошла резонансная передача энергии, необходимо выполнить несколько критериев. В дополнение к перекрывающимся спектрам излучения и поглощения молекул донора и акцептора, два задействованных флуорофора должны располагаться на расстоянии от 1 до 10 нанометров друг от друга. Как описано в уравнениях, выведенных Фёрстером (и обсуждаемых ниже), эффективность передачи энергии между донорными и акцепторными молекулами уменьшается в шестой степени расстояния, разделяющего их.Следовательно, способность донорного флуорофора передавать свою энергию возбуждения акцептору за счет безызлучательного взаимодействия резко снижается с увеличением расстояния между молекулами, ограничивая явление FRET максимальным радиусом разделения донор-акцептор приблизительно 10 нанометров. На расстояниях менее 1 нанометра возможны несколько других режимов передачи энергии и / или электронов. Зависимость процесса резонансной передачи энергии от расстояния является основной основой его полезности при исследовании молекулярных взаимодействий.В исследованиях живых клеток с участием молекул, меченных донорными и акцепторными флуорофорами, резонансная передача энергии будет происходить только между молекулами, которые находятся достаточно близко, чтобы биологически взаимодействовать друг с другом.

Дополнительным требованием для резонансной передачи энергии является то, что время жизни флуоресценции донорной молекулы должно быть достаточным для того, чтобы событие могло произойти. Как скорость ( K (T) ), так и эффективность ( E (T) ) передачи энергии напрямую связаны со временем жизни донорного флуорофора в присутствии и в отсутствие акцептора.Согласно теории Фёрстера и подтвержденной экспериментально, скорость передачи энергии определяется уравнением:

KT = (1 / τD) • [R0 / r] 6

, где R (0) — критическое значение Фёрстера. расстояние , τ (D) — время жизни донора в отсутствие акцептора, а r — расстояние, разделяющее донорные и акцепторные хромофоры. Критическое расстояние Фёрстера ( R (0) ) определяется как радиус разделения акцептор-донор, для которого скорость передачи равна скорости распада донора (снятия возбуждения) в отсутствие акцептора.Другими словами, когда радиус донора и акцептора ( r ) равен расстоянию Ферстера, то эффективность переноса составляет 50 процентов. На этом радиусе разделения половина энергии возбуждения донора передается акцептору посредством резонансной передачи энергии, а другая половина рассеивается посредством комбинации всех других доступных процессов, включая излучение флуоресценции.

Концептуально критическое расстояние Фёрстера — это максимальная длина разделения между донорными и акцепторными молекулами, при которой все еще будет происходить резонансная передача энергии.Значение критического расстояния обычно находится в диапазоне от 2 до 6 нанометров, что, к счастью, порядка многих размеров молекул белка. Кроме того, диапазон критических расстояний также соответствует нескольким другим биологически значимым параметрам, таким как толщина клеточной мембраны и расстояние, разделяющее сайты на белках, имеющих несколько субъединиц. Значение R (0) (в нанометрах) можно рассчитать из следующего выражения:

R0 = 2,11 × 10-2 • [

κ

2 • Дж (λ) • η-4 • QD] 1/6

, в котором κ -квадрат — коэффициент, описывающий относительную ориентацию в пространстве между переходными диполями донора и акцептора, Дж (λ) — интеграл перекрытия в области излучения донора. и спектры поглощения акцептора (с длиной волны, выраженной в нанометрах), η представляет показатель преломления среды, а Q (D) представляет собой квантовый выход донора.

Эффективность передачи энергии, E (T) , является мерой доли фотонов, поглощенных донором, которые передаются акцептору, и связана с расстоянием разделения донора и акцептора, r , соотношением уравнение:

r = R0 • [(1 / ET) — 1] 1/6

и E (T) вычисляется как:

ET = 1 — (τDA / τD)

, где τ (DA) — время жизни донора в присутствии акцептора, а τ (D) — время жизни донора в отсутствие акцептора.Следовательно, измеряя время жизни донорной флуоресценции в присутствии и в отсутствие акцептора (что указывает на степень тушения донора из-за акцептора), можно определить расстояние, разделяющее молекулы донора и акцептора. Во многих обычно применяемых методах эффективность передачи энергии определяется путем измерения в установившемся режиме относительной средней интенсивности флуоресценции донора в присутствии и в отсутствие акцептора (а не путем измерения времени жизни).

Таким образом, скорость передачи энергии зависит от степени перекрытия спектров между спектрами излучения донора и поглощения акцептора (см. Рисунок 4), квантового выхода донора, относительной ориентации дипольных моментов перехода донора и акцептора, и расстояние, разделяющее молекулы донора и акцептора. Любое событие или процесс, которые влияют на расстояние между донором и акцептором, будут влиять на скорость резонансной передачи энергии, что позволяет количественно оценить явление при условии, что артефакты можно контролировать или устранять.

На рисунке 4 представлены спектры поглощения и излучения голубого флуоресцентного белка ( CFP , донор) и красного флуоресцентного белка ( RFP или DsRed , акцептор) по сравнению с их потенциальным применением в качестве пара резонансного переноса энергии флуоресценции. Спектры поглощения обоих биологических пептидов показаны красными кривыми, а спектры испускания представлены синими кривыми. Область перекрытия спектров излучения донора и поглощения акцептора представлена ​​серой областью у основания кривых.Всякий раз, когда спектральное перекрытие молекул слишком сильно увеличивается, возникает явление, известное как спектральное просачивание или кроссовер , в котором сигнал от возбужденного акцептора (возникающий из возбуждающего освещения донора) и излучение донора обнаруживаются в акцепторный канал излучения. Результатом является высокий фоновый сигнал, который необходимо выделить из излучения слабой флуоресценции акцептора.

Основная теория безызлучательного переноса энергии напрямую применима к паре донор-акцептор, разделенной фиксированным расстоянием, и в этом случае скорость передачи энергии является функцией расстояния Ферстера, R (0) , которое в свою очередь зависит от κ -квадрат, Дж (λ) , η и Q (D) .Если эти факторы известны, можно рассчитать расстояние между донором и акцептором. Для описания таких ситуаций, как множественные акцепторные хромофоры и распределения расстояний, требуются более сложные формулировки. В таблице 1 представлена ​​серия экспериментально измеренных критических расстояний Фёрстера, которые были установлены из спектрального перекрытия нескольких популярных пар донорно-акцепторных флуорофоров. Поскольку переменная включает выход донорного кванта и степень спектрального перекрытия, оба из которых зависят от локализованных условий окружающей среды, значения расстояния Ферстера должны определяться в тех же экспериментальных условиях, что и те, которые используются для исследования резонансного переноса энергии.

Показатель преломления среды передачи энергии обычно известен из состава растворителя или может быть оценен для конкретной макромолекулы и обычно принимается равным 1,4 в водном растворе. Квантовый выход донора определяется путем сравнения со стандартными флуорофорами с известным квантовым выходом. Поскольку Q (D) появляется как шестой корень при вычислении R (0) , небольшие ошибки или неточности в значении Q (D) не имеют большого влияния на расчет расстояния Ферстера.Также из-за зависимости корня шестой степени, R (0) не сильно зависит от вариаций J (λ) , но интеграл перекрытия все равно должен оцениваться для каждой пары донор-акцептор. В общем, более высокая степень перекрытия между спектром излучения донора и спектром поглощения акцептора дает более высокие значения критического расстояния Ферстера.

Критическое расстояние Фёрстера для обычных пар донор-акцептор RET
Донор Акцептор Расстояние Ферстера (нанометры)
Триптофан Дансил 2.1
ИАЭДАНЫ (1) ДДПМ (2) 2,5 — 2,9
BFP DsRFP 3,1 — 3,3
Дансил FITC 3,3 — 4,1
Дансил Октадецилродамин 4.3
CFP GFP 4.7 — 4,9
CF (3) Техасский красный 5.1
Флуоресцеин Тетраметилродамин 4,9 — 5,5
Cy3 Cy5 > 5,0
GFP YFP 5,5 — 5,7
BODIPY FL (4) BODIPY FL (4) 5.7
Родамин 6G Малахитовый зеленый 6.1
FITC Эозин тиосемикарбазид 6,1 — 6,4
B-фикоэритрин Cy5 7.2
Cy5 Cy5.5 > 8,0

(1) 5- (2-иодацетиламиноэтил) аминонафталин-1-сульфоновая кислота
(2) N- (4-диметиламино-3,5-динитрофенил) малеимид
(3) карбоксифлуоресцеинсукцинимидиловый эфир
(4) 4,4-дифтор-4-бора-3a, 4a-диаза-s-индацен

Таблица 1

Неопределенность в оценке фактора ориентации ( κ -квадрат) широко обсуждалась в литературе, и, несмотря на экспериментальные доказательства того, что теория Фёрстера действительна и применима к измерению расстояний, эта переменная продолжала оставаться в силе. несколько спорно.Важно понимать, что расстояния Ферстера обычно приводятся для предполагаемого значения κ в квадрате, обычно это динамически усредненное значение 2/3 (0,67). Это предполагаемое значение является результатом рандомизации ориентации донора и акцептора посредством вращательной диффузии до передачи энергии. Фактор ориентации зависит от относительной ориентации в пространстве диполя излучения донора и диполя поглощения акцептора и может находиться в диапазоне от нуля до 4. Значение 1 соответствует параллельным диполям перехода, а значение 4 соответствует диполям, которые оба являются параллельные и коллинеарные.

Из-за отношения корня шестой степени к расстоянию Ферстера, изменение коэффициента ориентации от 1 до 4 приводит к изменению рассчитанного расстояния только на 26 процентов, а максимальная погрешность в 35 процентов возможна, когда обычно принимаемое значение 0,67 применяется. Наиболее серьезная потенциальная ошибка возникает, если диполи ориентированы точно перпендикулярно друг другу и соответствующее значение в квадрате κ становится равным нулю. Было использовано несколько методов работы с неопределенностью, включая предположение, что существует ряд статических ориентаций, которые не изменяются в течение времени жизни флуорофора в возбужденном состоянии.Измерения анизотропии флуоресценции для донора и акцептора могут позволить определить пределы для вариации κ в квадрате. Кроме того, использование флуорофоров с низкой поляризацией флуоресценции (из-за излучения нескольких перекрывающихся переходов) снижает неопределенность фактора ориентации. Ограничение возможных значений κ в квадрате таким образом снижает потенциальную ошибку вычисления расстояния до 10 процентов.

Во многих случаях фактор ориентации трудно, если вообще возможно, определить, а точное значение переменной часто рассматривается как непреодолимая проблема.Однако некоторые свидетельства указывают на ограничение важности фактора в расчетах резонансного переноса энергии. Сравнение донорных и акцепторных расстояний с использованием методов резонансной спектроскопии переноса энергии и дифракции рентгеновских лучей в значительной степени подтверждает обоснованность принятия значения 0,67 для фактора (как предложено теорией Фёрстера), по крайней мере, для небольших пептидов и белков. Больше неопределенности существует для более крупных белков. Использование этого значения для фактора ориентации допустимо при предположении, что зонды донора и акцептора могут свободно совершать неограниченное изотропное движение.Дальнейшее обоснование получено из экспериментальных доказательств того, что для флуорофоров, прикрепленных одинарной или двойной связью к макромолекулам, сегментарные движения донора и акцептора имеют тенденцию приводить к динамически рандомизированным ориентациям.

Для слабосвязанных флуорохромов свободное вращательное движение вокруг одинарных связей должно позволить использовать среднее значение ориентации, но неограниченное движение молекул, связанных через несколько сайтов связывания, вероятно, не происходит. С другой стороны, крайние значения нуля и 4 для κ -квадрат требуют полной поляризации флуоресценции донора и акцептора, а это условие маловероятно.Статистические расчеты были представлены некоторыми исследователями, которые утверждают, что расстояния распределения донор-акцептор и их ориентация определяют наблюдаемое среднее расстояние. При условии, что наблюдается некоторое распределение наблюдаемого расстояния (и это не ограничивается слишком близким расположением донора и акцептора относительно R (0) ), можно надежно получить среднее расстояние между флуорофорами и оценить погрешность, обусловленную фактором ориентации. .

Зависимость фактора ориентации ( κ в квадрате) от относительной ориентации диполя излучения донора и диполя поглощения акцептора (показано на рисунке 5) дается уравнением:

κ

2 = (cos θT — 3cos θDcos θA) 2 = (sin θD sin θAcos Φ — 2cos θDcos θA) 2

, где θ (T) — угол между диполем перехода излучения донора и диполем перехода поглощения акцептор, θ (D) и θ (A) — это углы между этими диполями и вектором, соединяющим донор и акцептор, а Φ — угол между плоскостями, содержащими два переходных диполя.

Эффективность передачи энергии наиболее чувствительна к изменениям расстояния, когда расстояние между донорами и акцепторами приближается к расстоянию Ферстера ( R (0) ) для двух молекул. Рисунок 6 иллюстрирует экспоненциальную зависимость между эффективностью переноса и расстоянием, разделяющим донор и акцептор. Эффективность быстро увеличивается до 100 процентов, когда расстояние разделения уменьшается ниже R (0) , и, наоборот, уменьшается до нуля, когда r больше, чем R (0) .Из-за сильной (шестой степени) зависимости эффективности переноса от расстояния измерения расстояния разделения донора и акцептора надежны только в том случае, если радиус донора и акцептора находится в пределах расстояния Ферстера в два раза. Когда r составляет примерно 50 процентов от R (0) , эффективность резонансной передачи энергии близка к максимальной, и более короткие расстояния не могут быть надежно определены. Когда расстояние донор-акцептор превышает значение R (0) на 50 процентов, наклон кривой настолько пологий, что более длинные разделительные расстояния не разрешаются.

Практическое значение знания критического расстояния Фёрстера состоит в том, что это значение дает представление о диапазоне расстояний разделения, которые могут быть определены FRET для данной пары датчиков (см. Таблицу 1). Поскольку измерение передачи энергии очень чувствительно к изменению расстояния, когда расстояния донор-акцептор близки к расстоянию Ферстера, приблизительные размеры целевого молекулярного взаимодействия являются наиболее важным фактором при выборе пары флуоресцентных красителей.Другие факторы, которые следует учитывать, в зависимости от того, проводятся ли измерения в установившемся режиме или с временным разрешением, включают химическую стабильность, квантовый выход и время жизни флуорофора. Поскольку для обычных методов флуоресцентного резонансного переноса энергии не существует внутреннего эталона расстояния, расстояния, рассчитанные путем измерения эффективности переноса, относятся к расстоянию Ферстера, которое выводится из спектроскопических данных, измеренных на парах донор-акцептор.

Явление резонансной передачи энергии с помощью механизма Ферстера сложно в некоторых аспектах, но простое и надежное по своему результирующему эффекту.Расстояния Ферстера точно предсказываются из спектральных свойств донора и акцептора, и, поскольку никаких исключений из теории еще не выявлено, можно предположить, что резонансный перенос энергии происходит при любых условиях, при которых пара молекулы донор-акцептор находится в непосредственной близости. Сложность теории, описывающей перенос диполя, возникает не из-за самого механизма передачи, а из-за наличия распределений расстояний (включая неслучайные распределения) и диффузии молекул донора и акцептора.Когда предпринимаются шаги для усреднения зависимости передачи энергии от расстояния по диапазону геометрий и временных рамок, FRET представляет собой надежный метод исследования пространственного распределения между взаимодействующими молекулами.

Применение методов FRET в оптической микроскопии

Параметры конфигурации микроскопа для исследований флуоресцентного резонансного переноса энергии меняются в зависимости от требований флуорофоров, образца и режима (-ов) визуализации, но практически любой вертикальный или инвертированный микроскоп можно дооснастить для FRET-микроскопия (см. Рисунок 7).Как правило, микроскоп должен быть оснащен охлаждаемой и усиленной системой CCD-камеры с высоким разрешением (12 бит), связанной с качественными интерференционными фильтрами, имеющими низкие уровни перекрестных помех (минимальный уровень блокировки) и полосы пропускания, соответствующие спектрам флуорофора. Чувствительность детектора определяет, насколько узкой может быть полоса пропускания фильтра, при этом сбор данных может продолжаться с приемлемой скоростью с минимальным спектральным сквозным шумом. В большинстве случаев для получения изображений следует использовать одно дихроматическое зеркало, соединенное с колесами или ползунками фильтров возбуждения и излучения, чтобы минимизировать или исключить сдвиги изображения.

Широкопольная флуоресцентная микроскопия страдает от излучения флуорофора, возникающего выше и ниже фокальной плоскости, что приводит к получению изображений со значительным расфокусированным сигналом, который снижает контраст и приводит к ухудшению качества изображения. Эта проблема усугубляется в микроскопии FRET из-за изначально низких уровней сигнала, возникающих в результате резонансной передачи энергии. Методы цифровой деконволюции могут быть связаны с оптическим секционированием, чтобы уменьшить или исключить сигналы вдали от фокальной плоскости, но этот процесс требует больших вычислительных ресурсов и может быть недостаточно быстрым для многих экспериментов по динамической визуализации FRET.Конфокальные методы лазерного сканирования могут применяться к FRET-микроскопии для значительного улучшения латерального разрешения, позволяя собирать последовательные оптические срезы с интервалами, приближающимися к реальному времени. Основным недостатком конфокальной микроскопии является ограничение длин волн возбуждения стандартными лазерными линиями, доступными для конкретной системы, что ограничивает выбор пар флуорофора донора и акцептора в экспериментах по резонансному переносу энергии. Многофотонное возбуждение также может использоваться в сочетании с методами FRET и меньше повреждает клетки из-за задействованных более длинных волн возбуждения.Кроме того, артефакты автофлуоресценции и фотообесцвечивание образца с меньшей вероятностью возникают в ограниченном объеме возбуждения, характерном для многофотонного возбуждения.

Типичная конфигурация микроскопа, способная наблюдать живые клетки в культуре с несколькими мотивами изображения флуоресцентного резонансного переноса энергии, представлена ​​на рисунке 7. Инвертированный микроскоп для культуры тканей оснащен стандартной вольфрам-галогеновой лампой на столбе для исследования и записи. ячейки, использующие стандартное светлое поле, фазово-контрастное или дифференциально-интерференционное ( DIC ) освещение.Обратите внимание, что последние два метода усиления контраста можно использовать в сочетании с флуоресценцией, чтобы выявить пространственное расположение флуорофоров в клеточной архитектуре. К тринокулярной головке микроскопа прикреплена стандартная система CCD-камеры с охлаждением Пельтье для получения широкоугольной флуоресценции и получения изображений в светлом поле.

Эксперименты по резонансной передаче энергии проводятся с использованием мультиспектрального освещения с использованием либо широкопольного освещения (дуговая разрядная лампа), либо конфокальной сканирующей приставки в реальном времени, оснащенной высокоскоростной дисковой системой Нипкова.Луч аргонно-криптонового лазера сначала фильтруется через акустооптическое устройство с перестраиваемой длиной волны для выбора конкретных длин волн возбуждения перед прохождением к конфокальной сканирующей головке. Изображения собираются с помощью двух охлаждаемых CCD-камер высокого разрешения Gen III с усиленным охлаждением, считывающих отдельные каналы, и передаются в буфер на главный компьютер. Сканирование образца в боковой ( x и y ) и осевой ( z ) плоскостях позволяет собирать оптические срезы для восстановления трехмерного изображения.Различные программы обработки изображений совместимы с проиллюстрированной конфигурацией микроскопа.

Основываясь на фундаментальных принципах этого явления, при проведении измерений резонансного переноса энергии флуоресценции с помощью оптического микроскопа следует учитывать ряд важных практических моментов:

  • Необходимо тщательно контролировать концентрации донорных и акцепторных флуорофоров. Статистически самая высокая вероятность достижения резонансного переноса энергии флуоресценции происходит, когда несколько акцепторных молекул окружают одну донорную молекулу.
  • Фотообесцвечивание необходимо устранить, поскольку артефакт может изменить молекулярное соотношение донора и акцептора и, следовательно, измеренное значение процесса резонансной передачи энергии.
  • Спектр излучения донорной флуоресценции и спектр поглощения акцептора должны иметь значительную область перекрытия.
  • Прямое возбуждение акцептора в диапазоне длин волн, используемом для возбуждения донора, должно быть минимальным. Распространенным источником ошибок в измерениях с помощью FRET-микроскопии в установившемся режиме является обнаружение донорной эмиссии с помощью наборов акцепторных фильтров.
  • Длины волн излучения как донора, так и акцептора должны совпадать с максимальным диапазоном чувствительности детектора.
  • Спектры поглощения и излучения донора должны иметь минимальное перекрытие, чтобы уменьшить возможность самопереноса от донора к донору.
  • Донорная молекула должна быть флуоресцентной и иметь достаточно длительное время жизни, чтобы произошла резонансная передача энергии.
  • Донор должен обладать низкой поляризационной анизотропией, чтобы минимизировать неопределенности в значении фактора ориентации (-квадрат).Этому требованию удовлетворяют доноры, испускание которых происходит в результате нескольких перекрывающихся переходов возбуждения.
  • При использовании методов маркировки антител не следует изменять биологическую активность реагентов, конъюгированных с донорными и акцепторными флуорохромами. Любое снижение активности серьезно повлияет на достоверность результирующих измерений резонансного переноса энергии.
  • Поскольку флуоресцентный резонансный перенос энергии требует, чтобы молекулы донора и акцептора имели соответствующее дипольное выравнивание и располагались в пределах 10 нанометров друг от друга, необходимо учитывать третичную структуру реагентов, к которым присоединены молекулы.Например, когда донорно-акцепторные молекулы могут быть прикреплены к различным структурным местоположениям (таким как карбокси или аминоконце) на белке, возможно, что FRET не будет наблюдаться, даже если белки действительно взаимодействуют, потому что молекулы донора и акцептора расположены на противоположных концах взаимодействующих молекул.
  • Живые клетки, меченные зелеными флуоресцентными мутантами белка для исследований FRET, должны быть проанализированы с использованием традиционных иммуногистохимических методов, чтобы убедиться, что меченый белок принимает ту же внутриклеточную среду обитания и свойства, что и нативный аналог.

Для того, чтобы явление флуоресцентного резонансного переноса энергии предоставило значимые данные в качестве инструмента в оптической микроскопии, необходимо оптимизировать как подготовку образца, так и параметры визуализации. Выбор подходящих донорных и акцепторных зондов и способа их использования в качестве молекулярных меток является серьезной проблемой. Кроме того, как только стратегия маркировки, которая разрешает передачу энергии, была разъяснена, широкий спектр методов может быть использован для выполнения самого измерения.Большинство количественных исследований флуоресцентной микроскопии проводится путем измерения интенсивности флуоресцентного излучения. Обнаружение FRET на основе интенсивности флуоресценции обычно достигается путем отслеживания изменений относительных величин интенсивности излучения на двух длинах волн, соответствующих донорному и акцепторному хромофорам. Когда условия подходят для возникновения резонансного переноса энергии флуоресценции, увеличение эмиссии акцептора ( I (A) ) сопровождается одновременным уменьшением интенсивности эмиссии донора ( I (D) ).

Хотя изменение относительной интенсивности излучения донора или акцептора можно рассматривать как показатель резонансного переноса энергии, обычно используется отношение двух значений: I (A) / I (D) , как мера FRET. Величина отношения зависит от среднего расстояния между парами донор-акцептор и нечувствительна к различиям в длине пути и объёме, доступном для возбуждающего светового луча. Любое состояние образца, которое вызывает изменение относительного расстояния между парами молекул, приводит к изменению соотношения испускания донора и акцептора.Следовательно, FRET можно наблюдать в микроскопе путем преимущественного возбуждения донорного флуорофора и обнаружения повышенного излучения взаимодействующего акцепторного флуорофора, сопровождаемого уменьшением флуоресценции донора, вызванным гашением из-за передачи энергии. Измерение FRET с использованием подхода мониторинга интенсивности называется стационарным, флуоресцентным резонансным переносом энергии.

Соответствующие донорные и акцепторные зонды выбираются на основе их спектральных характеристик поглощения и излучения.Для максимальной резонансной передачи энергии спектр излучения донора должен существенно перекрывать спектр поглощения акцептора. Кроме того, должно быть минимальное прямое возбуждение акцепторного флуорофора в максимуме возбуждения донора, и не должно быть значительного перекрытия излучения между донором и акцептором в области длин волн, в которой происходит излучение акцептора. На практике может быть сложно идентифицировать пары донор-акцептор, удовлетворяющие этим требованиям.Ситуация часто осложняется тем фактом, что имеющиеся в продаже наборы флуоресцентных фильтров не полностью эффективны при пропускании только желаемых длин волн, и может передаваться небольшой процент света за пределами проектной полосы пропускания. Если не используются очень хорошо охарактеризованные и контролируемые системы экспрессии, может быть трудно определить точную концентрацию донорных и акцепторных флуорофоров. Дополнительные корректировки могут также потребоваться для автофлуоресценции, фотообесцвечивания и фоновой флуоресценции.

Типичное исследование внутриклеточной белковой ассоциации в живой культуре клеток проиллюстрировано на рисунке 8 для событий, связанных с апоптозом, физическим процессом гибели клеток в результате сложного каскада последовательных взаимодействий. Генные продукты, непосредственно участвующие в цепочке событий, могут быть помечены путем слияния с соответствующими членами семейства флуоресцентных белков (в данном случае BFP и GFP) для совместной экспрессии в одной и той же клетке, чтобы исследовать специфические ассоциации с помощью FRET.Белки, участвующие в апоптозе, взаимодействуют внутри митохондрий и демонстрируют постепенное уменьшение связывания по мере того, как происходит запрограммированная гибель клеток. Таким образом, изображение излучения донора (рис. 8 (a)) содержит только флуоресценцию от белков, меченных BFP, в то время как соответствующий профиль излучения акцептора (рис. 9 (b)) иллюстрирует сигналы, обусловленные белками, меченными GFP (и некоторый вклад от белков, меченных GFP). донорская эмиссия). Фильтр FRET (рис. 8 (c)), как описано ниже, выявляет флуоресценцию, полученную в результате резонансного переноса энергии между двумя белками

Среди факторов, которые могут потенциально повлиять на точность измерений резонансного переноса энергии флуоресценции в целом, некоторые из них очень специфичны. к оптическому микроскопу.Основной целью микроскопических исследований является получение изображений с высоким разрешением, и это требует особого внимания к качеству и характеристикам оптических фильтров, используемых для спектрального различения длин волн поглощения и излучения донора и акцептора. Чтобы максимизировать отношение сигнал / шум (без вредного воздействия на образец или исследуемый процесс), необходимо тщательно сбалансировать интенсивность и время воздействия возбуждающего света с концентрацией донорных и акцепторных флуорофоров и детектора. эффективность.Если концентрация донорно-акцепторных флуорофоров чрезмерна, может произойти самотушение, влияющее на точность измерений FRET. Фотообесцвечивание является проблемой всех флуорофоров и может повлиять на соотношение донор-акцептор, изменяя измерения флуоресценции. Избыточная интенсивность освещения также может повредить образцы, особенно содержащие живые клетки или ткани.

Метод, известный как донорский фотообесцвечивающий резонансный перенос энергии флуоресценции ( pbFRET ), который использует процесс фотообесцвечивания для измерения FRET, часто применяется при исследовании фиксированных образцов.Основанный на попиксельном анализе, этот метод был применен для измерения отношений близости между белками клеточной поверхности, меченными моноклональными антителами, конъюгированными с флуорофором. Фотообесцвечивание FRET основано на теории, согласно которой флуорофор чувствителен к фотоповреждению только тогда, когда он находится в возбужденном состоянии. Статистически только небольшая часть молекул находится в возбужденном состоянии в любой момент времени, и поэтому флуорофоры с более длительным временем жизни флуоресценции имеют более высокую вероятность фотоповреждения и демонстрируют более высокую скорость фотообесцвечивания.

Экспериментальные данные, подтверждающие эту концепцию, продемонстрировали, что время фотообесцвечивания флуорофора обратно пропорционально времени его жизни в возбужденном состоянии. Возникновение резонансной передачи энергии снижает время жизни флуоресценции молекулы донора, эффективно защищая ее от фотообесцвечивания. Расчеты pbFRET основаны на уменьшении скорости фотообесцвечивания донора по сравнению с измеренной для донора в отсутствие резонансной передачи энергии. Измерение фотообесцвечивания в исследованиях FRET требует относительно длительного периода времени и, следовательно, наиболее применимо к образцам фиксированных клеток, в которых временные данные не важны, а влияние фотообесцвечивания на функцию клеток не является проблемой.В некоторых отношениях методика фотообесцвечивания доноров менее сложна, чем измерение сенсибилизированного излучения, хотя подгонка постоянных времени к кривым фотообесцвечивания, включающим несколько компонентов, представляет некоторые дополнительные трудности.

Эффективность передачи энергии также может быть определена с помощью методов фотообесцвечивания акцептора , в которых изменение тушения донорной эмиссии измеряется путем сравнения значения до и после селективного фотообесцвечивания акцепторной молекулы.Анализ изменения интенсивности флуоресценции донора в одних и тех же областях образца до и после удаления акцептора имеет то преимущество, что требует подготовки только одного образца, и напрямую связывает эффективность передачи энергии с флуоресценцией как донора, так и акцептора.

Точное измерение резонансного переноса энергии флуоресценции в микроскопе требует компенсации всех потенциальных источников ошибок. Был разработан простой метод корректировки обнаружения донорной флуоресценции с помощью фильтра эмиссии акцептора и флуоресценции акцептора с фильтром эмиссии донора (из-за кроссовера или спектрального просвечивания).Метод также корректирует зависимость FRET от концентраций донорных и акцепторных флуорофоров. Стратегия измерения, которая требует минимум спектральной информации, использует комбинацию из трех наборов фильтров и может быть легко реализована. Наборы фильтров донора, FRET и акцептора предназначены для выделения и максимизации трех конкретных сигналов: флуоресценции донора, флуоресценции акцептора, относящейся к FRET, и флуоресценции непосредственно возбужденного акцептора, соответственно. На практике три разных образца, содержащие только донор, только акцептор, и донор, и акцептор, исследуются с каждым из трех наборов фильтров, и полученные данные обрабатываются арифметически для корректировки кроссовера и неконтролируемых изменений концентраций донор-акцептор.

На рисунке 9 представлены схематические иллюстрации кроссовера (спектральное просачивание) и перекрестных помех фильтра, двух важных проблем, которые необходимо преодолеть, чтобы получить количественные результаты в экспериментах по флуоресцентному резонансному переносу энергии. Кроссовер или просачивание проявляется в перекрытии спектра излучения донорной флуоресценции с полосой пропускания интерференционного фильтра излучения акцептора на рисунке 9, в результате чего сигнал излучения донора (нежелательные длины волн) проходит через фильтр излучения.Напротив, перекрестные помехи фильтра описывают минимальный уровень затухания (блокировки) в определенном диапазоне двух фильтров, установленных вместе последовательно, и вызывают беспокойство при согласовании фильтров возбуждения и излучения для наборов флуоресценции. Дихроматические зеркала часто включают в оценку перекрестных помех комбинаций флуоресцентных фильтров. Хотя два эмиссионных фильтра редко устанавливаются на световом пути одновременно, спектры объединены на рисунке 9, чтобы одновременно проиллюстрировать обе концепции.Обратите внимание, что два спектра фильтра (синяя и красная кривые) представляют коэффициент пропускания света интерференционными фильтрами, тогда как кривая излучения донора (зеленый) представляет собой график зависимости интенсивности от длины волны.

Дополнительные факторы, которые потенциально могут привести к значительным ошибкам, также требуют исправления при использовании методов измерения FRET в установившемся режиме. Кроме того, желателен тщательный контроль концентрации донорного и акцепторного флуорофора. Определения концентрации флуорофора можно частично избежать за счет применения измерений флуоресценции с временным разрешением, которые обеспечивают метод получения среднего времени жизни без точного знания концентраций доноров.Метод позволяет количественно определять расстояние разделения донор-акцептор и основан на измерениях времени жизни донора в присутствии и в отсутствие акцептора. Измерение спада интенсивности флуоресценции как функции времени проясняет динамику излучения молекулы в возбужденном состоянии, и, следовательно, может быть получена более подробная информация о природе донорно-акцепторного взаимодействия. Графические графики спада интенсивности иллюстрируют усредненные по времени детали процесса затухания флуоресценции (см. Рис. 10 (а)), которые не разрешаются при использовании методов устойчивого состояния.Измерения, показывающие одно и то же значение для среднего времени жизни, когда регистрируется как интенсивность в установившемся состоянии, нормированная на поглощение, могут соответствовать существенно разным формам кривых затухания на графиках данных с временным разрешением, указывая на различия в участвующих межмолекулярных процессах.

Время жизни флуоресценции ( τ ) флуорофора — это характерное время, в течение которого молекула находится в возбужденном состоянии перед возвращением в основное состояние. Представляя затухание флуоресценции в упрощенной единственной экспоненциальной форме после короткого импульса возбуждающего света, интенсивность флуоресценции как функция времени ( t ) определяется уравнением:

I (t) = I0 exp (-t / τ )

, где I (0) — начальная интенсивность излучения флуоресценции сразу после импульса возбуждающего света, а I (t) — интенсивность флуоресценции, измеренная в момент времени t .Время жизни флуоресценции ( τ ) определяется как время, необходимое для уменьшения интенсивности до 1 / e от ее начального значения (приблизительно 37 процентов от I (0) ; Рисунок 10 (a)), и составляет величина, обратная константе скорости затухания флуоресценции из возбужденного состояния в основное.

Основным общим преимуществом измерений FRET с временным разрешением по сравнению с установившимся режимом является то, что расстояние разделения донор-акцептор может быть нанесено на карту с большей количественной точностью.Это происходит отчасти потому, что время жизни флуоресценции не зависит от локальной интенсивности или концентрации и в значительной степени не зависит от фотообесцвечивания флуорофоров. Однако времена жизни флуоресценции очень чувствительны к среде флуорофора, и даже молекулы со сходными спектрами могут проявлять разные времена жизни в разных условиях окружающей среды. Поскольку рассеяние не влияет на время жизни флуорофора, измерения изменения времени жизни могут предоставить информацию, которая конкретно связана с локальными молекулярными процессами.

Срок службы флуорофора может быть изменен множеством переменных в локальном микроокружении, включая такие факторы, как гидрофобность, концентрация кислорода, ионная сила других компонентов среды, связывание с макромолекулами и близость к молекулам акцептора, которые могут истощать возбужденное состояние. состояние за счет резонансной передачи энергии. Значительным практическим преимуществом является то, что измерения времени жизни могут служить абсолютными индикаторами молекулярных взаимодействий и не зависят от концентрации флуорофора.

Два общих метода, обычно используемых для измерения времени жизни флуоресцентных ламп, классифицируются как во временной области ( в импульсном режиме , см. Рисунок 10 (а)) и в частотной области (также называемый с фазовым разрешением ; рисунок 10 (б)) методы. При измерении срока службы во временной области используются источники света с импульсным возбуждением, а время жизни флуоресценции получают путем прямого измерения сигнала излучения или регистрации с помощью счета фотонов. Подход с частотной областью использует синусоидальную модуляцию источника возбуждающего света (полученную из импульсных или модулированных лазерных систем), а время жизни определяется по фазовому сдвигу и глубине демодуляции сигнала флуоресцентного излучения.Каждый из этих подходов к визуализации времени жизни флуоресценции имеет определенные преимущества и недостатки, и оба широко применяются в традиционной широкопольной, конфокальной и многофотонной микроскопии.

На рисунке 10 показаны схематические диаграммы, представляющие методы временной и частотной областей для определения времени жизни флуоресценции. В подходе во временной области (рис. 10 (а)) образец возбуждается коротким импульсом лазерного света, длительность которого намного короче, чем время жизни возбужденных частиц, и измеряется экспоненциальный профиль затухания как функция времени.Затухание флуоресценции обычно является моноэкспоненциальной функцией для одного флуорофора, но может иметь гораздо более сложный характер, если возбужденное состояние имеет многочисленные пути релаксации, доступные в окружающей среде. Синусоидально модулированный свет от лазера непрерывного действия, соединенного с акустооптическим модулятором, используется для возбуждения флуорофора в экспериментах в частотной области (рис. 10 (b)). Результирующее флуоресцентное излучение модулируется синусоидально на той же частоте, что и возбуждение, но сопровождается фазовым сдвигом и уменьшением глубины модуляции.В случае однократного экспоненциального затухания время жизни флуоресценции можно рассчитать, определив либо степень фазового сдвига ( φ ), либо коэффициент модуляции ( M ), используя уравнения, представленные на рисунке 10 (b). Если два значения идентичны, затухание флуоресценции действительно состоит из одной экспоненциальной функции. Когда присутствует более одного флуоресцентного вещества (или один флуорофор находится в сложной среде), фазовый сдвиг и время жизни модуляции следует оценивать в широком диапазоне частот.

Метод измерения времени жизни флуоресценции во временной области в основном основан на подсчете одиночных фотонов и требует системы детектирования с достаточным временным разрешением для сбора почти 100 процентов фотонов, генерируемых каждым импульсом возбуждения. Хотя методы с фазовым разрешением относительно менее требовательны в исполнении, они, как правило, не так чувствительны, как метод подсчета фотонов. Когда фазовая модуляция используется для разрешения сложных времен жизни мультифлуорофоров, длительное время воздействия повреждающего возбуждающего освещения может оказаться чрезмерным для некоторых образцов, а также может не обеспечить достаточного временного разрешения для процессов с живыми клетками.Предпочтительный метод зависит как от информации, необходимой для исследования, так и от типа исследуемого образца.

Измерения времени жизни флуоресценции оказались чувствительным индикатором FRET и имеют особые преимущества при исследованиях живых клеток из-за независимости измерений времени жизни от таких факторов, как концентрация и длина светового пути, которые трудно контролировать в живых образцах. Основное преимущество проведения FRET-исследований с помощью измерения времени жизни флуоресценции заключается в том, что можно различать перенос энергии даже между донорно-акцепторными парами с аналогичными спектрами излучения.Когда время жизни флуоресценции измеряется напрямую (в отличие от использования значений в установившемся состоянии), определение FRET возможно без фотодеструкции донорных или акцепторных флуорофоров. Поскольку FRET уменьшает время жизни флуоресценции донорной молекулы за счет передачи энергии акцептору, прямое сравнение времени жизни донора в присутствии акцептора ( τ (DA) ) с временем жизни в отсутствие акцептора ( τ ( D) ), позволяет вычислять значение эффективности FRET ( E (T) ) для каждого пикселя изображения.

В зависимости от метода измерения времени жизни флуоресценции требуют, чтобы образец подвергался воздействию либо высокочастотных повторяющихся импульсов возбуждающего света, либо непрерывного синусоидально модулированного света. В исследованиях с живыми клетками всегда необходимо оценивать эффект интенсивного освещения. Независимо от метода, эталонное время жизни донора без акцептора должно быть определено в экспериментальных условиях, идентичных условиям измерения донор-акцептор.Одним из способов достижения этого с одним образцом является измерение времени жизни только донора после фотообесцвечивания акцептора после эксперимента по передаче энергии.

Выводы

В биологических исследованиях наиболее распространенным применением флуоресцентного резонансного переноса энергии является измерение расстояний между двумя участками макромолекулы (обычно белка или нуклеиновой кислоты) или исследование взаимодействия in vivo между биомолекулярными объектами.Белки могут быть помечены синтетическими флуорохромами или иммунофлуоресцентными флуорофорами, которые служат донором и акцептором, но достижения в генетике флуоресцентных белков теперь позволяют исследователям маркировать определенные целевые белки множеством биологических флуорофоров, имеющих разные спектральные характеристики. Во многих случаях аминокислота триптофан используется в качестве внутреннего донорного флуорофора, который может быть связан с любым количеством внешних зондов, выступающих в качестве акцептора.

Если макромолекулы помечены одним донором и акцептором, а расстояние между двумя флуорохромами не изменяется в течение времени жизни возбужденного состояния донора, то расстояние между зондами можно определить по эффективности передачи энергии в установившемся состоянии. измерения, как описано выше.В случаях, когда расстояние между донором и акцептором колеблется вокруг кривой распределения, например, белковые сборки, мембраны, одноцепочечные нуклеиновые кислоты или развернутые белки (см. Сценарии, представленные на рисунке 11), FRET все еще можно использовать для изучения явлений, но предпочтительны измерения срока службы с временным разрешением. Некоторые биологические применения, которые попадают в оба случая, показаны на рисунке 11, включая конформационные изменения, диссоциацию или гидролиз, слияние мембраноподобных липидных везикул и взаимодействия лиганд-рецептор.

Хотя для измерения резонансного переноса энергии флуоресценции в оптическом микроскопе доступны различные методы, ни один из них не лишен недостатков. Некоторые методы требуют более сложных и дорогостоящих инструментов, в то время как другие основаны на предположениях, которые необходимо тщательно проверять. Некоторые подходы подходят для фиксированных образцов, но не могут применяться к системам живых клеток, в то время как другие методы должны включать значительные корректирующие вычисления или алгоритмы анализа данных.Однако несомненно, что FRET-анализ показывает большие перспективы для дальнейшего развития полезности и объема биологических приложений. В последние годы произошли драматические улучшения в инструментарии, особенно в отношении методов с временным разрешением.

Измерения времени жизни флуоресценции, которые раньше выполнялись крайне сложно, теперь поддерживаются зрелыми пикосекундными и наносекундными технологиями. Успехи в разработке флуоресцентных зондов позволили получить более мелкие и более стабильные молекулы с новыми механизмами прикрепления к биологическим мишеням.Были также разработаны флуорофоры с широким диапазоном времени жизни в собственном возбужденном состоянии, и значительные усилия прилагаются к развитию большего разнообразия генетических вариаций флуоресцентных белков. Совершенно новые классы флуоресцентных материалов, многие из которых меньше, чем предыдущие флуорофоры, и позволяют оценивать молекулярные взаимодействия на меньших расстояниях разделения, обещают улучшить универсальность мечения и привести к новым применениям метода FRET.

Соавторы

Брайан Херман и Виктория Э.Centonze Frohlich — Департамент клеточной и структурной биологии, Научный центр здравоохранения Техасского университета, 7703 Floyd Curl Drive, San Antonio, Texas 78229.

Joseph R. Lakowicz — Центр флуоресцентной спектроскопии, Департамент биохимии и молекулярной биологии, Университет Мэриленда и Институт биотехнологии Университета Мэриленда (UMBI), 725 West Lombard Street, Baltimore, Maryland 21201.

Thomas J. Fellers и Michael W.Дэвидсон — Национальная лаборатория сильных магнитных полей, 1800 Ист. Пол Дирак, доктор, Университет штата Флорида, Таллахасси, Флорида, 32310.

Флуоресцентный резонансный перенос энергии FRET — Примечание 1.2 | Thermo Fisher Scientific

Флуоресцентный резонансный перенос энергии (FRET) — это зависящее от расстояния взаимодействие между электронными возбужденными состояниями двух молекул красителя, при котором возбуждение передается от молекулы-донора к молекуле-акцептору без испускания фотона .Эффективность FRET зависит от обратной шестой степени межмолекулярного разделения, что делает его полезным на расстояниях, сопоставимых с размерами биологических макромолекул. Таким образом, FRET — важный метод исследования множества биологических явлений, которые вызывают изменения в молекулярной близости. Когда FRET используется в качестве механизма контраста, совместная локализация белков и других молекул может быть отображена с пространственным разрешением, выходящим за пределы традиционной оптической микроскопии.

Основные условия для FRET

  • Донорные и акцепторные молекулы должны находиться в непосредственной близости (обычно 10–100 Å).
  • Спектр поглощения акцептора должен перекрывать спектр излучения флуоресценции донора ( Рисунок 1 ).
  • Ориентации диполей донорного и акцепторного переходов должны быть примерно параллельны.


Рис. 1.
Схематическое изображение интеграла перекрытия спектров FRET.

Радиус Фёрстера

Расстояние, на котором передача энергии эффективна на 50% (т.е. 50% возбужденных доноров деактивируется FRET), определяется радиусом Фёрстера (R 0 ). Величина R 0 зависит от спектральных свойств донорных и акцепторных красителей ( Таблица 1 ):

Таблица 1. Типичные значения R
0 9018 9018 9018 9018 9018 9018 9018 9018 ED4 ED4
Донор Акцептор R 0 (Å)
Флуоресцеин Тетраметилродамин 55
IAEDANS Флуоресцеин 46
44
BODIPY FL BODIPY FL 57
Флуоресцеин QSY 7 и QSY 9 красители 61

9000 Пары донор / акцептор

Избранные приложения FRET

Основы FRET-микроскопии | Nikon’s MicroscopyU

Считается, что в живых клетках динамические взаимодействия между белками играют ключевую роль в регулировании многих путей передачи сигналов, а также вносят вклад в широкий спектр других критических процессов.В прошлом подходы классической биохимии к выяснению механизма таких взаимодействий были обычным явлением, но слабые или временные взаимодействия, которые могут происходить в естественной клеточной среде, обычно прозрачны для этих методов. Например, совместная локализация предполагаемых белковых партнеров с использованием иммунофлуоресцентной микроскопии в фиксированных клетках была популярным методом исследования взаимодействий in situ , и на основе этого метода были представлены многочисленные литературные отчеты.Однако, поскольку разрешение флуоресцентного микроскопа в несколько сотен раз меньше размера типичного белка, совместная локализация часто приводит к сомнительным результатам. Прекрасная аналогия состоит в том, что флуоресцентная микроскопия дает информацию, эквивалентную знанию того, что два студента присутствуют в большом лекционном зале. Он не предлагает разрешения, необходимого для определения того, находятся ли студенты в одном классе или, что еще лучше, сидят ли они за соседними партами.

Рисунок 1 — Фёрстеровский резонансный перенос энергии Диаграмма Яблонски

Типичные методы флуоресцентной микроскопии основаны на поглощении флуорофором света на одной длине волны (возбуждение) с последующим испусканием вторичной флуоресценции на более длинной длине волны.Длины волн возбуждения и излучения часто отделены друг от друга на десятки и сотни нанометров. Мечение клеточных компонентов, таких как ядра, митохондрии, цитоскелет, аппарат Гольджи и мембраны, специфическими флуорофорами позволяет их локализовать в фиксированных и живых препаратах. Путем одновременного мечения нескольких субклеточных структур отдельными флуорофорами, имеющими отдельные спектры возбуждения и испускания, можно использовать специальные комбинации флуоресцентных фильтров для изучения близости меченых молекул в пределах одной клетки или участка ткани.При использовании этого метода молекулы, которые расположены ближе друг к другу, чем предел оптического разрешения, по-видимому, совпадают (и говорят, что совмещают ). Эта очевидная пространственная близость подразумевает, что молекулярная ассоциация возможна. В большинстве случаев, однако, нормального разрешения флуоресцентного микроскопа с ограничением дифракции недостаточно, чтобы определить, действительно ли имеет место взаимодействие между биомолекулами.

Измерения совместной локализации в лучшем случае наводят на размышления, а в худшем — вводят в заблуждение, особенно с учетом того, что многие сигнальные пути используют одну и ту же клеточную структуру, как, например, покрытые клатрином ямки, которые используются для интернализации многих рецепторных комплексов.Знание о том, что две молекулы или белки на самом деле являются смежными, а не просто находятся в одном и том же соседстве, обеспечивает значительно более надежное определение их потенциала для взаимодействия. Проверенная временем методика электронной микроскопии имеет достаточное разрешение для удовлетворения требований высокоточной локализации, но просто не имеет точной методологии маркировки, необходимой для получения надежных результатов. Кроме того, многие методы совместной локализации обычно применяются для использования в фиксированных клетках, что исключает очень желательные динамические измерения, достижимые с помощью анализов в живых клетках.Визуализация флуоресценции с использованием многоцветных флуоресцентных белков позволяет легко проводить эксперименты с живыми клетками, которые необходимы для анализа переходного взаимодействия, но этот подход страдает из-за относительно низкого пространственного разрешения, ограниченного примерно 200 нанометрами.

Ограничения в определении пространственной близости белковых молекул можно преодолеть, применяя методы микроскопии Фёрстера (или флуоресценции) с резонансным переносом энергии ( FRET ). FRET возникает между двумя правильно расположенными флуорофорами только тогда, когда расстояние между ними составляет от 8 до 10 нанометров или меньше.Таким образом, FRET хорошо подходит для исследования белковых взаимодействий, которые происходят между двумя молекулами, расположенными на расстоянии нескольких нанометров друг от друга. За последние десять лет подходы FRET приобрели популярность из-за роста приложений, требующих генетического нацеливания на определенные белки и пептиды с использованием слияния с зеленым флуоресцентным белком ( GFP ) и его мутантными производными. FRET между двумя спектрально различными флуоресцентными белками (известный как FP-FRET ) широко применяется для двух совершенно разных экспериментальных методик, как обсуждается ниже.Представленный в Рис. 1 — это энергетическая диаграмма Яблонского, иллюстрирующая связанные переходы возбужденного состояния между испусканием донора и поглощением акцептора в FRET. Абсорбционные и эмиссионные переходы представлены прямыми вертикальными стрелками (синими, зелеными и красными), а колебательная релаксация обозначена волнистыми желтыми стрелками. Связанные переходы показаны пунктирными линиями, что указывает на их правильное расположение на диаграмме Яблонского, если они возникли в результате опосредованных фотонами электронных переходов.В присутствии подходящего акцептора донорный флуорофор может передавать энергию возбужденного состояния непосредственно акцептору, не испуская фотон (показано фиолетовой стрелкой на рис. , ). Результирующая флуоресценция , сенсибилизированная, эмиссионная имеет характеристики, аналогичные спектру эмиссии акцептора.

Одним из основных препятствий на пути широкого внедрения исследований FRET в живых клетках было отсутствие подходящих методов мечения конкретных внутриклеточных белков соответствующими флуорофорами.Недавняя разработка флуоресцентных белков, обладающих широким спектром спектральных профилей, и возрастающая сложность белковых химер (гибридных, а также биосенсоров) привели к появлению ряда потенциальных пар флуоресцентных белков, которые можно использовать в экспериментах FRET. Применение флуоресцентных белков к FRET включает либо интеграцию выбранной пары в биосенсор (единая генетически закодированная конструкция), либо проведение межмолекулярных измерений между двумя отдельными белками, каждый из которых слит с другим флуоресцентным белком.Последний подход был использован для визуализации различных белковых взаимодействий, включая олигомеризацию рецепторов и выяснение функций факторов транскрипции. Однако проведение FRET-анализов на независимо экспрессируемых химерных белках намного сложнее из-за изменчивой стехиометрии, которая неизбежно возникает, когда отдельные флуоресцентные объекты экспрессируются в живых клетках. Независимо от сложности, эксперименты такого рода могут дать информативные результаты, если установлены соответствующие элементы управления и исследование проводится с высокой точностью.

Флуоресцентные белковые биосенсоры

Флуоресцентные белковые биосенсоры нашли широкое применение при составлении отчетов о разнообразных внутриклеточных процессах. Благодаря творческому слиянию пар флуоресцентных белков с биополимерами, которые выполняют критически важные функции, связанные с различными аспектами физиологической передачи сигналов, ученые-исследователи разработали множество новых молекулярных зондов, которые можно использовать для оптической визуализации живых клеток таких важных процессов, как индукция кальциевой волны, цикличность. эффекты посланника нуклеотидов, изменения pH, колебания мембранного потенциала, фосфорилирование и действие внутриклеточной протеазы.Альтернативная, но весьма полезная стратегия конструирования биосенсора включает модификации самой структуры основной цепи флуоресцентного белка, либо для разделения пептида на отдельные единицы, которые объединяются in vivo для получения флуоресценции (метод, названный Bi -Molecular F luorescence C oplementation; BiFC ) или для соединения природных амино- и карбоксиконцев вместе и создания сайта встраивания в молекуле для сенсорного пептида.

Первым флуоресцентным белковым биосенсором был индикатор кальция под названием cameleon , созданный путем смещения белка кальмодулина и кальций-кальмодулин-связывающего домена киназы легкой цепи миозина (домен M13 ) между усиленными синими и зелеными флуоресцентными белками ( EBFP ). и EGFP ). В присутствии возрастающих уровней внутриклеточного кальция домен M13 связывает пептид кальмодулин, вызывая увеличение FRET между флуоресцентными белками.К сожалению, этому датчику мешал очень низкий динамический диапазон (увеличение флуоресценции в 1,6 раза), и его было трудно визуализировать из-за недостаточной яркости и плохой фотостабильности EBFP. Улучшенные версии с использованием той же матрицы включали голубой и желтый варианты ECFP и EYFP для получения более высоких уровней сигнала, и даже лучшие результаты были получены, когда производные YFP ​​(названные camgaroos ) были получены путем вставки кальций-чувствительных пептидов в начало седьмой бета -цепи в основной цепи флуоресцентного белка.Сенсорные пептиды, расположенные в этом необычном положении, довольно хорошо переносятся с точки зрения поддержания высокого уровня флуоресценции. Еще одна стратегия использует преимущества уникальной бочкообразной структуры, характерной для флуоресцентных белков, для изменения конфигурации концов белка путем связывания естественных концов N и C и создания нового стартового кодона в одном из нескольких мест в центральной области строение (обычно в петлях). Эти структурно модифицированные производные, названные циркулярно пермутированными флуоресцентными белками, могут быть слиты с кальмодулином и M13 для получения превосходных биосенсоров кальция.

Рисунок 2 — Флуоресцентный белковый биосенсор FRET для определения протеазной активности

За биосенсорами кальция быстро последовали генетические индикаторы pH, фосфорилирования и протеазной активности. Для адаптации флуоресцентных белков в качестве датчиков pH можно использовать два общих подхода. Первый основан на чувствительности флуоресценции EGFP (pKa = 5,9) и EYFP (pKa = 6,5) к кислой среде в сочетании с относительной нечувствительностью других белков, таких как ECFP (pKa = 4.7) или DsRed (pKa = 4,5). Слияние EGFP или EYFP с менее чувствительным флуоресцентным белком создает логометрический зонд, который можно использовать для измерения кислотности внутриклеточных компартментов. Второй подход основан на изменениях протонирования нативного (дикого типа) GFP, которые приводят к сдвигу бимодальных спектральных профилей нативного белка. Класс зондов под названием pHluorins , производных от wtGFP, демонстрирует сдвиг пика возбуждения с 470 до 410 нанометров при снижении pH.Также были разработаны датчики pH с двойным излучением, у которых есть пики в зеленой и синей областях спектра. Хотя биосенсоры фосфорилирования не могут сообщать об активности киназы в реальном времени, они состоят из пептида, содержащего мотив фосфорилирования из конкретной киназы, и связывающего домена для фосфопептида, зажатого между двумя флуоресцентными белками, способными к FRET. Когда биосенсор фосфорилируется киназой, домен связывания фосфопептида связывается с фосфорилированной последовательностью, таким образом вызывая или разрушая FRET.Доказано, что эта простая стратегия позволяет создавать надежные и высокоспецифичные биосенсоры. Как и у многих других биосенсоров, основным недостатком является уменьшенный динамический диапазон.

Возможно, наиболее широко используемая конструкция биосенсора для скрининга новых или улучшенных пар FRET включает анализ протеазного расщепления (см. , рис. 2, ). Простой мотив состоит из двух флуоресцентных белков, связанных вместе коротким пептидом, который содержит консенсусный сайт расщепления протеазой. В общем, сенсор демонстрирует очень сильную передачу энергии, которая полностью исчезает при расщеплении линкерной последовательности.Поскольку метод обычно имеет высокие уровни динамического диапазона, его можно использовать для скрининга новых голубых и зеленых доноров FRET с желтыми, оранжевыми и красными акцепторами. Самое большое семейство протеазных биосенсоров включает сайт расщепления, чувствительный к одной из протеаз семейства каспаз, что позволяет исследовать датчик во время индукции апоптоза. За последние несколько лет появилось большое количество новых биосенсоров, использующих как сенсибилизированные флуоресцентные белки, так и пары FRET. Несмотря на сохраняющиеся ограничения динамического диапазона датчиков FRET, использующих производные ECFP и EYFP, эта стратегия получила широкое распространение, вероятно, из-за простоты ратиометрических измерений и легкости конструкции датчика.Без сомнения, появятся новые стратегии с использованием более совершенных комбинаций флуоресцентных белков, которые служат для увеличения динамического диапазона и других свойств этого очень полезного класса зондов.

Основные принципы FRET

Фундаментальный механизм FRET включает в себя донорный флуорофор в возбужденном электронном состоянии, который может передавать свою энергию возбуждения соседнему акцепторному флуорофору (или хромофору) безызлучательным образом через диполь-дипольные взаимодействия на больших расстояниях.Теория, поддерживающая передачу энергии, основана на концепции рассмотрения возбужденного флуорофора как колеблющегося диполя, который может подвергаться обмену энергией со вторым диполем, имеющим аналогичную резонансную частоту. В этом отношении резонансная передача энергии аналогична поведению связанных генераторов, таких как пара камертонов, колеблющихся на той же частоте, или радиоантенна. Напротив, радиационная передача энергии требует испускания и повторного поглощения фотона и зависит от физических размеров и оптических свойств образца, а также от геометрии контейнера и путей волнового фронта.В отличие от радиационных механизмов, резонансный перенос энергии может дать значительный объем структурной информации о донорно-акцепторной паре.

Резонансная передача энергии нечувствительна к окружающей оболочке растворителя флуорофора и, таким образом, дает молекулярную информацию, уникальную по сравнению с той, которая обнаруживается с помощью зависящих от растворителя событий, таких как гашение флуоресценции, реакции возбужденного состояния, релаксация растворителя или измерения анизотропии. Основное влияние растворителя на флуорофоры, участвующие в резонансной передаче энергии, — это влияние на спектральные свойства донора и акцептора.Безызлучательный перенос энергии происходит на гораздо больших расстояниях, чем краткосрочные эффекты растворителя, и диэлектрическая природа компонентов (растворителя и макромолекулы хозяина), расположенных между задействованными флуорофорами, очень мало влияет на эффективность резонансной передачи энергии, которая зависит в первую очередь от расстояние между донорным и акцепторным флуорофором.

Рисунок 3 — Переменные Фёрстера расстояние и коэффициент ориентации в FRET

Феномен FRET не опосредован испусканием фотонов и, более того, даже не требует, чтобы акцепторный хромофор был флуоресцентным.Однако в большинстве приложений и донор, и акцептор являются флуоресцентными, и возникновение передачи энергии проявляется в тушении донорной флуоресценции и уменьшении времени жизни флуоресценции, сопровождаемом также увеличением эмиссии флуоресценции акцептора. Теория резонансного переноса энергии была первоначально разработана Теодором Фёрстером и недавно была названа его именем в честь его вклада. Теория Фёрстера показывает, что эффективность FRET ( E ) изменяется как обратная шестая степень расстояния между двумя молекулами (обозначается r ):

Формула 1 — Эффективность FRET

E FRET = 1 / [1 + (r / R 0 ) 6 ]

, где R (0) — характеристическое расстояние, при котором эффективность FRET составляет 50 процентов, которое можно рассчитать для любой пары флуоресцентных молекул (эта переменная также называется радиусом Ферстера и более подробно обсуждается ниже).Эффективность FRET теоретической пары флуорофоров (усиленные голубые и желтые флуоресцентные белки) графически продемонстрирована на рис. 3 (а) . Из-за обратной зависимости шестой степени от расстояния между двумя молекулами ( r ) кривая имеет очень резкий спад. Для расстояний меньше R (0) эффективность FRET близка к максимальной, тогда как для расстояний больше R (0) эффективность быстро приближается к нулю. Полезный диапазон для измерения FRET обозначен красной заштрихованной областью на рисунке 3 (a) с пределами 0.5 и 1,5 x R (0) . FRET может эффективно использоваться в качестве молекулярной линейки для расстояний, близких к R (0) , и действительно FRET был адаптирован для таких целей в структурной биологии с использованием прецизионных спектроскопических подходов. Однако для большинства приложений в клеточной биологии доступные отношения сигнал / шум ограничивают эксперименты FRET более двоичным считыванием. Фактически, измерение часто может различать только с высоким FRET и с низким FRET или просто между наличием и отсутствием FRET.

Как обсуждалось ранее, R (0) можно легко вычислить для любой пары флуоресцентных молекул. Значение R (0) в водном (или буферном) растворе определяется довольно простым уравнением с хорошо установленными входными параметрами:

Формула 2 — R (0)

R 0 = [2,8 x 10 17 × Κ 2 × Q D D × J (λ)] 1/6 нм

, где Κ (2) или в квадрате каппа представляет коэффициент ориентации между двумя флуорофорными диполями (см. {4} dλ $$

Хотя математика может показаться сложной, большинство параметров являются константами, которые легко найти в литературе.Два наиболее важных члена, которые обычно требуют дальнейшего объяснения, — это Κ (2) и J (λ) , интеграл перекрытия. Переменная угла ориентации ( Κ (2) ) просто указывает, что связь FRET зависит от угла между двумя флуорофорами во многом так же, как положение радиоантенны может влиять на ее прием. Если донор и акцептор выровнены параллельно друг другу, эффективность FRET будет выше, чем если бы они были ориентированы перпендикулярно.Эта степень совмещения определяет Κ (2) . Хотя Κ (2) может изменяться от нуля до 4, обычно предполагается, что оно равно 2/3, что является средним значением, проинтегрированным по всем возможным углам. Почти для любой реалистичной ситуации Κ (2) близко к 2/3, и обычно исследователь ничего не может сделать, чтобы отрегулировать это значение (хотя некоторые из них жестко прикрепили флуоресцентные белки к интересующим их целевым белкам, которые может привести к драматическим эффектам).Интеграл перекрытия, J (λ) , представляет собой область перекрытия между двумя спектрами, как показано на рис. 4 . Другими параметрами, которые могут влиять на FRET, являются квантовый выход донора и коэффициент экстинкции акцептора. Таким образом, чтобы максимизировать сигнал FRET, исследователь должен выбрать донор с наивысшим квантовым выходом, наиболее поглощающий акцептор и флуорофоры, имеющие значительное перекрытие в своих спектральных профилях. Эта теория неоднократно подтверждалась экспериментом, и нет никаких других механизмов для максимизации FRET для невыровненных флуоресцентных зондов.

Рисунок 4 — Интеграл спектрального перекрытия возбуждения и излучения

Следует отметить, что каждый из рассмотренных выше параметров влияет на расчет радиуса Ферстера только в шестой степени. Таким образом, удвоение квантового выхода донора приводит к изменению R (0) только на 12,5%. Поскольку почти все флуорофоры, используемые в экспериментах по визуализации FRET, имеют высокие квантовые выходы (более 0,5) и коэффициенты экстинкции (более 50000), диапазон возможных значений радиуса Ферстера ограничен между 4 и 6 нанометрами, а большинство пар FRET имеют средний значение R (0) ~ 5 нм.Учитывая, что эффективность FRET сильно зависит от расстояния, разделяющего пару FRET, а также от относительной ориентации флуорофоров, FRET можно использовать для обнаружения изменений белок-белковых взаимодействий, которые возникают из-за изменений аффинности между двумя белками или изменений в подтверждение их привязки. Стоит повторить, что для большинства приложений визуализации FRET в клеточной биологии эксперименты обычно различают только два состояния (FRET и отсутствие FRET), и необходима дополнительная информация, чтобы помочь в молекулярной интерпретации наблюдаемых изменений FRET.

Факторы, влияющие на измерения FRET

На практике широкий спектр проблем может усложнить и / или поставить под угрозу измерения FRET, что в конечном итоге приведет к неоднозначным или бессмысленным результатам. Одна из основных проблем заключается в том, что донорные и акцепторные флуорофоры могут иметь существенно разные уровни яркости при совместном отображении. Хотя теоретически это несоответствие не должно быть проблемой, однако на практике, поскольку большинство инструментов могут измерять только ограниченный динамический диапазон, визуализация с использованием двойного флуорофора может привести к тому, что один канал будет насыщенным (для более яркого флуорофора), в то время как другой канал будет доминировать с систематическим шум (для диммерного флуорофора).Таким образом, по возможности лучше использовать донор и акцептор сопоставимой яркости.

Еще одним фактором, который может ограничить обнаружение FRET, является стехиометрия донор-акцептор, которая находится вне диапазона от 10: 1 до 1:10. Этот фактор может быть серьезным ограничением в измерениях FRET белок-белковых взаимодействий, в которых один партнер может иметь избыточную концентрацию. Основная проблема — измерение небольшого уровня FRET на фоне флуоресцентных меток, которые не проходят FRET.В связи с тем, что на самом деле нет ничего, что можно было бы сделать для улучшения этой ситуации, множество возможных экспериментов по взаимодействию белок-белок, попадающих в эту категорию, просто не подходят для исследования методами FRET. Для описанных выше флуоресцентных белковых биосенсоров, которые сконструированы только с одним донором и акцептором, стехиометрия является фиксированной и гарантированно составляет 1: 1; таким образом, эта проблема никогда не возникает, и уровень сигнала остается постоянным, независимо от концентрации биосенсора.

Наличие сквозного прохождения (также называемого перекрестными помехами и кроссовером ) и перекрестное возбуждение между спектрально перекрывающимися флуорофорами также являются важными проблемами, которые могут затруднить исследования FRET (см. , рис. 5, ). В некоторых случаях акцептор может быть непосредственно возбужден светом в диапазоне длин волн, выбранном для возбуждения донора (, рис. 5 (а), ). Кроме того, флуоресценция от донора может просачиваться в канал обнаружения для флуоресценции акцептора, особенно когда спектральные профили излучения донора и акцептора значительно перекрываются (, рис. 5 (b), ).Поскольку эти два источника перекрестных помех возникают из-за фотофизики органических флуорофоров и наверняка будут присутствовать для любой пары FRET, их необходимо учитывать при измерении FRET. Выбор флуорофоров, которые хорошо разделены спектрально, является отличным механизмом для уменьшения перекрестных помех. Однако в большинстве случаев увеличенное спектральное разделение также уменьшает интеграл перекрытия ( J (λ) ), что на практике обычно приводит к снижению способности обнаруживать сигнал FRET.

Наконец, уровень сигнала FRET может быть уменьшен, если два флуорофора не выровнены должным образом (например, имея значение Κ (2) приблизительно равное нулю) или если они просто не расположены в пределах радиуса Фёрстера. (более 6 нанометров). Например, если два меченых белка взаимодействуют, но флуоресцентные метки расположены на противоположных сторонах комплекса, то может не быть обнаруживаемого сигнала FRET, даже если интересующие белки связаны.В общей практике этот тип ложноотрицательных довольно распространен, особенно с флуоресцентными белками-партнерами FRET. Часто требуется несколько стратегий мечения, прежде чем будет обнаружен достаточный и надежный сигнал FRET. Однако каждую из описанных выше проблем можно смягчить (или частично) путем осознанного выбора пары флуорофоров, которая будет использоваться до создания векторных конструкций или проведения экспериментов по синтетическому мечению.

Рисунок 5 — Спектральное просвечивание (перекрестные помехи) в парах CFP-YFP FRET

Представлено в Рис. 5 — это перекрытие спектральных профилей возбуждения и испускания ECFP и mVenus, в настоящее время одной из наиболее предпочтительных пар флуоресцентных белков для исследований FRET.Эти два белка демонстрируют значительное перекрытие как в спектрах возбуждения (, фиг. 5 (а), ), так и в спектрах излучения (, фиг. 5 (b), ). Прямое возбуждение акцептора FRET (mVenus; красная кривая) может быть значительным в зависимости от длины волны, используемой для возбуждения донора (ECFP; голубая кривая или mCerulean; синяя кривая) из-за более высокого коэффициента экстинкции желтого белка по сравнению с голубые белки. Это перекрытие особенно проблематично, когда ECFP используется в качестве донора и может быть частично компенсировано использованием вариантов CFP с высокими коэффициентами экстинкции, таких как mCerulean.Обратите внимание, что кривые возбуждения на рис. 5 (a) нарисованы в масштабе, чтобы отразить различия в коэффициенте экстинкции между желтым и голубым белками. Возбуждение на 458 нм создает гораздо более высокий уровень перекрестных помех возбуждения в мВенусе, чем при возбуждении на 405 или 440 нм. Широкий спектр излучения флуоресценции ECFP (, рис. 5 (b), ) демонстрирует значительное перекрытие по интенсивности во всей области излучения mVenus.

Методы FRET в приложениях клеточной биологии

Исследователи, использующие флуоресцентные белковые биосенсоры или пытающиеся сопоставить стехиометрию флуоресцентных зондов, слитых с отдельными взаимодействующими мишенями, должны использовать как можно больше различных методов анализа FRET, чтобы установить методологию для данного эксперимента.Такие усилия оправданы, потому что каждая из пар флуоресцентных белков FRET демонстрирует определенную патологию, которая усложняет ее использование, требуя четкого понимания параметров оптической микроскопии, применяемых для измерения относительно небольших разностей сигналов, производимых в большинстве анализов FRET. После того, как система и возможные результаты будут хорошо установлены, для текущих процедур можно использовать простейшие подходы. Список методов, разработанных для изображения FRET, довольно обширен.В целом, все существующие стратегии измерения FRET могут быть применены к экспериментам с флуоресцентными белками, но, исходя из практических соображений, пять общих подходов оказались особенно полезными:

  • Сенсибилизированная эмиссия — Двухканальная визуализация с использованием алгоритма, который корректирует перекрестные помехи возбуждения и эмиссии
  • Фотообесцвечивание акцептора — Также известный как декушение донора , этот метод измеряет повышенную эмиссию донора при фотообесцвечивании акцептора
  • Флуоресцентная микроскопия времени жизни (FLIM) — изменение времени жизни донора флуоресцентного белка (или другого флуорофора)
  • Спектральная визуализация — возбуждение на одной или двух длинах волн и измерение полных спектральных профилей донора и акцептора
  • Флуоресцентная поляризационная визуализация — Измеряйте поляризацию параллельно и перпендикулярно возбуждению с высоким отношением сигнал / шум

Каждый из перечисленных выше подходов FRET имеет свои сильные и слабые стороны.Например, с одной стороны, двухканальная визуализация — самый простой метод, но требует наиболее сложного набора элементов управления. С другой стороны, FLIM может дать однозначное измерение эффективности FRET, а инструменты доступны для интеграции в конфокальную систему Nikon A1 HD25 / A1R HD25.

Чувствительное излучение

Также обычно упоминается как двухцветная визуализация с элементами управления, сенсибилизированное излучение, пожалуй, самый простой метод визуализации FRET. Донорный флуорофор возбуждается определенной длиной волны (в широкоугольном или конфокальном микроскопе), и сигнал собирается с использованием фильтров излучения, выбранных для флуоресценции донора и флуоресценции акцептора.При (нереалистичном) отсутствии перекрестных помех между возбуждением и флуоресценцией двух флуорофоров сенсибилизированное излучение было бы идеальным методом. Однако перекрестные помехи между флуоресцентными белками представляют собой серьезную проблему, и обычно требуются обширные контрольные эксперименты, чтобы установить наличие или отсутствие FRET. Таким образом, при таком подходе сложно получить количественно точные данные FRET. Сенсибилизированное излучение относительно просто настроить на широкоугольном флуоресцентном микроскопе, доступном во многих лабораториях, но необходимые контрольные эксперименты требуют значительной обработки изображений для вычитания компонентов перекрестных помех, что значительно увеличивает уровень шума и неопределенность измерений.

Для сенсибилизированной эмиссионной FRET-визуализации были разработаны различные корректирующие подходы. Основная концепция включает использование различных комбинаций фильтров с несколькими образцами, которые содержат: только донор, только акцептор и предполагаемый образец FRET как с донором, так и с акцептором. Значения излучения из этих выборок позволяют исследователю определить величину ожидаемых перекрестных помех как в каналах возбуждения, так и в каналах излучения и вычесть их из измерения FRET.Теоретически этот подход работает хорошо, но, к сожалению, потребность в обработке изображений увеличивает уровень шума во всех изображениях. Таким образом, если сигнал FRET слабый, тогда может быть трудно измерить FRET с использованием этого подхода.

Рисунок 6 — Фотообесцвечивание сенсибилизированного излучения и акцептора FRET

Несмотря на упомянутые выше трудности, сенсибилизированные измерения излучения могут быть полезны для быстрых динамических экспериментов, в которых сигналы FRET велики из-за возможности одновременного получения обоих изображений.Сенсибилизированная эмиссия является особенно привлекательной техникой при исследовании флуоресцентных белковых биосенсоров, где динамический диапазон FRET велик, а стехиометрия донора и акцептора фиксирована в соотношении 1: 1. Хорошим примером является биосенсор протеазы, показанный на Рис. 2 . Эта химера была сконструирована так, чтобы иметь высокую эффективность FRET, которая снижается практически до нуля, когда пептидный линкер ферментативно расщепляется. Результатом является большое и легко поддающееся измерению изменение FRET, которое демонстрирует специфическую протеазную активность в данный момент времени и в определенной области внутри живой клетки.

Акцепторное фотообесцвечивание

Несмотря на то, что оно ограничено только одним измерением, фотообесцвечивание акцептора (или ослабление гашения донора) также является простым методом, который часто дает отличные результаты. Основная концепция использует тот факт, что флуоресценция донора гасится во время FRET, потому что часть энергии флуоресценции донора передается акцептору. Фотообесцвечивание акцепторного флуорофора необратимо устраняет эффект тушения и увеличивает уровень флуоресценции донора.Если FRET возникает между флуорофорами, флуоресценция донора должна увеличиваться при удалении акцептора. В общем, важно убедиться, что фотообесцвечивание акцептора не ухудшает флуоресценцию донора и чтобы акцептор фотообесцвечивался примерно до 10 процентов от своего первоначального значения. Оба эти ограничения легко выполняются с помощью лазерного сканирующего конфокального микроскопа, но также могут быть выполнены с помощью широкоугольных микроскопов или микроскопов с вращающимся диском, оснащенных специальной системой освещения.

Преимущество акцепторного фотообесцвечивания состоит в том, что он очень простой, количественный и выполняется с использованием только одного образца. Эффективность FRET может быть рассчитана путем вычитания интенсивности донора в присутствии акцептора из его интенсивности после фотообесцвечивания акцептора, а затем нормирования этого значения на интенсивность донора после отбеливания. Основным недостатком является то, что фотообесцвечивание акцептора является деструктивным и может использоваться только один раз на ячейку, что ограничивает его применение теми экспериментами, которые не связаны с динамическими измерениями.Кроме того, фотообесцвечивание — относительно медленный процесс, который часто занимает несколько минут или дольше. Тем не менее, почти всегда целесообразно выполнять измерение фотообесцвечивания акцептора в конце эксперимента, независимо от того, какие методы используются для анализа FRET.

Представлено в Рис. 6 являются примерами FRET-тестов сенсибилизированного излучения и фотообесцвечивания акцепторов с использованием визуализации живых клеток. Фиг. 6 (a) иллюстрирует эпителиальную клетку карциномы шейки матки человека (линия HeLa), экспрессирующую биосенсор верблюда, состоящий из mCerulean и mVenus, слитых вместе с промежуточным кальций-чувствительным пептидом, содержащим кальмодулин и домен M13 (описанный выше).Перед добавлением агента, индуцирующего кальций (иономицин), возбуждение клетки с помощью 440-нанометрового освещения вызывает голубую флуоресценцию, указывающую на отсутствие FRET между голубым и желтым флуоресцентными белками ( Рисунок 6 (a) ). После добавления иономицина временная двухцветная визуализация (сенсибилизированная эмиссия) регистрирует кальциевую волну, пересекающую цитоплазму, когда биосенсор реагирует увеличением уровня FRET между флуоресцентными белками ( рисунки 6 (b) и 6 (c) ) ; FRET — желто-красный псевдоцвет).Клетки почек африканской зеленой обезьяны (линия COS-7) на фиг.6 (d) — (f) были помечены синтетическими цианиновыми красителями, Cy3 ( фиг.6 (d), ; зеленый) и Cy5 ( фиг.6). (e) ; красный), конъюгированный с B-субъединицей холерного токсина и нацелен на плазматическую мембрану. Внутри мембраны непосредственная близость двух красителей обеспечивает высокий уровень FRET. Фотообесцвечивание Cy5 в выбранной области клетки (белый прямоугольник на рис. 6 (е) ) увеличивает расщепление донора (усиление зеленой флуоресценции на рис. 6 (f) ) в соответствующей области при просмотре флуоресценции в донорском канале. Только.

Флуоресцентная микроскопия для визуализации на протяжении всей жизни (FLIM)

Измерения срока службы на сегодняшний день являются наиболее строгим методом определения FRET; кроме того, они также менее подвержены артефактам перекрестных помех из-за того, что отслеживается только флуоресценция донора. Все флуоресцентные молекулы демонстрируют экспоненциальное затухание своей флуоресценции в наносекундном масштабе времени, и скорость этого затухания чувствительна к переменным окружающей среде, которые гасят флуоресценцию. Таким образом, основная концепция FLIM отчасти связана с концепцией фотообесцвечивания акцепторов.Флуоресценция донора гасится взаимодействием FRET, и степень гашения может быть определена путем измерения уменьшения времени затухания флуоресценции донора в присутствии FRET. Таким образом, FLIM дает однозначное значение эффективности FRET. Среди преимуществ комбинированных измерений FLIM-FRET — их нечувствительность к артефактам прямого акцепторного возбуждения, а также тот факт, что флуоресцентные доноры могут быть связаны с акцепторами, которые сами не являются флуоресцентными. Оба эти аспекта служат для увеличения числа полезных пар флуоресцентных белков FRET, доступных исследователям.

Рисунок 7 — Приложения FLIM и спектральной визуализации в FRET-микроскопии

FLIM имеет несколько ограничений, которые не позволяют ему быть доминирующим методом в визуализации FRET. В первую очередь, измерения в области наносекундного срока службы являются сложными, а оборудование является дорогостоящим в получении и обслуживании. Кроме того, этот тип сложного оборудования не является широко доступным. Кроме того, FLIM обычно относится к более медленным методологиям построения изображений, потенциально требующим нескольких минут для получения каждого изображения, что ограничивает его полезность во многих экспериментах с FRET.Эти ограничения могут быть сняты в будущем по мере разработки производителями более удобных и быстрых коммерческих систем «под ключ». Другим существенным недостатком является то, что время жизни флуоресцентных белков в живых клетках часто показывает многоэкспоненциальное затухание, что требует более всестороннего анализа данных для количественных анализов FRET. Более того, локальные факторы окружающей среды, такие как автофлуоресценция или изменение pH, также могут сократить измеряемое время жизни флуоресценции, что приведет к артефактам.Таким образом, следует проявлять большую осторожность при интерпретации данных FLIM-FRET в живых клетках.

Спектральная визуализация

Метод спектральной визуализации представляет собой разновидность метода обнаружения сенсибилизированного излучения FRET, но вместо сбора данных через два отдельных канала, весь спектр излучения, содержащий как донорную, так и акцепторную флуоресценцию, собирается при возбуждении донора. Запись всего спектра — типичный подход, используемый для спектроскопических экспериментов, но это относительно недавнее дополнение к инструментальной палитре широкопольной и конфокальной микроскопии.Концепция основана на предпосылке, что сбор всего спектра флуоресценции позволяет разделить перекрывающиеся спектры, используя не только пики излучения, но и различные формы спектральных хвостов. Собирая спектр как от донорного, так и от акцепторного флуорофора, можно определить относительные уровни донорной и акцепторной флуоресценции.

Метод построения спектральных изображений требует специального оборудования, но отличные системы доступны для многих коммерческих конфокальных микроскопов и могут быть добавлены к обычным флуоресцентным микроскопам по умеренной цене.Проведение количественного анализа уровня перекрестных помех из-за прямого возбуждения акцептора или использования двух длин волн возбуждения в конфокальной микроскопии позволяет точно определить количество FRET. Основным недостатком этого подхода является пониженное отношение сигнал / шум, связанное с получением полного спектра, а не с его сбором по двум каналам с помощью системы на основе фильтров. Однако по мере того, как разрабатываются и устанавливаются все больше коммерческих систем, применение спектральной визуализации в анализах FRET расширяется.В ближайшем будущем вполне возможно, что спектральная визуализация станет одним из основных методов проведения экспериментов по визуализации FRET.

Проиллюстрировано в . Рисунок 7 (a) — это изменения в спаде времени жизни донора (флуоресцентный белок mCerulean) псевдо-FRET биосенсора, состоящего из флуоресцентных белков mCerulean и mVenus, слитых вместе с линкером из 10 аминокислот. Синяя кривая спада показывает время жизни, наблюдаемое в клетках, экспрессирующих только mCerulean, тогда как красная кривая спада представляет время жизни mCerulean, полученное, когда клетки экспрессируют конкатенированные белки.Обратите внимание на уменьшение времени жизни mCerulean, когда белок участвует в резонансной передаче энергии. Область между кривыми представляет собой энергию, которая передается через FRET от mCerulean (донор) к mVenus (акцептор) в паре FRET. Профиль эмиссии от 450 до 650 нанометров mCerulean-mVenus в том же псевдобиосенсоре при возбуждении на 405 нанометрах в живых клетках изображен красной кривой на Рис. 7 (b) . Передача энергии от mCerulean к mVenus приводит к значительному пику излучения при 529 нанометрах (максимум излучения mVenus) с гораздо меньшим значением (примерно 25 процентов) на 475 нанометрах, максимальной длине волны излучения mCerulean.После фотообесцвечивания mVenus с помощью 514-нанометрового лазера и повторения спектрального сканирования профиль излучения смещается в сторону более низких длин волн и очень напоминает спектр mCerulean в отсутствие партнера FRET. Разница в интенсивностях на 475 и 529 нанометрах этих спектральных профилей связана с эффективностью FRET между связанными белками.

Построение изображения поляризационной анизотропии

Измерение поляризации флуоресценции дает особые преимущества для высококонтрастной дискриминации флуоресцентного белка FRET.Эта концепция основана на том факте, что при возбуждении поляризованным светом выбирается популяция флуоресцентных молекул, векторы поглощения которых выровнены параллельно вектору поляризации возбуждающего света. Сразу после возбуждения большая часть флуоресцентного излучения будет оставаться поляризованным параллельно возбуждению, так что флуоресценцию можно считать анизотропной с точки зрения поляризации. Анизотропия исчезнет, ​​если молекулы будут вращаться в течение наносекундного времени жизни флуоресценции.Однако, поскольку флуоресцентные белки имеют большие размеры и медленно вращаются, их флуоресценция не деполяризуется в значительной степени во время измерения. Если FRET возникает между двумя флуоресцентными белками, которые слегка смещены, то излучение поляризованной флуоресценции будет появляться под другим углом (от вектора возбуждения), что имитирует вращение флуоресцентного белка.

Рисунок 8 — Получение изображений FRET с поляризационной анизотропией

Основным достоинством этого подхода является простота измерения поляризации флуоресценции, параллельной и перпендикулярной вектору возбуждения, с высоким отношением сигнал-шум.Поскольку данные о поляризационной анизотропии могут быть получены быстро и с минимальными требованиями к обработке изображений, этот метод хорошо подходит для приложений при просмотре контента с высоким содержанием. Однако следует избегать прямого возбуждения акцептора, поскольку это может уменьшить донорный сигнал и уменьшить отношение сигнал / шум измерения. Кроме того, хотя этот метод превосходно распознает наличие и отсутствие FRET, он не подходит для различения сильного и слабого FRET.Наконец, поляризация может ухудшаться в объективах с высокой числовой апертурой, поэтому эксперименты с поляризованным FRET следует ограничивать получением изображений с помощью объективов, имеющих числовую апертуру 1,0 или меньше.

Представлено в Рисунок 8 — графическая иллюстрация поляризационной анизотропии с использованием флуоресцентных белков в качестве модельной системы. Когда случайно ориентированная популяция флуоресцентных белков (, рис. 8 (а), ) возбуждается линейно поляризованным светом (голубая волна), преимущественно возбуждаются только те молекулы, дипольный вектор поглощения которых ориентирован параллельно азимуту поляризации.Эмиссию правильно ориентированных флуоресцентных белков можно наблюдать как сигнал с помощью анализатора, который также параллелен вектору поляризации возбуждающего света (зеленая волна). Результирующая анизотропия, которая является индикатором степени ориентации, может быть определена путем измерения и сравнения интенсивности излучения с помощью вертикально и горизонтально ориентированных анализаторов. Уровень сигнала анизотропии будет уменьшаться, если флуоресцентный белок вращается в масштабе времени эксперимента ( рис. 8 (b), ) или если он передает энергию возбуждения из-за FRET соседнему белку ( рис. 8 (c) ), имеющему разная ориентация.Как описано выше, из-за того факта, что резонансная передача энергии может происходить намного быстрее, чем вращение молекул для больших флуоресцентных белковых молекул, деполяризацию из-за FRET можно легко отличить от потери анизотропии, которая происходит во время вращения.

Рекомендации по использованию флуоресцентных белков в FRET

Выбор подходящих зондов для исследования FRET в живых клетках ограничен. Синтетические флуорофоры, идеально подходящие для исследований резонансного переноса энергии в фиксированных клетках, трудно вводить и воздействовать на живые клетки.Точно так же квантовые точки могут использоваться для маркировки компонентов мембраны для изучения явлений на внешней стороне клетки, но они тоже не могут проникнуть через мембрану и, следовательно, мало используются во внутриклеточных компартментах, таких как ядро, митохондрии или эндоплазматические клетки. сеточка. Генетически кодируемые флуоресцентные белки в настоящее время представляют собой лучших кандидатов для визуализации FRET в живых клетках с высоким разрешением, о чем свидетельствует объем литературы, публикуемой в этой области ежегодно.Однако многие типичные артефакты, которые встречаются при измерении FRET с помощью синтетических флуорофоров и квантовых точек, особенно остро проявляются при применении к флуоресцентным белкам. Например, в отличие от 30-40 нанометров ширины полосы спектральных профилей излучения в синтетических материалах, профили флуоресцентных белков колеблются от примерно 60 до 100 нанометров, что часто приводит к значительному перекрытию при попытке разделить донорную и акцепторную флуоресценцию. Широкий спектр флуоресцентных белков также ограничивает количество зондов, которые можно использовать вместе в FRET и других типах экспериментов по визуализации.Кроме того, флуоресцентные белки демонстрируют широкий диапазон уровней яркости. Например, один из самых популярных белков-доноров, ECFP, имеет в пять раз меньшую яркость, чем его обычный желтый акцепторный партнер EYFP.

Хромофор флуоресцентного белка окружает полипептид из 220+ аминокислот, намотанный в трехмерную цилиндрическую структуру размером примерно 2,4 на 4,2 нанометра (называемый бета -ствол или бета -кан ) и состоящий из полипептида с обширной водородной связью beta -листов, которые окружают и защищают центральную альфа -спираль, содержащую хромофор (см. фиг.9, ).Концы цилиндра закрыты полускиральными пептидными участками, которые служат для блокирования проникновения ионов и небольших молекул. Внутренняя часть белка настолько плотно упакована боковыми цепями аминокислот и молекулами воды, что остается мало места для диффузии кислорода, ионов или других вторгающихся небольших молекул, которым удается пройти через концы цилиндра. Эти благоприятные структурные параметры, которые частично отвечают за эластичную фотостабильность и отличные характеристики флуоресцентных белков, также способствуют снижению эффективности FRET.Большой размер цилиндра эффективно защищает соседние хромофоры флуоресцентного белка с пептидными остатками (до предельного расстояния близкого приближения от 2 до 3 нанометров; обозначено красной линией на , рис. 9, ), что приводит к снижению максимальной эффективности FRET до примерно 40 процентов от теоретического значения. Тем не менее, многочисленные преимущества использования флуоресцентных белков для FRET-визуализации живых клеток намного перевешивают затраты.

Рисунок 9 — Архитектурные особенности флуоресцентного белка

Высокая степень перекрытия спектральной полосы пропускания и проблемы с размером, которые возникают с флуоресцентными белками, усугубляются их склонностью к олигомеризации.Почти все обнаруженные к настоящему времени флуоресцентные белки демонстрируют по крайней мере ограниченную степень четвертичной структуры, о чем свидетельствует слабая тенденция нативного зеленого флуоресцентного белка Aequorea victoria и его производных к димеризации при иммобилизации в высоких концентрациях. Эта тенденция также подтверждается мотивом строгой тетрамеризации природных желтых, оранжевых и красных флуоресцентных белков, выделенных у рифовых кораллов и анемонов. Олигомеризация может быть значительной проблемой для многих приложений в клеточной биологии, особенно в тех случаях, когда флуоресцентный белок сливается с белком-хозяином, который нацелен в конкретное субклеточное место.После экспрессии образование димеров и олигомеров более высокого порядка, индуцированное флуоресцентной белковой частью химеры, может вызывать атипичную локализацию, нарушать нормальную функцию, мешать сигнальным каскадам или ограничивать агрегацию продукта слияния внутри конкретной органеллы или цитоплазмы. Этот эффект особенно заметен, когда флуоресцентный белок сливается с партнерами, которые сами участвуют в образовании природного олигомера. Продукты слияния с белками, которые образуют только слабые димеры (фактически, большинство вариантов Aequorea victoria ) могут не проявлять агрегацию или неправильное нацеливание при условии, что локализованная концентрация остается низкой.Однако, когда слабодимерные флуоресцентные белки нацелены на определенные клеточные компартменты, такие как плазматическая мембрана, локализованная концентрация белка в некоторых случаях может стать достаточно высокой, чтобы позволить димеризацию. Это может вызывать особую озабоченность при проведении межмолекулярных экспериментов FRET, которые могут дать сложные наборы данных, которые иногда могут быть скомпрометированы артефактами димеризации. С другой стороны, естественная слабая димеризация белков Aequorea может в некоторых случаях использоваться для увеличения сигнала FRET в биосенсорах, которые в противном случае демонстрировали бы ограниченный динамический диапазон.

Токсичность — это проблема, которая возникает из-за чрезмерной концентрации синтетических флуорофоров и чрезмерной экспрессии или агрегации плохо локализованных флуоресцентных белков. Кроме того, здоровье и долговечность оптимально меченых клеток млекопитающих в камерах для получения изображений микроскопа также может пострадать от ряда других вредных факторов. Прежде всего, это вызванное светом повреждение (фототоксичность), которое возникает при многократном воздействии на флуоресцентно меченые клетки света от лазеров и высокоинтенсивных дуговых разрядных ламп.В возбужденном состоянии флуоресцентные молекулы имеют тенденцию реагировать с молекулярным кислородом с образованием свободных радикалов, которые могут повредить субклеточные компоненты и поставить под угрозу всю клетку. Флуоресцентные белки из-за того, что их флуорофоры скрыты глубоко внутри защитной полипептидной оболочки, обычно не фототоксичны для клеток. При разработке экспериментов FRET следует выбирать комбинации флуоресцентных белков, которые демонстрируют максимально длинные волны возбуждения, чтобы минимизировать повреждение клеток коротковолновым освещением, особенно в долгосрочных экспериментах по визуализации.Таким образом, вместо создания продуктов слияния и биосенсоров с синими или голубыми флуоресцентными белками (возбуждаемыми ультрафиолетовым и синим светом соответственно), варианты, излучающие в желтой, оранжевой и красной областях спектра, были бы гораздо более идеальными.

Исследователи должны позаботиться о проведении необходимых контрольных экспериментов при использовании новых флуоресцентных белковых биосенсоров и клеточных линий, чтобы гарантировать, что артефакты цитотоксичности и фототоксичности не затеняют результаты FRET или другие важные биологические явления.В некоторых случаях липофильные реагенты вызывают вредные эффекты, которые можно спутать с токсичностью флуоресцентных белков во время визуализации клеточных линий после временных трансфекций. Олигомерные флуоресцентные белки (обсуждаемые выше) рифовых кораллов имеют гораздо большую тенденцию к образованию агрегатов (в сочетании с плохой субклеточной локализацией), чем мономерные белки медуз, но неправильно свернутые продукты слияния могут возникать с любым вариантом. Недавно сообщалось о флуоресцентном белке, способном генерировать активные формы кислорода ( ROS, ) при освещении зеленым светом, как об эффективном агенте для инактивации определенных белков с помощью хромофорной инактивации света ( CALI ).Этот генетически закодированный фотосенсибилизатор, получивший соответствующее название KillerRed , способен убивать как бактерии, так и эукариотические клетки при освещении в микроскоп. Предыдущие исследования фототоксичности EGFP показали, что даже благодаря тому, что хромофор способен генерировать синглетный кислород, флуоресцентный белок относительно неэффективен в качестве фотосенсибилизатора. Однако длительное освещение клеток, экспрессирующих EGFP и его варианты, может привести к физиологическим изменениям и, в конечном итоге, к гибели клеток, что является определенным сигналом потенциальной фототоксичности в долгосрочных экспериментах по визуализации.

В экспериментах с живыми клетками флуоресцентные белки очень полезны для расширенной визуализации из-за их более низкой скорости фотообесцвечивания по сравнению с синтетическими флуорофорами. Хотя существует высокая степень некоррелированной вариабельности между флуоресцентными белками с точки зрения фотостабильности, большинство вариантов можно использовать для краткосрочной визуализации (от 1 до 25 снимков), в то время как некоторые из более фотостабильных белков можно использовать в покадровых последовательностях, которые охватывают периоды продолжительностью 24 часа и более (в которых собираются от сотен до тысяч изображений).Однако долговременная стабильность любого конкретного белка должна быть исследована для каждого сценария освещения (широкопольного, конфокального, многофотонного, качающегося поля и т. Д.), Потому что различия в фотостабильности часто наблюдаются с одним и тем же белком, когда освещение создается дугой. -разрядная лампа в сравнении с лазерной системой. Таким образом, с точки зрения фотостабильности выбор флуоресцентных белков продиктован многочисленными параметрами, включая условия освещения, систему экспрессии и эффективность установки визуализации.

Потенциальный флуоресцентный белок FRET Partners

За последние несколько лет было разработано и доработано большое количество новых вариантов флуоресцентных белков, чтобы иметь профили излучения, охватывающие 200-нанометровый диапазон (примерно от 450 до 650 нанометров), таким образом заполняя множество пробелов, чтобы предоставить потенциально полезных партнеров FRET. во всех цветовых классах. Недавние успехи в разработке белков в синей (от 440 до 470 нанометров) и голубой (от 470 до 500 нанометров) спектральных областях позволили получить несколько новых зондов, которые могут быть полезны для визуализации и исследований FRET.Три группы по разработке белков сообщили об улучшенных вариантах флуоресцентного белка синей Aequorea, которые обладают значительно более высокой яркостью и фотостабильностью по сравнению с EBFP. Названные Azurite , SBFP2 (сильно усиленный синий FP) и EBFP2 (см. Таблица 1 ), эти белки дают первую реальную надежду на успешную долгосрочную визуализацию живых клеток в синей спектральной области, и все они могут применяться в сочетании с EGFP и производными в биосенсорах FRET.Самый яркий и самый фотостабильный из новых синих репортеров, EBFP2, демонстрирует типичное GFP-подобное поведение в слияниях и был продемонстрирован как отличный донор FRET для белков в зеленом спектральном классе. Все синие флуоресцентные белки могут быть легко отображены в флуоресцентном микроскопе с использованием стандартных наборов фильтров DAPI или запатентованных наборов BFP, доступных от производителей послепродажного обслуживания.

Флуоресцентные белки в голубой области спектра широко применялись в качестве доноров FRET в паре с белками, излучающими желтый, и преобладали варианты исходного Aequorea ECFP до появления мономерного репортера бирюзового цвета, известного как мТФП1 .Флуоресцентный белок бирюзового цвета демонстрирует более высокую яркость и кислотную стабильность по сравнению с CFP Aequorea и является гораздо более фотостабильным. Высокий квантовый выход эмиссии mTFP1 (см. , таблица 1, ) обеспечивает отличную альтернативу циановым производным, mECFP и mCerulean, в качестве донора FRET в сочетании с желтыми или оранжевыми флуоресцентными белками. Дополнительные исследования позволили получить полезные белки в голубом спектральном классе. Среди недавно представленных улучшенных голубых флуоресцентных белков, CyPet и улучшенный голубой вариант, названный Cerulean , наиболее перспективны в качестве кандидатов на использование тегов слияния, биосенсоров FRET и многоцветной визуализации.Церулеан как минимум в 2 раза ярче, чем ECFP, и в исследованиях FRET было продемонстрировано, что он значительно увеличивает контраст, а также отношение сигнал / шум в сочетании с флуоресцентными белками, излучающими желтый цвет, такими как Венера (см. Ниже). Вариант CFP, названный CyPet (от аббревиатуры: Cy — флуоресцентный белок P для передачи e nergy t ), был получен с помощью уникальной стратегии, использующей сортировку клеток с активацией флуоресценции ( FACS ) для оптимизации голубого и желтая пара для FRET.CyPet примерно вдвое слабее EGFP и на две трети ярче Cerulean, но при 37 градусах Цельсия экспрессирует относительно плохо. Однако CyPet имеет более смещенный в синий цвет и более узкий пик флуоресценции, чем CFP, что значительно увеличивает его потенциал для многоцветной визуализации.

Введение полезных мутаций сворачивания в мономерные варианты ECFP привело к производству новых вариантов с повышенной яркостью, эффективностью сворачивания, растворимостью и характеристиками FRET.Названные супер CFP ( SCFP ), новые репортеры значительно ярче, чем родительский белок, когда они экспрессируются в бактериях, и почти в два раза ярче в клетках млекопитающих. Эти высокопроизводительные зонды должны быть полезны как для рутинных тегов слияния, так и для создания новых биосенсоров CFP-YFP FRET, демонстрирующих высокий динамический диапазон. Другой новый мономерный циановый репортер, TagCFP , был получен из GFP-подобного белка медузы Aequorea macrodactyla .Конкретные подробности о белке недоступны в литературе, но он коммерчески доступен в виде векторов для клонирования млекопитающих и слияния от Evrogen. Сообщается, что TagCFP ярче, чем ECFP и Cerulean, но имеет аналогичную кислотостойкость. Другой белок, выделяющий циан, Midoriishi-Cyan (сокращенно MiCy ) был первоначально разработан в качестве донора в новой комбинации FRET с мономерным Kusabira Orange ( mKO ; см. Таблица 1 ) для создания биосенсора. с высоким спектральным перекрытием (расстояние Фёрстера 5.3). Этот белок имеет самые длинные профили длины волны поглощения и излучения (472 и 495 нанометров соответственно), о которых сообщалось для любого зонда в голубой области спектра. Высокий молярный коэффициент экстинкции и квантовый выход, демонстрируемые MiCy, придают белку такую ​​же яркость, что и Cerulean.

Таблица 1 — Свойства выбранных пар флуоресцентных белков FRET

На сегодняшний день лучшим выбором для визуализации живых клеток репортеров FRET в классе зеленого цвета (от 500 до 525 нанометров) является производное GFP Emerald , которое имеет свойства, аналогичные его родительскому EGFP. Emerald содержит мутации F64L и S65T , представленные в EGFP, но вариант также имеет четыре дополнительных точечных мутации, которые улучшают сворачивание, экспрессию при 37 градусах Цельсия и яркость.Недавно было создано новое дополнение к зеленой области спектра — суперпапка GFP , которая ярче и устойчивее к кислотам, чем EGFP или Emerald, и имеет аналогичную фотостабильность. Следовательно, вариант суперпапки должен быть отличным кандидатом для слияния с белками млекопитающих и создания биосенсоров FRET, особенно тех, которые демонстрируют проблемы сворачивания со стандартными производными GFP. Другой ярко флуоресцентный репортер, который может быть хорошим кандидатом FRET, называется Azami Green и был выделен из каменистого коралла Galaxeidae и продемонстрировал быстрое созревание во время экспрессии в линиях клеток млекопитающих.Кроме того, сообщалось о двух ярких мономерных репортерах GFP, полученных с помощью сайт-направленного и случайного мутагенеза в сочетании со скринингом библиотеки на циановые белки. Полученный от кораллов рода Clavularia , mWasabi является потенциальным альтернативным партнером FRET, излучающим зеленый цвет, для синих флуоресцентных белков из-за незначительного поглощения при 400 нанометрах и ниже, где часто возбуждаются синие варианты. Новый зеленый репортер коммерчески доступен (Allele Biotechnology) и должен быть особенно полезен для двухцветной визуализации в сочетании с белками с длинным стоксовым сдвигом (такими как T-Sapphire ), а также с тегом локализации в слияниях с целевыми белками.Производное TagCFP, названное TagGFP , представляет собой яркий и мономерный зеленый вариант, имеющий максимум поглощения при 482 нанометрах и излучение при 505 нанометрах. TagGFP, который лишь немного ярче EGFP, доступен в виде векторов клонирования и тегов слияния от Evrogen, но не был полностью охарактеризован в литературных отчетах.

Желтые флуоресцентные белки (от 525 до 555 нанометров) являются одними из самых универсальных генетически закодированных зондов, которые когда-либо были разработаны, и должны обеспечивать кандидатов, действующих как доноры, так и акцепторы в парах FRET.Варианты, известные как Citrine и Venus , в настоящее время являются наиболее полезными белками в этом спектральном классе (см. , Таблица 1, ), но ни один из них не является коммерчески доступным. Другой вариант, названный в честь камня Topaz , доступен от Invitrogen и полезен при локализации слитых тегов, внутриклеточной передаче сигналов и исследованиях FRET. Новый член коммерческой серии белков-репортеров локализации Evrogen «Tag», TagYFP , представляет собой производное мономерной медузы ( Aequorea macrodactyla ), которое немного менее яркое, чем EYFP, но на порядок более фотостабильно.Как и его партнеры, TagYFP (пик излучения при 524 нанометрах) не описан в литературе, но может быть приобретен как векторы для клонирования млекопитающих или теги слияния.

Во время того же исследования сортировки клеток с активацией флуоресценции, которое привело к генерации CyPet (обсуждалось выше), также был получен эволюционно оптимизированный комплементарный акцептор FRET, названный YPet . Названный в честь его мастерства в FRET ( Y F P для e nergy t ransfer), YPet является самым ярким желтым вариантом, когда-либо разработанным и демонстрирует разумную фотостабильность.Устойчивость к кислой среде, обеспечиваемая YPet, превосходит Venus и другие производные YFP, что увеличивает применимость этого зонда в комбинациях биосенсоров, нацеленных на кислые органеллы. Однако, хотя оптимизированная комбинация CyPet-YPet должна быть предпочтительной отправной точкой в ​​разработке новых биосенсоров FRET, остается серьезное сомнение относительно происхождения повышенной производительности YPet, которая, вероятно, связана просто с усиленной димеризацией с его совместно эволюционировавшими. партнер, CyPet.Аналогичным образом, пригодность CyPet и YPet в тегах слияния для экспериментов по локализации, анализа бимолекулярной комплементации и других приложений еще не установлена. Оба белка существуют в растворе в виде слабых димеров, но предположительно могут быть преобразованы в истинные мономеры с использованием мутации A206K, которая так хорошо сработала с другими вариантами Aequorea (хотя это, по-видимому, разрушает их преимущества в FRET).

Оранжевые флуоресцентные белки, все из которых были выделены из видов коралловых рифов, потенциально могут быть полезны в различных сценариях визуализации FRET.Возможно, наиболее универсальным из них является мономерный Kusabira Orange, белок, первоначально полученный в виде тетрамера из грибного коралла Fungia concinna (известный на японском языке как Kusabira-Ishi ). Мономерная версия Kusabira Orange (сокращенно mKO) была создана путем введения более 20 мутаций посредством сайт-направленного и случайного мутагенеза. Мономер (коммерчески доступный от MBL International) проявляет спектральные свойства, аналогичные тетрамеру, и имеет значение яркости, аналогичное EGFP, но немного более чувствительно к кислой среде, чем его родительский компонент.Однако фотостабильность этого репортера является одной из лучших среди белков во всех спектральных классах, что делает mKO отличным выбором для долгосрочных экспериментов по визуализации. Кроме того, спектральный профиль излучения достаточно хорошо отделен от голубых флуоресцентных белков, чтобы повысить эффективность FRET в биосенсорах, включающих mKO, и зонд полезен в многоцветных исследованиях с комбинацией голубых, зеленых, желтых и красных зондов.

Рисунок 10 — Спаривание флуоресцентного белка FRET с дальним красным акцептором

На рисунке 10 показаны спектральные профили ECFP (, рисунок 10 (a), ), EGFP (, рисунок 10 (b), ), EYFP (, рисунок 10 (c), ) и mOrange (, рисунок 10). (d) ), каждый из которых действует как донор FRET для mPlum, акцептора флуоресцентного белка, излучающего дальний красный цвет.Когда спектральные профили излучения доноров смещаются в сторону более длинных волн (от голубого к оранжевому), спектральное перекрытие (закрашенная серая область) и рассчитанное расстояние Ферстера ( R (0) ) соответственно увеличивается. Точно так же перекрестные помехи возбуждения и излучения (красные и синие заштрихованные области соответственно) также увеличиваются по мере уменьшения расстояния между длинами волн между пиками излучения донора и акцептора. Обратите внимание, что ECFP и mPlum демонстрируют лишь ограниченную степень перекрытия в спектрах возбуждения и практически не перекрываются в спектрах излучения.Напротив, когда mOrange сочетается с mPlum, наблюдается высокий уровень перекрестных помех как возбуждения, так и излучения. Поскольку цветовая палитра флуоресцентных белков продолжает расширяться, широкий спектр новых пар FRET должен стать легко доступным для исследователей.

Производное mRFP1 , mOrange , немного ярче, чем mKO, но имеет менее 10 процентов фотостабильности, что серьезно затрудняет его применение в экспериментах, требующих повторной визуализации.Тем не менее, mOrange остается одним из самых ярких белков в оранжевом спектральном классе и по-прежнему является отличным выбором там, где интенсивность более важна, чем долговременная фотостабильность. Кроме того, в сочетании с T-сапфиром, излучающим зеленый свет, mOrange является подходящей альтернативой белкам CFP-YFP в качестве пары FRET для создания более длинноволновых биосенсоров и может быть соединен с белками в других спектральных областях для многоцветных исследований. Теперь доступна улучшенная версия mOrange (под названием mOrange2 ) с резко увеличенной фотостабильностью.Яркий новый мономерный белок оранжевого цвета, названный TagRFP , был недавно представлен в качестве кандидата для изучения локализации и FRET и может оказаться эффективным в большом количестве биосенсорных конструкций. Самый яркий флуоресцентный белок в любом спектральном классе — это тандемная версия димера Tomato (dTomato), производного апельсина, который был одним из исходных белков Fruit . Белок томата содержит первые и последние семь аминокислот из GFP на концах N — и C — с целью повышения толерантности к гибридным белкам и уменьшения потенциальных артефактов в локализации, а также повышения возможности его использования. в биосенсорах FRET.Версия тандем-димера (фактически мономер) была создана путем слияния двух копий dTomato «голова к хвосту» с линкером из 23 аминокислот. Благодаря наличию двойных хромофоров полученный tdTomato очень яркий и обладает исключительной фотостабильностью. Основным недостатком использования этого белка является больший размер (в два раза больше мономерного белка), что может мешать упаковке слитого белка в некоторых биополимерах.

Поиск идеального флуоресцентного белка, излучающего красный цвет, долгое время был целью визуализации живых клеток и целых животных с использованием биосенсоров FRET и слияния, в первую очередь из-за потребности в датчиках в этой спектральной области в экспериментах с многоцветной визуализацией, а также того факта, что что более длинные волны возбуждения вызывают меньшую фототоксичность и могут проникать глубже в биологические ткани.На сегодняшний день сообщается о широком спектре потенциально полезных красных зондов (излучение от 590 до 650 нанометров), многие из которых все еще страдают определенной степенью обязательной четвертичной структуры, обусловленной их разновидностями происхождения. В отличие от белков медуз, большинство природных и генетически модифицированных вариантов белков коралловых рифов созревают очень эффективно при 37 градусах Цельсия. Обширные усилия по исследованию мутагенеза, включая недавно внедренную методологию, были успешно применены в поисках вариантов флуоресцентных белков желтого, оранжевого, красного и дальнего красного цвета, которые еще больше снижают склонность этих потенциально эффективных биологических зондов к самоассоциации, одновременно вызывая выбросы. максимумы в сторону более длинных волн.В результате были улучшены мономерные белки с повышенными коэффициентами экстинкции, квантовыми выходами и фотостабильностью, хотя ни один вариант еще не был оптимизирован по всем критериям.

Красный mFruit белков, mApple , mCherry и mStrawberry (пики излучения на 592, 610 и 596 нанометрах соответственно), имеют уровни яркости от 50 до 110 процентов EGFP, но mpple и mCherry гораздо более фотостабильны, чем mStrawberry, и являются лучшим выбором для замены mRFP1 в долгосрочных экспериментах по визуализации.Дальнейшее расширение спектрального класса белков mFruit за счет итеративной соматической гипермутации привело к появлению двух новых флуоресцентных белков с максимумами длины волны излучения 625 и 649 нанометров, представляющих первые настоящие дально-красные генно-инженерные зонды. Самый потенциально полезный зонд в этой паре был назван mPlum , который имеет довольно ограниченное значение яркости (10 процентов от EGFP), но отличную фотостабильность. Этот мономерный зонд должен быть полезен в сочетании с вариантами, излучающими в голубых, зеленых, желтых и оранжевых областях, для экспериментов с многоцветной визуализацией и в качестве биосенсора FRET-партнера с зелеными и желтыми белками, такими как изумруд и цитрин (см. , рис. 10, ). .Несколько дополнительных красных флуоресцентных белков, показывающих различную степень перспективности, были выделены из организмов рифовых кораллов. Применение сайт-специфического и случайного мутагенеза к вариантам TurboRFP с последующим скринингом мутаций, проявляющих дальнюю красную флуоресценцию, привело к димерному белку, названному Катушка (максимум излучения 635 нанометров). Хотя «Катушка» ярче всего на две трети от EGFP, она демонстрирует самые высокие уровни яркости среди всех флуоресцентных белков в спектральном окне, охватывающем от 650 до 800 нанометров, области, которая важна для визуализации глубоких тканей.Введение четырех основных мутаций катушки в TagRFP привело к получению мономерного белка дальнего красного цвета, названного mKate , который имеет сходные спектральные характеристики. Сообщается, что фотостабильность mKate является исключительной, и белок демонстрирует яркость, аналогичную яркости mCherry, что делает его отличным кандидатом для локализации и экспериментов FRET в дальней красной части спектра.

Несмотря на значительные успехи в расширении флуоресцентной цветовой палитры на оранжевую, красную и дальнюю красную области спектра, голубой и желтый производные Aequorea остаются наиболее полезным сценарием сочетания для разработки полезных биосенсоров.Это непредвиденное несоответствие возникает из-за того, что большинство белков, полученных из оранжевого и красного коралла, демонстрируют относительно широкий спектральный профиль поглощения с длинным хвостом возбуждения, который простирается в фиолетовую и голубую области, таким образом вызывая прямое возбуждение акцептора. Другой фактор, который может иметь значение, — это относительная скорость созревания слитых флуоресцентных белков-партнеров. В большинстве случаев варианты, полученные из белков Aequorea , созревают гораздо быстрее, чем варианты, полученные из рифовых кораллов, поэтому возможно, что незрелые акцепторы вносят вклад в слабую сенсибилизированную эмиссию, проявляемую многими белками, полученными из кораллов.Кроме того, широкие спектры адсорбции оранжевого и красного белков в сочетании со сниженными квантовыми выходами мономерных версий, вероятно, затрудняют их использование в FRET. Будущий успех экспериментального дизайна флуоресцентного белка FRET будет сосредоточен, среди прочего, на согласовании скорости созревания парных белков.

Выводы

Хотя эксперименты FRET, основанные на вездесущем семействе флуоресцентных белков, предлагают огромный потенциал для выявления молекулярной динамики в живых клеточных системах, идеальной пары FRET пока нет.Оптимизированные версии CFP и YFP по-прежнему представляют собой наиболее эффективную пару для общего использования, хотя лучшие комбинации могут появиться на горизонте. Точно так же не существует идеальной техники для измерения FRET, хотя все описанные выше подходы имеют сильные стороны, которые можно использовать в зависимости от конкретной исследуемой экспериментальной ситуации. По мере того, как становятся доступными более оптимизированные флуоресцентные белки, включая ярко-красные варианты, которые могут быть подходящими в качестве акцепторов для доноров GFP или YFP, FRET, использующий флуоресцентные белки, должен стать еще более полезным для исследований межбелкового взаимодействия в живых клетках.Как обсуждалось, широкие спектры поглощения текущей палитры красных флуоресцентных белков, в дополнение к более низким квантовым выходам мономерных версий, затрудняют использование этих кандидатов в FRET. Тем не менее, быстрые темпы усовершенствования флуоресцентных белков вселяют оптимизм в отношении того, что такие белки будут доступны в ближайшем будущем, и помогут произвести дальнейшую революцию в этом новом подходе к выяснению внутриклеточных биохимических механизмов.

Основы FRET-микроскопии | Nikon’s MicroscopyU

Считается, что в живых клетках динамические взаимодействия между белками играют ключевую роль в регулировании многих путей передачи сигналов, а также вносят вклад в широкий спектр других критических процессов.В прошлом подходы классической биохимии к выяснению механизма таких взаимодействий были обычным явлением, но слабые или временные взаимодействия, которые могут происходить в естественной клеточной среде, обычно прозрачны для этих методов. Например, совместная локализация предполагаемых белковых партнеров с использованием иммунофлуоресцентной микроскопии в фиксированных клетках была популярным методом исследования взаимодействий in situ , и на основе этого метода были представлены многочисленные литературные отчеты.Однако, поскольку разрешение флуоресцентного микроскопа в несколько сотен раз меньше размера типичного белка, совместная локализация часто приводит к сомнительным результатам. Прекрасная аналогия состоит в том, что флуоресцентная микроскопия дает информацию, эквивалентную знанию того, что два студента присутствуют в большом лекционном зале. Он не предлагает разрешения, необходимого для определения того, находятся ли студенты в одном классе или, что еще лучше, сидят ли они за соседними партами.

Рисунок 1 — Фёрстеровский резонансный перенос энергии Диаграмма Яблонски

Типичные методы флуоресцентной микроскопии основаны на поглощении флуорофором света на одной длине волны (возбуждение) с последующим испусканием вторичной флуоресценции на более длинной длине волны.Длины волн возбуждения и излучения часто отделены друг от друга на десятки и сотни нанометров. Мечение клеточных компонентов, таких как ядра, митохондрии, цитоскелет, аппарат Гольджи и мембраны, специфическими флуорофорами позволяет их локализовать в фиксированных и живых препаратах. Путем одновременного мечения нескольких субклеточных структур отдельными флуорофорами, имеющими отдельные спектры возбуждения и испускания, можно использовать специальные комбинации флуоресцентных фильтров для изучения близости меченых молекул в пределах одной клетки или участка ткани.При использовании этого метода молекулы, которые расположены ближе друг к другу, чем предел оптического разрешения, по-видимому, совпадают (и говорят, что совмещают ). Эта очевидная пространственная близость подразумевает, что молекулярная ассоциация возможна. В большинстве случаев, однако, нормального разрешения флуоресцентного микроскопа с ограничением дифракции недостаточно, чтобы определить, действительно ли имеет место взаимодействие между биомолекулами.

Измерения совместной локализации в лучшем случае наводят на размышления, а в худшем — вводят в заблуждение, особенно с учетом того, что многие сигнальные пути используют одну и ту же клеточную структуру, как, например, покрытые клатрином ямки, которые используются для интернализации многих рецепторных комплексов.Знание о том, что две молекулы или белки на самом деле являются смежными, а не просто находятся в одном и том же соседстве, обеспечивает значительно более надежное определение их потенциала для взаимодействия. Проверенная временем методика электронной микроскопии имеет достаточное разрешение для удовлетворения требований высокоточной локализации, но просто не имеет точной методологии маркировки, необходимой для получения надежных результатов. Кроме того, многие методы совместной локализации обычно применяются для использования в фиксированных клетках, что исключает очень желательные динамические измерения, достижимые с помощью анализов в живых клетках.Визуализация флуоресценции с использованием многоцветных флуоресцентных белков позволяет легко проводить эксперименты с живыми клетками, которые необходимы для анализа переходного взаимодействия, но этот подход страдает из-за относительно низкого пространственного разрешения, ограниченного примерно 200 нанометрами.

Ограничения в определении пространственной близости белковых молекул можно преодолеть, применяя методы микроскопии Фёрстера (или флуоресценции) с резонансным переносом энергии ( FRET ). FRET возникает между двумя правильно расположенными флуорофорами только тогда, когда расстояние между ними составляет от 8 до 10 нанометров или меньше.Таким образом, FRET хорошо подходит для исследования белковых взаимодействий, которые происходят между двумя молекулами, расположенными на расстоянии нескольких нанометров друг от друга. За последние десять лет подходы FRET приобрели популярность из-за роста приложений, требующих генетического нацеливания на определенные белки и пептиды с использованием слияния с зеленым флуоресцентным белком ( GFP ) и его мутантными производными. FRET между двумя спектрально различными флуоресцентными белками (известный как FP-FRET ) широко применяется для двух совершенно разных экспериментальных методик, как обсуждается ниже.Представленный в Рис. 1 — это энергетическая диаграмма Яблонского, иллюстрирующая связанные переходы возбужденного состояния между испусканием донора и поглощением акцептора в FRET. Абсорбционные и эмиссионные переходы представлены прямыми вертикальными стрелками (синими, зелеными и красными), а колебательная релаксация обозначена волнистыми желтыми стрелками. Связанные переходы показаны пунктирными линиями, что указывает на их правильное расположение на диаграмме Яблонского, если они возникли в результате опосредованных фотонами электронных переходов.В присутствии подходящего акцептора донорный флуорофор может передавать энергию возбужденного состояния непосредственно акцептору, не испуская фотон (показано фиолетовой стрелкой на рис. , ). Результирующая флуоресценция , сенсибилизированная, эмиссионная имеет характеристики, аналогичные спектру эмиссии акцептора.

Одним из основных препятствий на пути широкого внедрения исследований FRET в живых клетках было отсутствие подходящих методов мечения конкретных внутриклеточных белков соответствующими флуорофорами.Недавняя разработка флуоресцентных белков, обладающих широким спектром спектральных профилей, и возрастающая сложность белковых химер (гибридных, а также биосенсоров) привели к появлению ряда потенциальных пар флуоресцентных белков, которые можно использовать в экспериментах FRET. Применение флуоресцентных белков к FRET включает либо интеграцию выбранной пары в биосенсор (единая генетически закодированная конструкция), либо проведение межмолекулярных измерений между двумя отдельными белками, каждый из которых слит с другим флуоресцентным белком.Последний подход был использован для визуализации различных белковых взаимодействий, включая олигомеризацию рецепторов и выяснение функций факторов транскрипции. Однако проведение FRET-анализов на независимо экспрессируемых химерных белках намного сложнее из-за изменчивой стехиометрии, которая неизбежно возникает, когда отдельные флуоресцентные объекты экспрессируются в живых клетках. Независимо от сложности, эксперименты такого рода могут дать информативные результаты, если установлены соответствующие элементы управления и исследование проводится с высокой точностью.

Флуоресцентные белковые биосенсоры

Флуоресцентные белковые биосенсоры нашли широкое применение при составлении отчетов о разнообразных внутриклеточных процессах. Благодаря творческому слиянию пар флуоресцентных белков с биополимерами, которые выполняют критически важные функции, связанные с различными аспектами физиологической передачи сигналов, ученые-исследователи разработали множество новых молекулярных зондов, которые можно использовать для оптической визуализации живых клеток таких важных процессов, как индукция кальциевой волны, цикличность. эффекты посланника нуклеотидов, изменения pH, колебания мембранного потенциала, фосфорилирование и действие внутриклеточной протеазы.Альтернативная, но весьма полезная стратегия конструирования биосенсора включает модификации самой структуры основной цепи флуоресцентного белка, либо для разделения пептида на отдельные единицы, которые объединяются in vivo для получения флуоресценции (метод, названный Bi -Molecular F luorescence C oplementation; BiFC ) или для соединения природных амино- и карбоксиконцев вместе и создания сайта встраивания в молекуле для сенсорного пептида.

Первым флуоресцентным белковым биосенсором был индикатор кальция под названием cameleon , созданный путем смещения белка кальмодулина и кальций-кальмодулин-связывающего домена киназы легкой цепи миозина (домен M13 ) между усиленными синими и зелеными флуоресцентными белками ( EBFP ). и EGFP ). В присутствии возрастающих уровней внутриклеточного кальция домен M13 связывает пептид кальмодулин, вызывая увеличение FRET между флуоресцентными белками.К сожалению, этому датчику мешал очень низкий динамический диапазон (увеличение флуоресценции в 1,6 раза), и его было трудно визуализировать из-за недостаточной яркости и плохой фотостабильности EBFP. Улучшенные версии с использованием той же матрицы включали голубой и желтый варианты ECFP и EYFP для получения более высоких уровней сигнала, и даже лучшие результаты были получены, когда производные YFP ​​(названные camgaroos ) были получены путем вставки кальций-чувствительных пептидов в начало седьмой бета -цепи в основной цепи флуоресцентного белка.Сенсорные пептиды, расположенные в этом необычном положении, довольно хорошо переносятся с точки зрения поддержания высокого уровня флуоресценции. Еще одна стратегия использует преимущества уникальной бочкообразной структуры, характерной для флуоресцентных белков, для изменения конфигурации концов белка путем связывания естественных концов N и C и создания нового стартового кодона в одном из нескольких мест в центральной области строение (обычно в петлях). Эти структурно модифицированные производные, названные циркулярно пермутированными флуоресцентными белками, могут быть слиты с кальмодулином и M13 для получения превосходных биосенсоров кальция.

Рисунок 2 — Флуоресцентный белковый биосенсор FRET для определения протеазной активности

За биосенсорами кальция быстро последовали генетические индикаторы pH, фосфорилирования и протеазной активности. Для адаптации флуоресцентных белков в качестве датчиков pH можно использовать два общих подхода. Первый основан на чувствительности флуоресценции EGFP (pKa = 5,9) и EYFP (pKa = 6,5) к кислой среде в сочетании с относительной нечувствительностью других белков, таких как ECFP (pKa = 4.7) или DsRed (pKa = 4,5). Слияние EGFP или EYFP с менее чувствительным флуоресцентным белком создает логометрический зонд, который можно использовать для измерения кислотности внутриклеточных компартментов. Второй подход основан на изменениях протонирования нативного (дикого типа) GFP, которые приводят к сдвигу бимодальных спектральных профилей нативного белка. Класс зондов под названием pHluorins , производных от wtGFP, демонстрирует сдвиг пика возбуждения с 470 до 410 нанометров при снижении pH.Также были разработаны датчики pH с двойным излучением, у которых есть пики в зеленой и синей областях спектра. Хотя биосенсоры фосфорилирования не могут сообщать об активности киназы в реальном времени, они состоят из пептида, содержащего мотив фосфорилирования из конкретной киназы, и связывающего домена для фосфопептида, зажатого между двумя флуоресцентными белками, способными к FRET. Когда биосенсор фосфорилируется киназой, домен связывания фосфопептида связывается с фосфорилированной последовательностью, таким образом вызывая или разрушая FRET.Доказано, что эта простая стратегия позволяет создавать надежные и высокоспецифичные биосенсоры. Как и у многих других биосенсоров, основным недостатком является уменьшенный динамический диапазон.

Возможно, наиболее широко используемая конструкция биосенсора для скрининга новых или улучшенных пар FRET включает анализ протеазного расщепления (см. , рис. 2, ). Простой мотив состоит из двух флуоресцентных белков, связанных вместе коротким пептидом, который содержит консенсусный сайт расщепления протеазой. В общем, сенсор демонстрирует очень сильную передачу энергии, которая полностью исчезает при расщеплении линкерной последовательности.Поскольку метод обычно имеет высокие уровни динамического диапазона, его можно использовать для скрининга новых голубых и зеленых доноров FRET с желтыми, оранжевыми и красными акцепторами. Самое большое семейство протеазных биосенсоров включает сайт расщепления, чувствительный к одной из протеаз семейства каспаз, что позволяет исследовать датчик во время индукции апоптоза. За последние несколько лет появилось большое количество новых биосенсоров, использующих как сенсибилизированные флуоресцентные белки, так и пары FRET. Несмотря на сохраняющиеся ограничения динамического диапазона датчиков FRET, использующих производные ECFP и EYFP, эта стратегия получила широкое распространение, вероятно, из-за простоты ратиометрических измерений и легкости конструкции датчика.Без сомнения, появятся новые стратегии с использованием более совершенных комбинаций флуоресцентных белков, которые служат для увеличения динамического диапазона и других свойств этого очень полезного класса зондов.

Основные принципы FRET

Фундаментальный механизм FRET включает в себя донорный флуорофор в возбужденном электронном состоянии, который может передавать свою энергию возбуждения соседнему акцепторному флуорофору (или хромофору) безызлучательным образом через диполь-дипольные взаимодействия на больших расстояниях.Теория, поддерживающая передачу энергии, основана на концепции рассмотрения возбужденного флуорофора как колеблющегося диполя, который может подвергаться обмену энергией со вторым диполем, имеющим аналогичную резонансную частоту. В этом отношении резонансная передача энергии аналогична поведению связанных генераторов, таких как пара камертонов, колеблющихся на той же частоте, или радиоантенна. Напротив, радиационная передача энергии требует испускания и повторного поглощения фотона и зависит от физических размеров и оптических свойств образца, а также от геометрии контейнера и путей волнового фронта.В отличие от радиационных механизмов, резонансный перенос энергии может дать значительный объем структурной информации о донорно-акцепторной паре.

Резонансная передача энергии нечувствительна к окружающей оболочке растворителя флуорофора и, таким образом, дает молекулярную информацию, уникальную по сравнению с той, которая обнаруживается с помощью зависящих от растворителя событий, таких как гашение флуоресценции, реакции возбужденного состояния, релаксация растворителя или измерения анизотропии. Основное влияние растворителя на флуорофоры, участвующие в резонансной передаче энергии, — это влияние на спектральные свойства донора и акцептора.Безызлучательный перенос энергии происходит на гораздо больших расстояниях, чем краткосрочные эффекты растворителя, и диэлектрическая природа компонентов (растворителя и макромолекулы хозяина), расположенных между задействованными флуорофорами, очень мало влияет на эффективность резонансной передачи энергии, которая зависит в первую очередь от расстояние между донорным и акцепторным флуорофором.

Рисунок 3 — Переменные Фёрстера расстояние и коэффициент ориентации в FRET

Феномен FRET не опосредован испусканием фотонов и, более того, даже не требует, чтобы акцепторный хромофор был флуоресцентным.Однако в большинстве приложений и донор, и акцептор являются флуоресцентными, и возникновение передачи энергии проявляется в тушении донорной флуоресценции и уменьшении времени жизни флуоресценции, сопровождаемом также увеличением эмиссии флуоресценции акцептора. Теория резонансного переноса энергии была первоначально разработана Теодором Фёрстером и недавно была названа его именем в честь его вклада. Теория Фёрстера показывает, что эффективность FRET ( E ) изменяется как обратная шестая степень расстояния между двумя молекулами (обозначается r ):

Формула 1 — Эффективность FRET

E FRET = 1 / [1 + (r / R 0 ) 6 ]

, где R (0) — характеристическое расстояние, при котором эффективность FRET составляет 50 процентов, которое можно рассчитать для любой пары флуоресцентных молекул (эта переменная также называется радиусом Ферстера и более подробно обсуждается ниже).Эффективность FRET теоретической пары флуорофоров (усиленные голубые и желтые флуоресцентные белки) графически продемонстрирована на рис. 3 (а) . Из-за обратной зависимости шестой степени от расстояния между двумя молекулами ( r ) кривая имеет очень резкий спад. Для расстояний меньше R (0) эффективность FRET близка к максимальной, тогда как для расстояний больше R (0) эффективность быстро приближается к нулю. Полезный диапазон для измерения FRET обозначен красной заштрихованной областью на рисунке 3 (a) с пределами 0.5 и 1,5 x R (0) . FRET может эффективно использоваться в качестве молекулярной линейки для расстояний, близких к R (0) , и действительно FRET был адаптирован для таких целей в структурной биологии с использованием прецизионных спектроскопических подходов. Однако для большинства приложений в клеточной биологии доступные отношения сигнал / шум ограничивают эксперименты FRET более двоичным считыванием. Фактически, измерение часто может различать только с высоким FRET и с низким FRET или просто между наличием и отсутствием FRET.

Как обсуждалось ранее, R (0) можно легко вычислить для любой пары флуоресцентных молекул. Значение R (0) в водном (или буферном) растворе определяется довольно простым уравнением с хорошо установленными входными параметрами:

Формула 2 — R (0)

R 0 = [2,8 x 10 17 × Κ 2 × Q D D × J (λ)] 1/6 нм

, где Κ (2) или в квадрате каппа представляет коэффициент ориентации между двумя флуорофорными диполями (см. Рисунок 3 (b) для сводки углов, используемых для расчета коэффициента ориентации), Q (D) — квантовый выход донора, Ε (A) — максимальный коэффициент экстинкции акцептора в обратных молях на сантиметр, а J (λ) — интеграл спектрального перекрытия (см. {4} dλ $$

Хотя математика может показаться сложной, большинство параметров являются константами, которые легко найти в литературе.Два наиболее важных члена, которые обычно требуют дальнейшего объяснения, — это Κ (2) и J (λ) , интеграл перекрытия. Переменная угла ориентации ( Κ (2) ) просто указывает, что связь FRET зависит от угла между двумя флуорофорами во многом так же, как положение радиоантенны может влиять на ее прием. Если донор и акцептор выровнены параллельно друг другу, эффективность FRET будет выше, чем если бы они были ориентированы перпендикулярно.Эта степень совмещения определяет Κ (2) . Хотя Κ (2) может изменяться от нуля до 4, обычно предполагается, что оно равно 2/3, что является средним значением, проинтегрированным по всем возможным углам. Почти для любой реалистичной ситуации Κ (2) близко к 2/3, и обычно исследователь ничего не может сделать, чтобы отрегулировать это значение (хотя некоторые из них жестко прикрепили флуоресцентные белки к интересующим их целевым белкам, которые может привести к драматическим эффектам).Интеграл перекрытия, J (λ) , представляет собой область перекрытия между двумя спектрами, как показано на рис. 4 . Другими параметрами, которые могут влиять на FRET, являются квантовый выход донора и коэффициент экстинкции акцептора. Таким образом, чтобы максимизировать сигнал FRET, исследователь должен выбрать донор с наивысшим квантовым выходом, наиболее поглощающий акцептор и флуорофоры, имеющие значительное перекрытие в своих спектральных профилях. Эта теория неоднократно подтверждалась экспериментом, и нет никаких других механизмов для максимизации FRET для невыровненных флуоресцентных зондов.

Рисунок 4 — Интеграл спектрального перекрытия возбуждения и излучения

Следует отметить, что каждый из рассмотренных выше параметров влияет на расчет радиуса Ферстера только в шестой степени. Таким образом, удвоение квантового выхода донора приводит к изменению R (0) только на 12,5%. Поскольку почти все флуорофоры, используемые в экспериментах по визуализации FRET, имеют высокие квантовые выходы (более 0,5) и коэффициенты экстинкции (более 50000), диапазон возможных значений радиуса Ферстера ограничен между 4 и 6 нанометрами, а большинство пар FRET имеют средний значение R (0) ~ 5 нм.Учитывая, что эффективность FRET сильно зависит от расстояния, разделяющего пару FRET, а также от относительной ориентации флуорофоров, FRET можно использовать для обнаружения изменений белок-белковых взаимодействий, которые возникают из-за изменений аффинности между двумя белками или изменений в подтверждение их привязки. Стоит повторить, что для большинства приложений визуализации FRET в клеточной биологии эксперименты обычно различают только два состояния (FRET и отсутствие FRET), и необходима дополнительная информация, чтобы помочь в молекулярной интерпретации наблюдаемых изменений FRET.

Факторы, влияющие на измерения FRET

На практике широкий спектр проблем может усложнить и / или поставить под угрозу измерения FRET, что в конечном итоге приведет к неоднозначным или бессмысленным результатам. Одна из основных проблем заключается в том, что донорные и акцепторные флуорофоры могут иметь существенно разные уровни яркости при совместном отображении. Хотя теоретически это несоответствие не должно быть проблемой, однако на практике, поскольку большинство инструментов могут измерять только ограниченный динамический диапазон, визуализация с использованием двойного флуорофора может привести к тому, что один канал будет насыщенным (для более яркого флуорофора), в то время как другой канал будет доминировать с систематическим шум (для диммерного флуорофора).Таким образом, по возможности лучше использовать донор и акцептор сопоставимой яркости.

Еще одним фактором, который может ограничить обнаружение FRET, является стехиометрия донор-акцептор, которая находится вне диапазона от 10: 1 до 1:10. Этот фактор может быть серьезным ограничением в измерениях FRET белок-белковых взаимодействий, в которых один партнер может иметь избыточную концентрацию. Основная проблема — измерение небольшого уровня FRET на фоне флуоресцентных меток, которые не проходят FRET.В связи с тем, что на самом деле нет ничего, что можно было бы сделать для улучшения этой ситуации, множество возможных экспериментов по взаимодействию белок-белок, попадающих в эту категорию, просто не подходят для исследования методами FRET. Для описанных выше флуоресцентных белковых биосенсоров, которые сконструированы только с одним донором и акцептором, стехиометрия является фиксированной и гарантированно составляет 1: 1; таким образом, эта проблема никогда не возникает, и уровень сигнала остается постоянным, независимо от концентрации биосенсора.

Наличие сквозного прохождения (также называемого перекрестными помехами и кроссовером ) и перекрестное возбуждение между спектрально перекрывающимися флуорофорами также являются важными проблемами, которые могут затруднить исследования FRET (см. , рис. 5, ). В некоторых случаях акцептор может быть непосредственно возбужден светом в диапазоне длин волн, выбранном для возбуждения донора (, рис. 5 (а), ). Кроме того, флуоресценция от донора может просачиваться в канал обнаружения для флуоресценции акцептора, особенно когда спектральные профили излучения донора и акцептора значительно перекрываются (, рис. 5 (b), ).Поскольку эти два источника перекрестных помех возникают из-за фотофизики органических флуорофоров и наверняка будут присутствовать для любой пары FRET, их необходимо учитывать при измерении FRET. Выбор флуорофоров, которые хорошо разделены спектрально, является отличным механизмом для уменьшения перекрестных помех. Однако в большинстве случаев увеличенное спектральное разделение также уменьшает интеграл перекрытия ( J (λ) ), что на практике обычно приводит к снижению способности обнаруживать сигнал FRET.

Наконец, уровень сигнала FRET может быть уменьшен, если два флуорофора не выровнены должным образом (например, имея значение Κ (2) приблизительно равное нулю) или если они просто не расположены в пределах радиуса Фёрстера. (более 6 нанометров). Например, если два меченых белка взаимодействуют, но флуоресцентные метки расположены на противоположных сторонах комплекса, то может не быть обнаруживаемого сигнала FRET, даже если интересующие белки связаны.В общей практике этот тип ложноотрицательных довольно распространен, особенно с флуоресцентными белками-партнерами FRET. Часто требуется несколько стратегий мечения, прежде чем будет обнаружен достаточный и надежный сигнал FRET. Однако каждую из описанных выше проблем можно смягчить (или частично) путем осознанного выбора пары флуорофоров, которая будет использоваться до создания векторных конструкций или проведения экспериментов по синтетическому мечению.

Рисунок 5 — Спектральное просвечивание (перекрестные помехи) в парах CFP-YFP FRET

Представлено в Рис. 5 — это перекрытие спектральных профилей возбуждения и испускания ECFP и mVenus, в настоящее время одной из наиболее предпочтительных пар флуоресцентных белков для исследований FRET.Эти два белка демонстрируют значительное перекрытие как в спектрах возбуждения (, фиг. 5 (а), ), так и в спектрах излучения (, фиг. 5 (b), ). Прямое возбуждение акцептора FRET (mVenus; красная кривая) может быть значительным в зависимости от длины волны, используемой для возбуждения донора (ECFP; голубая кривая или mCerulean; синяя кривая) из-за более высокого коэффициента экстинкции желтого белка по сравнению с голубые белки. Это перекрытие особенно проблематично, когда ECFP используется в качестве донора и может быть частично компенсировано использованием вариантов CFP с высокими коэффициентами экстинкции, таких как mCerulean.Обратите внимание, что кривые возбуждения на рис. 5 (a) нарисованы в масштабе, чтобы отразить различия в коэффициенте экстинкции между желтым и голубым белками. Возбуждение на 458 нм создает гораздо более высокий уровень перекрестных помех возбуждения в мВенусе, чем при возбуждении на 405 или 440 нм. Широкий спектр излучения флуоресценции ECFP (, рис. 5 (b), ) демонстрирует значительное перекрытие по интенсивности во всей области излучения mVenus.

Методы FRET в приложениях клеточной биологии

Исследователи, использующие флуоресцентные белковые биосенсоры или пытающиеся сопоставить стехиометрию флуоресцентных зондов, слитых с отдельными взаимодействующими мишенями, должны использовать как можно больше различных методов анализа FRET, чтобы установить методологию для данного эксперимента.Такие усилия оправданы, потому что каждая из пар флуоресцентных белков FRET демонстрирует определенную патологию, которая усложняет ее использование, требуя четкого понимания параметров оптической микроскопии, применяемых для измерения относительно небольших разностей сигналов, производимых в большинстве анализов FRET. После того, как система и возможные результаты будут хорошо установлены, для текущих процедур можно использовать простейшие подходы. Список методов, разработанных для изображения FRET, довольно обширен.В целом, все существующие стратегии измерения FRET могут быть применены к экспериментам с флуоресцентными белками, но, исходя из практических соображений, пять общих подходов оказались особенно полезными:

  • Сенсибилизированная эмиссия — Двухканальная визуализация с использованием алгоритма, который корректирует перекрестные помехи возбуждения и эмиссии
  • Фотообесцвечивание акцептора — Также известный как декушение донора , этот метод измеряет повышенную эмиссию донора при фотообесцвечивании акцептора
  • Флуоресцентная микроскопия времени жизни (FLIM) — изменение времени жизни донора флуоресцентного белка (или другого флуорофора)
  • Спектральная визуализация — возбуждение на одной или двух длинах волн и измерение полных спектральных профилей донора и акцептора
  • Флуоресцентная поляризационная визуализация — Измеряйте поляризацию параллельно и перпендикулярно возбуждению с высоким отношением сигнал / шум

Каждый из перечисленных выше подходов FRET имеет свои сильные и слабые стороны.Например, с одной стороны, двухканальная визуализация — самый простой метод, но требует наиболее сложного набора элементов управления. С другой стороны, FLIM может дать однозначное измерение эффективности FRET, а инструменты доступны для интеграции в конфокальную систему Nikon A1 HD25 / A1R HD25.

Чувствительное излучение

Также обычно упоминается как двухцветная визуализация с элементами управления, сенсибилизированное излучение, пожалуй, самый простой метод визуализации FRET. Донорный флуорофор возбуждается определенной длиной волны (в широкоугольном или конфокальном микроскопе), и сигнал собирается с использованием фильтров излучения, выбранных для флуоресценции донора и флуоресценции акцептора.При (нереалистичном) отсутствии перекрестных помех между возбуждением и флуоресценцией двух флуорофоров сенсибилизированное излучение было бы идеальным методом. Однако перекрестные помехи между флуоресцентными белками представляют собой серьезную проблему, и обычно требуются обширные контрольные эксперименты, чтобы установить наличие или отсутствие FRET. Таким образом, при таком подходе сложно получить количественно точные данные FRET. Сенсибилизированное излучение относительно просто настроить на широкоугольном флуоресцентном микроскопе, доступном во многих лабораториях, но необходимые контрольные эксперименты требуют значительной обработки изображений для вычитания компонентов перекрестных помех, что значительно увеличивает уровень шума и неопределенность измерений.

Для сенсибилизированной эмиссионной FRET-визуализации были разработаны различные корректирующие подходы. Основная концепция включает использование различных комбинаций фильтров с несколькими образцами, которые содержат: только донор, только акцептор и предполагаемый образец FRET как с донором, так и с акцептором. Значения излучения из этих выборок позволяют исследователю определить величину ожидаемых перекрестных помех как в каналах возбуждения, так и в каналах излучения и вычесть их из измерения FRET.Теоретически этот подход работает хорошо, но, к сожалению, потребность в обработке изображений увеличивает уровень шума во всех изображениях. Таким образом, если сигнал FRET слабый, тогда может быть трудно измерить FRET с использованием этого подхода.

Рисунок 6 — Фотообесцвечивание сенсибилизированного излучения и акцептора FRET

Несмотря на упомянутые выше трудности, сенсибилизированные измерения излучения могут быть полезны для быстрых динамических экспериментов, в которых сигналы FRET велики из-за возможности одновременного получения обоих изображений.Сенсибилизированная эмиссия является особенно привлекательной техникой при исследовании флуоресцентных белковых биосенсоров, где динамический диапазон FRET велик, а стехиометрия донора и акцептора фиксирована в соотношении 1: 1. Хорошим примером является биосенсор протеазы, показанный на Рис. 2 . Эта химера была сконструирована так, чтобы иметь высокую эффективность FRET, которая снижается практически до нуля, когда пептидный линкер ферментативно расщепляется. Результатом является большое и легко поддающееся измерению изменение FRET, которое демонстрирует специфическую протеазную активность в данный момент времени и в определенной области внутри живой клетки.

Акцепторное фотообесцвечивание

Несмотря на то, что оно ограничено только одним измерением, фотообесцвечивание акцептора (или ослабление гашения донора) также является простым методом, который часто дает отличные результаты. Основная концепция использует тот факт, что флуоресценция донора гасится во время FRET, потому что часть энергии флуоресценции донора передается акцептору. Фотообесцвечивание акцепторного флуорофора необратимо устраняет эффект тушения и увеличивает уровень флуоресценции донора.Если FRET возникает между флуорофорами, флуоресценция донора должна увеличиваться при удалении акцептора. В общем, важно убедиться, что фотообесцвечивание акцептора не ухудшает флуоресценцию донора и чтобы акцептор фотообесцвечивался примерно до 10 процентов от своего первоначального значения. Оба эти ограничения легко выполняются с помощью лазерного сканирующего конфокального микроскопа, но также могут быть выполнены с помощью широкоугольных микроскопов или микроскопов с вращающимся диском, оснащенных специальной системой освещения.

Преимущество акцепторного фотообесцвечивания состоит в том, что он очень простой, количественный и выполняется с использованием только одного образца. Эффективность FRET может быть рассчитана путем вычитания интенсивности донора в присутствии акцептора из его интенсивности после фотообесцвечивания акцептора, а затем нормирования этого значения на интенсивность донора после отбеливания. Основным недостатком является то, что фотообесцвечивание акцептора является деструктивным и может использоваться только один раз на ячейку, что ограничивает его применение теми экспериментами, которые не связаны с динамическими измерениями.Кроме того, фотообесцвечивание — относительно медленный процесс, который часто занимает несколько минут или дольше. Тем не менее, почти всегда целесообразно выполнять измерение фотообесцвечивания акцептора в конце эксперимента, независимо от того, какие методы используются для анализа FRET.

Представлено в Рис. 6 являются примерами FRET-тестов сенсибилизированного излучения и фотообесцвечивания акцепторов с использованием визуализации живых клеток. Фиг. 6 (a) иллюстрирует эпителиальную клетку карциномы шейки матки человека (линия HeLa), экспрессирующую биосенсор верблюда, состоящий из mCerulean и mVenus, слитых вместе с промежуточным кальций-чувствительным пептидом, содержащим кальмодулин и домен M13 (описанный выше).Перед добавлением агента, индуцирующего кальций (иономицин), возбуждение клетки с помощью 440-нанометрового освещения вызывает голубую флуоресценцию, указывающую на отсутствие FRET между голубым и желтым флуоресцентными белками ( Рисунок 6 (a) ). После добавления иономицина временная двухцветная визуализация (сенсибилизированная эмиссия) регистрирует кальциевую волну, пересекающую цитоплазму, когда биосенсор реагирует увеличением уровня FRET между флуоресцентными белками ( рисунки 6 (b) и 6 (c) ) ; FRET — желто-красный псевдоцвет).Клетки почек африканской зеленой обезьяны (линия COS-7) на фиг.6 (d) — (f) были помечены синтетическими цианиновыми красителями, Cy3 ( фиг.6 (d), ; зеленый) и Cy5 ( фиг.6). (e) ; красный), конъюгированный с B-субъединицей холерного токсина и нацелен на плазматическую мембрану. Внутри мембраны непосредственная близость двух красителей обеспечивает высокий уровень FRET. Фотообесцвечивание Cy5 в выбранной области клетки (белый прямоугольник на рис. 6 (е) ) увеличивает расщепление донора (усиление зеленой флуоресценции на рис. 6 (f) ) в соответствующей области при просмотре флуоресценции в донорском канале. Только.

Флуоресцентная микроскопия для визуализации на протяжении всей жизни (FLIM)

Измерения срока службы на сегодняшний день являются наиболее строгим методом определения FRET; кроме того, они также менее подвержены артефактам перекрестных помех из-за того, что отслеживается только флуоресценция донора. Все флуоресцентные молекулы демонстрируют экспоненциальное затухание своей флуоресценции в наносекундном масштабе времени, и скорость этого затухания чувствительна к переменным окружающей среде, которые гасят флуоресценцию. Таким образом, основная концепция FLIM отчасти связана с концепцией фотообесцвечивания акцепторов.Флуоресценция донора гасится взаимодействием FRET, и степень гашения может быть определена путем измерения уменьшения времени затухания флуоресценции донора в присутствии FRET. Таким образом, FLIM дает однозначное значение эффективности FRET. Среди преимуществ комбинированных измерений FLIM-FRET — их нечувствительность к артефактам прямого акцепторного возбуждения, а также тот факт, что флуоресцентные доноры могут быть связаны с акцепторами, которые сами не являются флуоресцентными. Оба эти аспекта служат для увеличения числа полезных пар флуоресцентных белков FRET, доступных исследователям.

Рисунок 7 — Приложения FLIM и спектральной визуализации в FRET-микроскопии

FLIM имеет несколько ограничений, которые не позволяют ему быть доминирующим методом в визуализации FRET. В первую очередь, измерения в области наносекундного срока службы являются сложными, а оборудование является дорогостоящим в получении и обслуживании. Кроме того, этот тип сложного оборудования не является широко доступным. Кроме того, FLIM обычно относится к более медленным методологиям построения изображений, потенциально требующим нескольких минут для получения каждого изображения, что ограничивает его полезность во многих экспериментах с FRET.Эти ограничения могут быть сняты в будущем по мере разработки производителями более удобных и быстрых коммерческих систем «под ключ». Другим существенным недостатком является то, что время жизни флуоресцентных белков в живых клетках часто показывает многоэкспоненциальное затухание, что требует более всестороннего анализа данных для количественных анализов FRET. Более того, локальные факторы окружающей среды, такие как автофлуоресценция или изменение pH, также могут сократить измеряемое время жизни флуоресценции, что приведет к артефактам.Таким образом, следует проявлять большую осторожность при интерпретации данных FLIM-FRET в живых клетках.

Спектральная визуализация

Метод спектральной визуализации представляет собой разновидность метода обнаружения сенсибилизированного излучения FRET, но вместо сбора данных через два отдельных канала, весь спектр излучения, содержащий как донорную, так и акцепторную флуоресценцию, собирается при возбуждении донора. Запись всего спектра — типичный подход, используемый для спектроскопических экспериментов, но это относительно недавнее дополнение к инструментальной палитре широкопольной и конфокальной микроскопии.Концепция основана на предпосылке, что сбор всего спектра флуоресценции позволяет разделить перекрывающиеся спектры, используя не только пики излучения, но и различные формы спектральных хвостов. Собирая спектр как от донорного, так и от акцепторного флуорофора, можно определить относительные уровни донорной и акцепторной флуоресценции.

Метод построения спектральных изображений требует специального оборудования, но отличные системы доступны для многих коммерческих конфокальных микроскопов и могут быть добавлены к обычным флуоресцентным микроскопам по умеренной цене.Проведение количественного анализа уровня перекрестных помех из-за прямого возбуждения акцептора или использования двух длин волн возбуждения в конфокальной микроскопии позволяет точно определить количество FRET. Основным недостатком этого подхода является пониженное отношение сигнал / шум, связанное с получением полного спектра, а не с его сбором по двум каналам с помощью системы на основе фильтров. Однако по мере того, как разрабатываются и устанавливаются все больше коммерческих систем, применение спектральной визуализации в анализах FRET расширяется.В ближайшем будущем вполне возможно, что спектральная визуализация станет одним из основных методов проведения экспериментов по визуализации FRET.

Проиллюстрировано в . Рисунок 7 (a) — это изменения в спаде времени жизни донора (флуоресцентный белок mCerulean) псевдо-FRET биосенсора, состоящего из флуоресцентных белков mCerulean и mVenus, слитых вместе с линкером из 10 аминокислот. Синяя кривая спада показывает время жизни, наблюдаемое в клетках, экспрессирующих только mCerulean, тогда как красная кривая спада представляет время жизни mCerulean, полученное, когда клетки экспрессируют конкатенированные белки.Обратите внимание на уменьшение времени жизни mCerulean, когда белок участвует в резонансной передаче энергии. Область между кривыми представляет собой энергию, которая передается через FRET от mCerulean (донор) к mVenus (акцептор) в паре FRET. Профиль эмиссии от 450 до 650 нанометров mCerulean-mVenus в том же псевдобиосенсоре при возбуждении на 405 нанометрах в живых клетках изображен красной кривой на Рис. 7 (b) . Передача энергии от mCerulean к mVenus приводит к значительному пику излучения при 529 нанометрах (максимум излучения mVenus) с гораздо меньшим значением (примерно 25 процентов) на 475 нанометрах, максимальной длине волны излучения mCerulean.После фотообесцвечивания mVenus с помощью 514-нанометрового лазера и повторения спектрального сканирования профиль излучения смещается в сторону более низких длин волн и очень напоминает спектр mCerulean в отсутствие партнера FRET. Разница в интенсивностях на 475 и 529 нанометрах этих спектральных профилей связана с эффективностью FRET между связанными белками.

Построение изображения поляризационной анизотропии

Измерение поляризации флуоресценции дает особые преимущества для высококонтрастной дискриминации флуоресцентного белка FRET.Эта концепция основана на том факте, что при возбуждении поляризованным светом выбирается популяция флуоресцентных молекул, векторы поглощения которых выровнены параллельно вектору поляризации возбуждающего света. Сразу после возбуждения большая часть флуоресцентного излучения будет оставаться поляризованным параллельно возбуждению, так что флуоресценцию можно считать анизотропной с точки зрения поляризации. Анизотропия исчезнет, ​​если молекулы будут вращаться в течение наносекундного времени жизни флуоресценции.Однако, поскольку флуоресцентные белки имеют большие размеры и медленно вращаются, их флуоресценция не деполяризуется в значительной степени во время измерения. Если FRET возникает между двумя флуоресцентными белками, которые слегка смещены, то излучение поляризованной флуоресценции будет появляться под другим углом (от вектора возбуждения), что имитирует вращение флуоресцентного белка.

Рисунок 8 — Получение изображений FRET с поляризационной анизотропией

Основным достоинством этого подхода является простота измерения поляризации флуоресценции, параллельной и перпендикулярной вектору возбуждения, с высоким отношением сигнал-шум.Поскольку данные о поляризационной анизотропии могут быть получены быстро и с минимальными требованиями к обработке изображений, этот метод хорошо подходит для приложений при просмотре контента с высоким содержанием. Однако следует избегать прямого возбуждения акцептора, поскольку это может уменьшить донорный сигнал и уменьшить отношение сигнал / шум измерения. Кроме того, хотя этот метод превосходно распознает наличие и отсутствие FRET, он не подходит для различения сильного и слабого FRET.Наконец, поляризация может ухудшаться в объективах с высокой числовой апертурой, поэтому эксперименты с поляризованным FRET следует ограничивать получением изображений с помощью объективов, имеющих числовую апертуру 1,0 или меньше.

Представлено в Рисунок 8 — графическая иллюстрация поляризационной анизотропии с использованием флуоресцентных белков в качестве модельной системы. Когда случайно ориентированная популяция флуоресцентных белков (, рис. 8 (а), ) возбуждается линейно поляризованным светом (голубая волна), преимущественно возбуждаются только те молекулы, дипольный вектор поглощения которых ориентирован параллельно азимуту поляризации.Эмиссию правильно ориентированных флуоресцентных белков можно наблюдать как сигнал с помощью анализатора, который также параллелен вектору поляризации возбуждающего света (зеленая волна). Результирующая анизотропия, которая является индикатором степени ориентации, может быть определена путем измерения и сравнения интенсивности излучения с помощью вертикально и горизонтально ориентированных анализаторов. Уровень сигнала анизотропии будет уменьшаться, если флуоресцентный белок вращается в масштабе времени эксперимента ( рис. 8 (b), ) или если он передает энергию возбуждения из-за FRET соседнему белку ( рис. 8 (c) ), имеющему разная ориентация.Как описано выше, из-за того факта, что резонансная передача энергии может происходить намного быстрее, чем вращение молекул для больших флуоресцентных белковых молекул, деполяризацию из-за FRET можно легко отличить от потери анизотропии, которая происходит во время вращения.

Рекомендации по использованию флуоресцентных белков в FRET

Выбор подходящих зондов для исследования FRET в живых клетках ограничен. Синтетические флуорофоры, идеально подходящие для исследований резонансного переноса энергии в фиксированных клетках, трудно вводить и воздействовать на живые клетки.Точно так же квантовые точки могут использоваться для маркировки компонентов мембраны для изучения явлений на внешней стороне клетки, но они тоже не могут проникнуть через мембрану и, следовательно, мало используются во внутриклеточных компартментах, таких как ядро, митохондрии или эндоплазматические клетки. сеточка. Генетически кодируемые флуоресцентные белки в настоящее время представляют собой лучших кандидатов для визуализации FRET в живых клетках с высоким разрешением, о чем свидетельствует объем литературы, публикуемой в этой области ежегодно.Однако многие типичные артефакты, которые встречаются при измерении FRET с помощью синтетических флуорофоров и квантовых точек, особенно остро проявляются при применении к флуоресцентным белкам. Например, в отличие от 30-40 нанометров ширины полосы спектральных профилей излучения в синтетических материалах, профили флуоресцентных белков колеблются от примерно 60 до 100 нанометров, что часто приводит к значительному перекрытию при попытке разделить донорную и акцепторную флуоресценцию. Широкий спектр флуоресцентных белков также ограничивает количество зондов, которые можно использовать вместе в FRET и других типах экспериментов по визуализации.Кроме того, флуоресцентные белки демонстрируют широкий диапазон уровней яркости. Например, один из самых популярных белков-доноров, ECFP, имеет в пять раз меньшую яркость, чем его обычный желтый акцепторный партнер EYFP.

Хромофор флуоресцентного белка окружает полипептид из 220+ аминокислот, намотанный в трехмерную цилиндрическую структуру размером примерно 2,4 на 4,2 нанометра (называемый бета -ствол или бета -кан ) и состоящий из полипептида с обширной водородной связью beta -листов, которые окружают и защищают центральную альфа -спираль, содержащую хромофор (см. фиг.9, ).Концы цилиндра закрыты полускиральными пептидными участками, которые служат для блокирования проникновения ионов и небольших молекул. Внутренняя часть белка настолько плотно упакована боковыми цепями аминокислот и молекулами воды, что остается мало места для диффузии кислорода, ионов или других вторгающихся небольших молекул, которым удается пройти через концы цилиндра. Эти благоприятные структурные параметры, которые частично отвечают за эластичную фотостабильность и отличные характеристики флуоресцентных белков, также способствуют снижению эффективности FRET.Большой размер цилиндра эффективно защищает соседние хромофоры флуоресцентного белка с пептидными остатками (до предельного расстояния близкого приближения от 2 до 3 нанометров; обозначено красной линией на , рис. 9, ), что приводит к снижению максимальной эффективности FRET до примерно 40 процентов от теоретического значения. Тем не менее, многочисленные преимущества использования флуоресцентных белков для FRET-визуализации живых клеток намного перевешивают затраты.

Рисунок 9 — Архитектурные особенности флуоресцентного белка

Высокая степень перекрытия спектральной полосы пропускания и проблемы с размером, которые возникают с флуоресцентными белками, усугубляются их склонностью к олигомеризации.Почти все обнаруженные к настоящему времени флуоресцентные белки демонстрируют по крайней мере ограниченную степень четвертичной структуры, о чем свидетельствует слабая тенденция нативного зеленого флуоресцентного белка Aequorea victoria и его производных к димеризации при иммобилизации в высоких концентрациях. Эта тенденция также подтверждается мотивом строгой тетрамеризации природных желтых, оранжевых и красных флуоресцентных белков, выделенных у рифовых кораллов и анемонов. Олигомеризация может быть значительной проблемой для многих приложений в клеточной биологии, особенно в тех случаях, когда флуоресцентный белок сливается с белком-хозяином, который нацелен в конкретное субклеточное место.После экспрессии образование димеров и олигомеров более высокого порядка, индуцированное флуоресцентной белковой частью химеры, может вызывать атипичную локализацию, нарушать нормальную функцию, мешать сигнальным каскадам или ограничивать агрегацию продукта слияния внутри конкретной органеллы или цитоплазмы. Этот эффект особенно заметен, когда флуоресцентный белок сливается с партнерами, которые сами участвуют в образовании природного олигомера. Продукты слияния с белками, которые образуют только слабые димеры (фактически, большинство вариантов Aequorea victoria ) могут не проявлять агрегацию или неправильное нацеливание при условии, что локализованная концентрация остается низкой.Однако, когда слабодимерные флуоресцентные белки нацелены на определенные клеточные компартменты, такие как плазматическая мембрана, локализованная концентрация белка в некоторых случаях может стать достаточно высокой, чтобы позволить димеризацию. Это может вызывать особую озабоченность при проведении межмолекулярных экспериментов FRET, которые могут дать сложные наборы данных, которые иногда могут быть скомпрометированы артефактами димеризации. С другой стороны, естественная слабая димеризация белков Aequorea может в некоторых случаях использоваться для увеличения сигнала FRET в биосенсорах, которые в противном случае демонстрировали бы ограниченный динамический диапазон.

Токсичность — это проблема, которая возникает из-за чрезмерной концентрации синтетических флуорофоров и чрезмерной экспрессии или агрегации плохо локализованных флуоресцентных белков. Кроме того, здоровье и долговечность оптимально меченых клеток млекопитающих в камерах для получения изображений микроскопа также может пострадать от ряда других вредных факторов. Прежде всего, это вызванное светом повреждение (фототоксичность), которое возникает при многократном воздействии на флуоресцентно меченые клетки света от лазеров и высокоинтенсивных дуговых разрядных ламп.В возбужденном состоянии флуоресцентные молекулы имеют тенденцию реагировать с молекулярным кислородом с образованием свободных радикалов, которые могут повредить субклеточные компоненты и поставить под угрозу всю клетку. Флуоресцентные белки из-за того, что их флуорофоры скрыты глубоко внутри защитной полипептидной оболочки, обычно не фототоксичны для клеток. При разработке экспериментов FRET следует выбирать комбинации флуоресцентных белков, которые демонстрируют максимально длинные волны возбуждения, чтобы минимизировать повреждение клеток коротковолновым освещением, особенно в долгосрочных экспериментах по визуализации.Таким образом, вместо создания продуктов слияния и биосенсоров с синими или голубыми флуоресцентными белками (возбуждаемыми ультрафиолетовым и синим светом соответственно), варианты, излучающие в желтой, оранжевой и красной областях спектра, были бы гораздо более идеальными.

Исследователи должны позаботиться о проведении необходимых контрольных экспериментов при использовании новых флуоресцентных белковых биосенсоров и клеточных линий, чтобы гарантировать, что артефакты цитотоксичности и фототоксичности не затеняют результаты FRET или другие важные биологические явления.В некоторых случаях липофильные реагенты вызывают вредные эффекты, которые можно спутать с токсичностью флуоресцентных белков во время визуализации клеточных линий после временных трансфекций. Олигомерные флуоресцентные белки (обсуждаемые выше) рифовых кораллов имеют гораздо большую тенденцию к образованию агрегатов (в сочетании с плохой субклеточной локализацией), чем мономерные белки медуз, но неправильно свернутые продукты слияния могут возникать с любым вариантом. Недавно сообщалось о флуоресцентном белке, способном генерировать активные формы кислорода ( ROS, ) при освещении зеленым светом, как об эффективном агенте для инактивации определенных белков с помощью хромофорной инактивации света ( CALI ).Этот генетически закодированный фотосенсибилизатор, получивший соответствующее название KillerRed , способен убивать как бактерии, так и эукариотические клетки при освещении в микроскоп. Предыдущие исследования фототоксичности EGFP показали, что даже благодаря тому, что хромофор способен генерировать синглетный кислород, флуоресцентный белок относительно неэффективен в качестве фотосенсибилизатора. Однако длительное освещение клеток, экспрессирующих EGFP и его варианты, может привести к физиологическим изменениям и, в конечном итоге, к гибели клеток, что является определенным сигналом потенциальной фототоксичности в долгосрочных экспериментах по визуализации.

В экспериментах с живыми клетками флуоресцентные белки очень полезны для расширенной визуализации из-за их более низкой скорости фотообесцвечивания по сравнению с синтетическими флуорофорами. Хотя существует высокая степень некоррелированной вариабельности между флуоресцентными белками с точки зрения фотостабильности, большинство вариантов можно использовать для краткосрочной визуализации (от 1 до 25 снимков), в то время как некоторые из более фотостабильных белков можно использовать в покадровых последовательностях, которые охватывают периоды продолжительностью 24 часа и более (в которых собираются от сотен до тысяч изображений).Однако долговременная стабильность любого конкретного белка должна быть исследована для каждого сценария освещения (широкопольного, конфокального, многофотонного, качающегося поля и т. Д.), Потому что различия в фотостабильности часто наблюдаются с одним и тем же белком, когда освещение создается дугой. -разрядная лампа в сравнении с лазерной системой. Таким образом, с точки зрения фотостабильности выбор флуоресцентных белков продиктован многочисленными параметрами, включая условия освещения, систему экспрессии и эффективность установки визуализации.

Потенциальный флуоресцентный белок FRET Partners

За последние несколько лет было разработано и доработано большое количество новых вариантов флуоресцентных белков, чтобы иметь профили излучения, охватывающие 200-нанометровый диапазон (примерно от 450 до 650 нанометров), таким образом заполняя множество пробелов, чтобы предоставить потенциально полезных партнеров FRET. во всех цветовых классах. Недавние успехи в разработке белков в синей (от 440 до 470 нанометров) и голубой (от 470 до 500 нанометров) спектральных областях позволили получить несколько новых зондов, которые могут быть полезны для визуализации и исследований FRET.Три группы по разработке белков сообщили об улучшенных вариантах флуоресцентного белка синей Aequorea, которые обладают значительно более высокой яркостью и фотостабильностью по сравнению с EBFP. Названные Azurite , SBFP2 (сильно усиленный синий FP) и EBFP2 (см. Таблица 1 ), эти белки дают первую реальную надежду на успешную долгосрочную визуализацию живых клеток в синей спектральной области, и все они могут применяться в сочетании с EGFP и производными в биосенсорах FRET.Самый яркий и самый фотостабильный из новых синих репортеров, EBFP2, демонстрирует типичное GFP-подобное поведение в слияниях и был продемонстрирован как отличный донор FRET для белков в зеленом спектральном классе. Все синие флуоресцентные белки могут быть легко отображены в флуоресцентном микроскопе с использованием стандартных наборов фильтров DAPI или запатентованных наборов BFP, доступных от производителей послепродажного обслуживания.

Флуоресцентные белки в голубой области спектра широко применялись в качестве доноров FRET в паре с белками, излучающими желтый, и преобладали варианты исходного Aequorea ECFP до появления мономерного репортера бирюзового цвета, известного как мТФП1 .Флуоресцентный белок бирюзового цвета демонстрирует более высокую яркость и кислотную стабильность по сравнению с CFP Aequorea и является гораздо более фотостабильным. Высокий квантовый выход эмиссии mTFP1 (см. , таблица 1, ) обеспечивает отличную альтернативу циановым производным, mECFP и mCerulean, в качестве донора FRET в сочетании с желтыми или оранжевыми флуоресцентными белками. Дополнительные исследования позволили получить полезные белки в голубом спектральном классе. Среди недавно представленных улучшенных голубых флуоресцентных белков, CyPet и улучшенный голубой вариант, названный Cerulean , наиболее перспективны в качестве кандидатов на использование тегов слияния, биосенсоров FRET и многоцветной визуализации.Церулеан как минимум в 2 раза ярче, чем ECFP, и в исследованиях FRET было продемонстрировано, что он значительно увеличивает контраст, а также отношение сигнал / шум в сочетании с флуоресцентными белками, излучающими желтый цвет, такими как Венера (см. Ниже). Вариант CFP, названный CyPet (от аббревиатуры: Cy — флуоресцентный белок P для передачи e nergy t ), был получен с помощью уникальной стратегии, использующей сортировку клеток с активацией флуоресценции ( FACS ) для оптимизации голубого и желтая пара для FRET.CyPet примерно вдвое слабее EGFP и на две трети ярче Cerulean, но при 37 градусах Цельсия экспрессирует относительно плохо. Однако CyPet имеет более смещенный в синий цвет и более узкий пик флуоресценции, чем CFP, что значительно увеличивает его потенциал для многоцветной визуализации.

Введение полезных мутаций сворачивания в мономерные варианты ECFP привело к производству новых вариантов с повышенной яркостью, эффективностью сворачивания, растворимостью и характеристиками FRET.Названные супер CFP ( SCFP ), новые репортеры значительно ярче, чем родительский белок, когда они экспрессируются в бактериях, и почти в два раза ярче в клетках млекопитающих. Эти высокопроизводительные зонды должны быть полезны как для рутинных тегов слияния, так и для создания новых биосенсоров CFP-YFP FRET, демонстрирующих высокий динамический диапазон. Другой новый мономерный циановый репортер, TagCFP , был получен из GFP-подобного белка медузы Aequorea macrodactyla .Конкретные подробности о белке недоступны в литературе, но он коммерчески доступен в виде векторов для клонирования млекопитающих и слияния от Evrogen. Сообщается, что TagCFP ярче, чем ECFP и Cerulean, но имеет аналогичную кислотостойкость. Другой белок, выделяющий циан, Midoriishi-Cyan (сокращенно MiCy ) был первоначально разработан в качестве донора в новой комбинации FRET с мономерным Kusabira Orange ( mKO ; см. Таблица 1 ) для создания биосенсора. с высоким спектральным перекрытием (расстояние Фёрстера 5.3). Этот белок имеет самые длинные профили длины волны поглощения и излучения (472 и 495 нанометров соответственно), о которых сообщалось для любого зонда в голубой области спектра. Высокий молярный коэффициент экстинкции и квантовый выход, демонстрируемые MiCy, придают белку такую ​​же яркость, что и Cerulean.

Таблица 1 — Свойства выбранных пар флуоресцентных белков FRET
Белковая пара Максимум возбуждения донора
(нм)
Максимум эмиссии акцептора
(нм)
Квантовый выход донора Коэффициент молярной экстинкции акцептора Яркость акцептора 17
EBFP2-mEGFP 383 507 0.56 57,500 4,8 1: 2
ECFP-EYFP 440 527 0,40 83,400 4,9 1: 4 528 0,62 92,200 5,4 1: 2
MiCy-mKO 472 559 0,90 51,600 492 528 0.85 92,200 5,1 1: 1
CyPet-YPet 477 530 0,51 104 000 5,1 1: 4,5
610 0,60 72,000 5,1 2,5: 1
Venus-mCherry 528 610 0,57 72,000 5,7 528 581 0.57 138,000 5,9 1: 2
Venus-mPlum 528 649 0,57 41,000 5,2 13177

На сегодняшний день лучшим выбором для визуализации живых клеток репортеров FRET в классе зеленого цвета (от 500 до 525 нанометров) является производное GFP Emerald , которое имеет свойства, аналогичные его родительскому EGFP. Emerald содержит мутации F64L и S65T , представленные в EGFP, но вариант также имеет четыре дополнительных точечных мутации, которые улучшают сворачивание, экспрессию при 37 градусах Цельсия и яркость.Недавно было создано новое дополнение к зеленой области спектра — суперпапка GFP , которая ярче и устойчивее к кислотам, чем EGFP или Emerald, и имеет аналогичную фотостабильность. Следовательно, вариант суперпапки должен быть отличным кандидатом для слияния с белками млекопитающих и создания биосенсоров FRET, особенно тех, которые демонстрируют проблемы сворачивания со стандартными производными GFP. Другой ярко флуоресцентный репортер, который может быть хорошим кандидатом FRET, называется Azami Green и был выделен из каменистого коралла Galaxeidae и продемонстрировал быстрое созревание во время экспрессии в линиях клеток млекопитающих.Кроме того, сообщалось о двух ярких мономерных репортерах GFP, полученных с помощью сайт-направленного и случайного мутагенеза в сочетании со скринингом библиотеки на циановые белки. Полученный от кораллов рода Clavularia , mWasabi является потенциальным альтернативным партнером FRET, излучающим зеленый цвет, для синих флуоресцентных белков из-за незначительного поглощения при 400 нанометрах и ниже, где часто возбуждаются синие варианты. Новый зеленый репортер коммерчески доступен (Allele Biotechnology) и должен быть особенно полезен для двухцветной визуализации в сочетании с белками с длинным стоксовым сдвигом (такими как T-Sapphire ), а также с тегом локализации в слияниях с целевыми белками.Производное TagCFP, названное TagGFP , представляет собой яркий и мономерный зеленый вариант, имеющий максимум поглощения при 482 нанометрах и излучение при 505 нанометрах. TagGFP, который лишь немного ярче EGFP, доступен в виде векторов клонирования и тегов слияния от Evrogen, но не был полностью охарактеризован в литературных отчетах.

Желтые флуоресцентные белки (от 525 до 555 нанометров) являются одними из самых универсальных генетически закодированных зондов, которые когда-либо были разработаны, и должны обеспечивать кандидатов, действующих как доноры, так и акцепторы в парах FRET.Варианты, известные как Citrine и Venus , в настоящее время являются наиболее полезными белками в этом спектральном классе (см. , Таблица 1, ), но ни один из них не является коммерчески доступным. Другой вариант, названный в честь камня Topaz , доступен от Invitrogen и полезен при локализации слитых тегов, внутриклеточной передаче сигналов и исследованиях FRET. Новый член коммерческой серии белков-репортеров локализации Evrogen «Tag», TagYFP , представляет собой производное мономерной медузы ( Aequorea macrodactyla ), которое немного менее яркое, чем EYFP, но на порядок более фотостабильно.Как и его партнеры, TagYFP (пик излучения при 524 нанометрах) не описан в литературе, но может быть приобретен как векторы для клонирования млекопитающих или теги слияния.

Во время того же исследования сортировки клеток с активацией флуоресценции, которое привело к генерации CyPet (обсуждалось выше), также был получен эволюционно оптимизированный комплементарный акцептор FRET, названный YPet . Названный в честь его мастерства в FRET ( Y F P для e nergy t ransfer), YPet является самым ярким желтым вариантом, когда-либо разработанным и демонстрирует разумную фотостабильность.Устойчивость к кислой среде, обеспечиваемая YPet, превосходит Venus и другие производные YFP, что увеличивает применимость этого зонда в комбинациях биосенсоров, нацеленных на кислые органеллы. Однако, хотя оптимизированная комбинация CyPet-YPet должна быть предпочтительной отправной точкой в ​​разработке новых биосенсоров FRET, остается серьезное сомнение относительно происхождения повышенной производительности YPet, которая, вероятно, связана просто с усиленной димеризацией с его совместно эволюционировавшими. партнер, CyPet.Аналогичным образом, пригодность CyPet и YPet в тегах слияния для экспериментов по локализации, анализа бимолекулярной комплементации и других приложений еще не установлена. Оба белка существуют в растворе в виде слабых димеров, но предположительно могут быть преобразованы в истинные мономеры с использованием мутации A206K, которая так хорошо сработала с другими вариантами Aequorea (хотя это, по-видимому, разрушает их преимущества в FRET).

Оранжевые флуоресцентные белки, все из которых были выделены из видов коралловых рифов, потенциально могут быть полезны в различных сценариях визуализации FRET.Возможно, наиболее универсальным из них является мономерный Kusabira Orange, белок, первоначально полученный в виде тетрамера из грибного коралла Fungia concinna (известный на японском языке как Kusabira-Ishi ). Мономерная версия Kusabira Orange (сокращенно mKO) была создана путем введения более 20 мутаций посредством сайт-направленного и случайного мутагенеза. Мономер (коммерчески доступный от MBL International) проявляет спектральные свойства, аналогичные тетрамеру, и имеет значение яркости, аналогичное EGFP, но немного более чувствительно к кислой среде, чем его родительский компонент.Однако фотостабильность этого репортера является одной из лучших среди белков во всех спектральных классах, что делает mKO отличным выбором для долгосрочных экспериментов по визуализации. Кроме того, спектральный профиль излучения достаточно хорошо отделен от голубых флуоресцентных белков, чтобы повысить эффективность FRET в биосенсорах, включающих mKO, и зонд полезен в многоцветных исследованиях с комбинацией голубых, зеленых, желтых и красных зондов.

Рисунок 10 — Спаривание флуоресцентного белка FRET с дальним красным акцептором

На рисунке 10 показаны спектральные профили ECFP (, рисунок 10 (a), ), EGFP (, рисунок 10 (b), ), EYFP (, рисунок 10 (c), ) и mOrange (, рисунок 10). (d) ), каждый из которых действует как донор FRET для mPlum, акцептора флуоресцентного белка, излучающего дальний красный цвет.Когда спектральные профили излучения доноров смещаются в сторону более длинных волн (от голубого к оранжевому), спектральное перекрытие (закрашенная серая область) и рассчитанное расстояние Ферстера ( R (0) ) соответственно увеличивается. Точно так же перекрестные помехи возбуждения и излучения (красные и синие заштрихованные области соответственно) также увеличиваются по мере уменьшения расстояния между длинами волн между пиками излучения донора и акцептора. Обратите внимание, что ECFP и mPlum демонстрируют лишь ограниченную степень перекрытия в спектрах возбуждения и практически не перекрываются в спектрах излучения.Напротив, когда mOrange сочетается с mPlum, наблюдается высокий уровень перекрестных помех как возбуждения, так и излучения. Поскольку цветовая палитра флуоресцентных белков продолжает расширяться, широкий спектр новых пар FRET должен стать легко доступным для исследователей.

Производное mRFP1 , mOrange , немного ярче, чем mKO, но имеет менее 10 процентов фотостабильности, что серьезно затрудняет его применение в экспериментах, требующих повторной визуализации.Тем не менее, mOrange остается одним из самых ярких белков в оранжевом спектральном классе и по-прежнему является отличным выбором там, где интенсивность более важна, чем долговременная фотостабильность. Кроме того, в сочетании с T-сапфиром, излучающим зеленый свет, mOrange является подходящей альтернативой белкам CFP-YFP в качестве пары FRET для создания более длинноволновых биосенсоров и может быть соединен с белками в других спектральных областях для многоцветных исследований. Теперь доступна улучшенная версия mOrange (под названием mOrange2 ) с резко увеличенной фотостабильностью.Яркий новый мономерный белок оранжевого цвета, названный TagRFP , был недавно представлен в качестве кандидата для изучения локализации и FRET и может оказаться эффективным в большом количестве биосенсорных конструкций. Самый яркий флуоресцентный белок в любом спектральном классе — это тандемная версия димера Tomato (dTomato), производного апельсина, который был одним из исходных белков Fruit . Белок томата содержит первые и последние семь аминокислот из GFP на концах N — и C — с целью повышения толерантности к гибридным белкам и уменьшения потенциальных артефактов в локализации, а также повышения возможности его использования. в биосенсорах FRET.Версия тандем-димера (фактически мономер) была создана путем слияния двух копий dTomato «голова к хвосту» с линкером из 23 аминокислот. Благодаря наличию двойных хромофоров полученный tdTomato очень яркий и обладает исключительной фотостабильностью. Основным недостатком использования этого белка является больший размер (в два раза больше мономерного белка), что может мешать упаковке слитого белка в некоторых биополимерах.

Поиск идеального флуоресцентного белка, излучающего красный цвет, долгое время был целью визуализации живых клеток и целых животных с использованием биосенсоров FRET и слияния, в первую очередь из-за потребности в датчиках в этой спектральной области в экспериментах с многоцветной визуализацией, а также того факта, что что более длинные волны возбуждения вызывают меньшую фототоксичность и могут проникать глубже в биологические ткани.На сегодняшний день сообщается о широком спектре потенциально полезных красных зондов (излучение от 590 до 650 нанометров), многие из которых все еще страдают определенной степенью обязательной четвертичной структуры, обусловленной их разновидностями происхождения. В отличие от белков медуз, большинство природных и генетически модифицированных вариантов белков коралловых рифов созревают очень эффективно при 37 градусах Цельсия. Обширные усилия по исследованию мутагенеза, включая недавно внедренную методологию, были успешно применены в поисках вариантов флуоресцентных белков желтого, оранжевого, красного и дальнего красного цвета, которые еще больше снижают склонность этих потенциально эффективных биологических зондов к самоассоциации, одновременно вызывая выбросы. максимумы в сторону более длинных волн.В результате были улучшены мономерные белки с повышенными коэффициентами экстинкции, квантовыми выходами и фотостабильностью, хотя ни один вариант еще не был оптимизирован по всем критериям.

Красный mFruit белков, mApple , mCherry и mStrawberry (пики излучения на 592, 610 и 596 нанометрах соответственно), имеют уровни яркости от 50 до 110 процентов EGFP, но mpple и mCherry гораздо более фотостабильны, чем mStrawberry, и являются лучшим выбором для замены mRFP1 в долгосрочных экспериментах по визуализации.Дальнейшее расширение спектрального класса белков mFruit за счет итеративной соматической гипермутации привело к появлению двух новых флуоресцентных белков с максимумами длины волны излучения 625 и 649 нанометров, представляющих первые настоящие дально-красные генно-инженерные зонды. Самый потенциально полезный зонд в этой паре был назван mPlum , который имеет довольно ограниченное значение яркости (10 процентов от EGFP), но отличную фотостабильность. Этот мономерный зонд должен быть полезен в сочетании с вариантами, излучающими в голубых, зеленых, желтых и оранжевых областях, для экспериментов с многоцветной визуализацией и в качестве биосенсора FRET-партнера с зелеными и желтыми белками, такими как изумруд и цитрин (см. , рис. 10, ). .Несколько дополнительных красных флуоресцентных белков, показывающих различную степень перспективности, были выделены из организмов рифовых кораллов. Применение сайт-специфического и случайного мутагенеза к вариантам TurboRFP с последующим скринингом мутаций, проявляющих дальнюю красную флуоресценцию, привело к димерному белку, названному Катушка (максимум излучения 635 нанометров). Хотя «Катушка» ярче всего на две трети от EGFP, она демонстрирует самые высокие уровни яркости среди всех флуоресцентных белков в спектральном окне, охватывающем от 650 до 800 нанометров, области, которая важна для визуализации глубоких тканей.Введение четырех основных мутаций катушки в TagRFP привело к получению мономерного белка дальнего красного цвета, названного mKate , который имеет сходные спектральные характеристики. Сообщается, что фотостабильность mKate является исключительной, и белок демонстрирует яркость, аналогичную яркости mCherry, что делает его отличным кандидатом для локализации и экспериментов FRET в дальней красной части спектра.

Несмотря на значительные успехи в расширении флуоресцентной цветовой палитры на оранжевую, красную и дальнюю красную области спектра, голубой и желтый производные Aequorea остаются наиболее полезным сценарием сочетания для разработки полезных биосенсоров.Это непредвиденное несоответствие возникает из-за того, что большинство белков, полученных из оранжевого и красного коралла, демонстрируют относительно широкий спектральный профиль поглощения с длинным хвостом возбуждения, который простирается в фиолетовую и голубую области, таким образом вызывая прямое возбуждение акцептора. Другой фактор, который может иметь значение, — это относительная скорость созревания слитых флуоресцентных белков-партнеров. В большинстве случаев варианты, полученные из белков Aequorea , созревают гораздо быстрее, чем варианты, полученные из рифовых кораллов, поэтому возможно, что незрелые акцепторы вносят вклад в слабую сенсибилизированную эмиссию, проявляемую многими белками, полученными из кораллов.Кроме того, широкие спектры адсорбции оранжевого и красного белков в сочетании со сниженными квантовыми выходами мономерных версий, вероятно, затрудняют их использование в FRET. Будущий успех экспериментального дизайна флуоресцентного белка FRET будет сосредоточен, среди прочего, на согласовании скорости созревания парных белков.

Выводы

Хотя эксперименты FRET, основанные на вездесущем семействе флуоресцентных белков, предлагают огромный потенциал для выявления молекулярной динамики в живых клеточных системах, идеальной пары FRET пока нет.Оптимизированные версии CFP и YFP по-прежнему представляют собой наиболее эффективную пару для общего использования, хотя лучшие комбинации могут появиться на горизонте. Точно так же не существует идеальной техники для измерения FRET, хотя все описанные выше подходы имеют сильные стороны, которые можно использовать в зависимости от конкретной исследуемой экспериментальной ситуации. По мере того, как становятся доступными более оптимизированные флуоресцентные белки, включая ярко-красные варианты, которые могут быть подходящими в качестве акцепторов для доноров GFP или YFP, FRET, использующий флуоресцентные белки, должен стать еще более полезным для исследований межбелкового взаимодействия в живых клетках.Как обсуждалось, широкие спектры поглощения текущей палитры красных флуоресцентных белков, в дополнение к более низким квантовым выходам мономерных версий, затрудняют использование этих кандидатов в FRET. Тем не менее, быстрые темпы усовершенствования флуоресцентных белков вселяют оптимизм в отношении того, что такие белки будут доступны в ближайшем будущем, и помогут произвести дальнейшую революцию в этом новом подходе к выяснению внутриклеточных биохимических механизмов.

Скрининг белок-белковых взаимодействий с использованием резонансного переноса энергии Фёрстера (FRET) и микроскопии визуализации времени жизни флуоресценции (FLIM)

  • 1

    Eggeling, C., Виллиг, К. И., Сал, С. Дж. И Хелл, С. В. Флуоресцентная наноскопия на основе линз. кварт. Rev. Biophys. 48 , 178–243 (2015).

    CAS Google ученый

  • 2

    Паттерсон, Г., Дэвидсон, М., Мэнли, С. и Липпинкотт-Шварц, Дж. Визуализация сверхвысокого разрешения с использованием локализации одной молекулы. Annu. Rev. Phys. Chem. 61 , 345–367 (2010).

    CAS PubMed PubMed Central Google ученый

  • 3

    Занелла, Ф., Lorens, J. B. & Link, W. Скрининг высокого содержания: увидеть — значит поверить. Trends Biotechnol. 28 , 237–245 (2010).

    CAS PubMed Google ученый

  • 4

    Ярес-Эриджман, Э. А. и Джовин, Т. М. Визуализация молекулярных взаимодействий в живых клетках с помощью микроскопии FRET. Curr. Opin. Chem. Биол. 10 , 409–416 (2006).

    CAS PubMed Google ученый

  • 5

    Хоппе, А., Кристенсен, К. и Свансон, Дж. А. Стехиометрия на основе флуоресцентного резонансного переноса энергии в живых клетках. Biophys. J. 83 , 3652–3664 (2002).

    ADS CAS PubMed PubMed Central Google ученый

  • 6

    Чен, Х., Пуль, 3-й Х. Л., Кушик, С. В., Фогель, С. и Икеда, С. Р. Измерение эффективности FRET и отношения концентрации донора к акцептору в живых клетках. Biophys, J. 91 , L39–41 (2006).

    CAS Google ученый

  • 7

    Бадер, А.Н., Хофман, Э.Г., ван Берген эн Хенегувен, П.М.П. и Герритсен, Х.С. Получение изображений размеров белковых кластеров с помощью конфокальной флуоресцентной анизотропной микроскопии с синхронизацией по времени. Опт. Экспресс 15 , 6934–6945 (2007).

    ADS CAS PubMed Google ученый

  • 8

    Уоррен, С.К., Марджиняну, А., Катан, М., Дансби, С. и Френч, П. М. В. Биосенсоры на основе Homo-FRET и их применение для мультиплексной визуализации сигнальных событий в живых клетках. Внутр. J. Mol. Sci. 16 , 14695–14716 (2015).

    CAS PubMed PubMed Central Google ученый

  • 9

    Мэтьюз, Д. Р. и др. Многофункциональный подход к визуализации для скрининга взаимодействия белков с высоким содержанием. PLoS ONE 7 , e33231 (2012).

    ADS CAS PubMed PubMed Central Google ученый

  • 10

    Флуоресцентная спектроскопия на протяжении всей жизни и визуализация: принципы и приложения Eds. Марку Л., Френч П. М. У., Элсон Д. С., CRC Press, стр. 1–322, (2015).

  • 11

    Kumar, S. et al. Технология FLIM FRET для открытия лекарств: автоматизированный многолуночный анализ с высоким содержанием, мультиплексированные считывания и приложение in situ . ChemPhysChem 12 , 609–626 (2011).

    CAS PubMed PubMed Central Google ученый

  • 12

    Köllner, M. & Wolfrum, J. Сколько фотонов необходимо для измерения времени жизни флуоресценции? Chem. Phys. Lett. 200 , 199–203 (1992).

    ADS Google ученый

  • 13

    Дигман, М., Кайолфа, В. Р., Замай, М.& Gratton, E. Подход векторов к анализу визуализации времени жизни флуоресценции. Biophys. J. 94 , L14–16 (2008).

    CAS PubMed Google ученый

  • 14

    Эйхорст, Дж. П., Тенг, К. В. и Клегг, Р. М. Представление флуоресценции с временным разрешением в виде полярного графика, в «Флуоресцентная спектроскопия и микроскопия: методы и протоколы», Методы в молекулярной биологии Eds. Энгельборгс Ю., Виссер А.J. W. G. vol. 1076, Springer Science + Business Media, стр. 97–112 (2014).

  • 15

    Chan, J. J. et al. Сравнительный анализ взаимодействий РАССФ1-10. Adv. Биол. Regul. 53 , 190–201 (2013).

    CAS PubMed PubMed Central Google ученый

  • 16

    Scheel, H. & Hofmann, K. Новый мотив взаимодействия, SARAH, связывает три класса опухолевых супрессоров. Curr. Биол. 13 , R899 – R900 (2003).

    CAS PubMed Google ученый

  • 17

    Oh, H. J. et al. Роль опухолевого супрессора RASSF1A в Mst1-опосредованном апоптозе. Cancer Res. 66 , 2562–2569 (2006).

    CAS PubMed Google ученый

  • 18

    Praskova, M., Khoklatchev, A., Ortiz-Vega, S. & Avruch, J. Регулирование киназы MST1 путем аутофосфорилирования, белками, ингибирующими рост, RASSF1 и NORE1, и Ras. Biochem J. 381 , 453–462 (2004).

    CAS PubMed PubMed Central Google ученый

  • 19

    Хохлачев А. и др. Идентификация нового Ras-регулируемого проапоптотического пути. Curr. Биол. 12 , 253–265 (2002).

    CAS PubMed Google ученый

  • 20

    Guo, C. et al. RASSF1A является частью комплекса, подобного сети супрессоров опухолей Drosophila Hippo / Salvador / Lats. Curr. Биол. 17 , 700–705 (2007).

    CAS PubMed Google ученый

  • 21

    Ikeda, M. et al. Белок 6 семейства Ras-ассоциативных доменов индуцирует апоптоз через каспазозависимые и независимые от каспаз пути. Exp. Cell Res. 313 ​​, 1484–1495 (2007).

    CAS PubMed Google ученый

  • 22

    Икеда, М.и другие. Зависимые и независимые от пути бегемота роли RASSF6. Sci. Сигнал 2 , ra59 (2009).

    PubMed Google ученый

  • 23

    Del Re, D. P. et al. Проапоптотическая передача сигналов Rassf1A / Mst1 в сердечных фибробластах защищает мышей от перегрузки давлением. J. Clin. Инвестировать. 120 , 3555–67 (2010).

    CAS PubMed PubMed Central Google ученый

  • 24

    Park, J.и другие. Семейство 5 ассоциативных доменов ras-супрессоров опухолей (RASSF5 / NORE1) опосредует апоптоз, индуцированный лигандом рецептора смерти. J. Biol. Chem. 285 , 35029–38 (2010).

    CAS PubMed PubMed Central Google ученый

  • 25

    Sherwood, V., Recino, A., Jeffries, A., Ward, A. & Chalmers, AD Семейство N-концевых RASSF: новая группа белков, содержащих Ras-ассоциативный домен, с возникающими связями к образованию рака. Biochem. J. 425 , 303–311 (2010).

    CAS Google ученый

  • 26

    Hwang, E. et al. Структурное понимание димерного взаимодействия доменов SARAH из белков семейства Mst1 и RASSF в пути апоптоза. Proc. Nat. Акад. Sci. США 104 , 9236–9241 (2007).

    ADS CAS PubMed Google ученый

  • 27

    Ni, L.и другие. Структурная основа аутоактивации киназы Mst2 человека и ее регуляция с помощью RASSF5. Структура 21 , 1757–1768 (2013).

    CAS PubMed PubMed Central Google ученый

  • 28

    Hwang, E. et al. Структурная основа гетеродимеризации доменов MST и RASSF SARAH в сигнальном пути Hippo. Acta Crystallogr. D Biol. Кристаллогр. 70 , 1944–1953 (2014).

    CAS PubMed PubMed Central Google ученый

  • 29

    Miertzschke, M. et al. Характеристика взаимодействий адаптерного белка RAPL / Nore1B с RAP GTPases и их роль в миграции Т-клеток. J. Biol. Chem. 282 , 30629–30634 (2007).

    CAS PubMed Google ученый

  • 30

    Stieglitz, B. et al. Установлен новый тип эффекторного взаимодействия Ras между опухолевым супрессором NORE1A и переключателем Ras II. EMBO J. 27 , 1995–2005 (2008).

    CAS PubMed PubMed Central Google ученый

  • 31

    Rodriguez-Viciana, P., Sabatier, C. & McCormick, F. Специфичность передачи сигналов GTPases семейства Ras определяется полным спектром эффекторов, которые они регулируют. Мол. Клетка. Биол. 24 , 4943–54 (2004).

    CAS PubMed PubMed Central Google ученый

  • 32

    Авруч, Ю., Праскова, М., Ортис-Вега, С., Лю, М. и Чжан, X. Ф. Регулирование пролиферации клеток и киназ MST1 / 2 с помощью Nore1 и RASSF1. Methods Enzymol. 407 , 290–310 (2006).

    CAS PubMed Google ученый

  • 33

    Ciani, B. et al. Молекулярные основы специфичности состояния олигомеризации спиральной спирали. Proc. Natl. Акад. Sci. США 107 , 19850–19855 (2010).

    ADS CAS PubMed Google ученый

  • 34

    Moutevelis, E.И Вулфсон, Д. Н. Периодическая таблица спиральных белковых структур. J. Mol. Биол. 385 , 726–32 (2009).

    CAS PubMed Google ученый

  • 35

    Warren, S.C. et al. Быстрая глобальная подгонка наборов данных микроскопии для визуализации с большим временем жизни флуоресценции. PLoS ONE 8 , e70687 (2013).

    ADS CAS PubMed PubMed Central Google ученый

  • 36

    Рааб, М., Smith, X., Matthess, Y., Strebhardt, K. & Rudd, C. E. PH домен белка SKAP1 определяет локализацию мембраны RapL и образование комплекса белка Rap1 для активации T-клеточного рецептора (TCR) LFA-1. J. Biol. Chem. 286 , 29663–29670 (2011).

    CAS PubMed PubMed Central Google ученый

  • 37

    Барлоу Д. Дж. И Торнтон Дж. М. Геометрия спирали в белках. J. Mol. Биол. 201 , 601–619 (1988).

    CAS PubMed Google ученый

  • 38

    Фогель, С. С., Нгуен, Т. А., ван дер Меер, Б. В. и Бланк, П. С. Влияние гетерогенности и темных акцепторных состояний на FRET: последствия использования флуоресцентных доноров и акцепторов белков. PLoS ONE 7 , e49593 (2012).

    ADS CAS PubMed PubMed Central Google ученый

  • 39

    Котуренкене, А.Молекулярная основа апоптотической передачи сигналов Ras через мультибелковый комплекс Nore1-MST1. Кандидатская диссертация, Бохумский университет (2008 г.).

  • 40

    Constantinescu Aruxandei, D., Makbul, C., Koturenkiene, A., Ludemann, MB & Herrmann, C. Индуцированное димеризацией сворачивание MST1 SARAH и влияние внутренне неструктурированного ингибирующего домена: низкая термодинамическая стабильность мономер. Биохимия 50 , 10990–1000 (2011).

    CAS PubMed Google ученый

  • 41

    Макбул, К.и другие. Структурные и термодинамические характеристики Nore1-SARAH: небольшой спиральный модуль, важный в сетях передачи сигналов. Биохимия 52 , 1045–1054 (2013).

    CAS PubMed Google ученый

  • 42

    Сонг, Ю., Мадахар, В. и Ляо, Дж. Развитие метода FRET для создания платформ для количественного и высокопроизводительного скрининга белок-белковых взаимодействий. Ann. Биомед.Англ. 39 , 1224–1234 (2010).

    PubMed PubMed Central Google ученый

  • 43

    Сонг, Ю., Роджерс, В. Г. Дж., Шульц, Дж. С. и Ляо, Дж. Определение аффинности взаимодействия белков с помощью количественной технологии FRET. Biotechnol. Bioeng. 109 , 2875–2883 (2012).

    CAS PubMed Google ученый

  • 44

    Чакраборти, С., Hu, S.-Y., Wu, S.-H., Karmenyan, A. & Chiou, A. Сродство взаимодействия между молекулой адгезии сосудистых клеток-1 (VCAM-1) и очень поздним антигеном-4 (VLA- 4) анализировали количественным методом FRET. PLoS One 10 , e0121399 (2014).

    Google ученый

  • 45

    Du, Y. et al. Анализ флуоресцентного резонансного переноса энергии с временным разрешением для высокопроизводительного скрининга ингибиторов межбелкового взаимодействия 14-3-3. Assay Drug Dev. Technol. 11 , 367–381 (2013).

    CAS PubMed PubMed Central Google ученый

  • 46

    Чен, Х., Пуль, Х.Л., III и Икеда, С.Р. Оценка сродства белок-белкового взаимодействия в живых клетках с использованием количественных измерений передачи энергии резонанса Фёрстера. J. Biomed. Оптика 12 , 054011 (2007).

    ADS Google ученый

  • 47

    Мехта, К., Hoppe, A.D., Kainkaryam, R., Woolf, P.J. и Linderman, J.J. Вычислительный подход к выводу сродства связывания клеточного белка на основе количественной визуализации флуоресцентного резонансного переноса энергии. Протеомика 9 , 5371–5383 (2009).

    CAS PubMed Google ученый

  • 48

    Дэй, Р. Н. Измерение взаимодействия белков с использованием резонансной передачи энергии Фёрстера и микроскопии для визуализации времени жизни флуоресценции. Методы 66 , 200–207 (2014).

    CAS PubMed Google ученый

  • 49

    Hom, E. F. Y. & Verkman, A. S. Анализ кинетики и диффузии связанных бимолекулярных реакций с помощью двухцветной флуоресцентной корреляционной спектроскопии: повышенное разрешение кинетики за счет резонансного переноса энергии. Biophys. J. 83 , 533–546 (2002).

    ADS CAS PubMed PubMed Central Google ученый

  • 50

    Фу, Ю.Х., Нареди-Райнер, Н., Лэмб, Д. С., Ахмед, С. и Вохланд, Т. Факторы, влияющие на количественную оценку биомолекулярных взаимодействий с помощью флуоресцентной кросс-корреляционной спектроскопии. Biophys. J. 102 , 1174–1183 (2012).

    ADS CAS PubMed PubMed Central Google ученый

  • 51

    Hohng, S., Joo, C. & Ha, T. Одномолекулярный трехцветный FRET. Biophys. J. 87 , 1328–1337 (2004).

    ADS CAS PubMed PubMed Central Google ученый

  • 52

    Kim, H. et al. Белковая динамика РНК во время ранней сборки рибосом. Природа 506 , 334–340 (2014).

    ADS CAS PubMed PubMed Central Google ученый

  • 53

    Lee, J. et al. Одномолекулярный четырехцветный FRET. Angew. Chem. Int. Эд. Англ. 49 , 9922–9925 (2010).

    CAS PubMed PubMed Central Google ученый

  • 54

    Чжао, М., Хуанг, Р. и Пэн, Л. Количественные многоцветные измерения FRET с помощью матрицы возбуждения-излучения за время жизни Фурье. Optics Express 20 , 26806–26827 (2012).

    ADS PubMed PubMed Central Google ученый

  • 55

    Гальперин, Э., Верхуша В. В., Соркин А. Треххромофорная FRET-микроскопия для анализа мультипротеиновых взаимодействий в живых клетках. Nat. Методы 1 , 209–217 (2004).

    CAS PubMed Google ученый

  • 56

    Wallrabe, H., Sun, Y., Fang, X., Periasamy, A. & Bloom, G. Трехцветный FRET расширяет возможности количественной оценки взаимодействий нескольких белков, участвующих в зарождении актиновых филаментов. Proc.SPIE 822 , 82260J (2012).

    ADS Google ученый

  • 57

    Скотт Б. Л. и Хоппе А. Д. Трехмерная реконструкция трехфакторной микроскопии FRET улучшает визуализацию множественных белок-белковых взаимодействий. PLoS One 11 , e0152401 (2016).

    PubMed PubMed Central Google ученый

  • 58

    Грант, Д. М.и другие. Мультиплексированный FRET для изображения нескольких сигнальных событий в живых клетках. Biophys. J. 95 , L69 – L71 (2008).

    CAS PubMed PubMed Central Google ученый

  • 59

    Zhao, M., Wan, X., Li, Y., Zhou, W. & Peng, L. Мультиплексная 3D-визуализация FRET в глубоких тканях живых эмбрионов. Научный представитель 5 , 13991 (2015).

    ADS CAS Google ученый

  • 60

    Саркар П., Фогель, С.С., Грычински, И., Грычински, З. Фотофизические свойства флуоресцентных белков Церулеана и Венеры. J. Biomed. Опт. 14 , 034047 (2009).

    ADS PubMed PubMed Central Google ученый

  • 61

    Чен Ю., Мюллер Дж. Д., Руан К. и Граттон Е. Определение молекулярной яркости EGFP in vivo с помощью флуоресцентной флуктуационной спектроскопии. Biophys. Дж. 82 , 133–144 (2002).

    CAS PubMed PubMed Central Google ученый

  • 62

    Kelly, D. J. et al. Автоматический многолуночный считывающий микроскоп FLIM для анализа времени жизни автофлуоресценции живых клеток. J. Innov. Опт. Health Sci. 7 , 1450025 (2014).

    CAS Google ученый

  • 63

    Grant, D. M. et al. Высокоскоростная визуализация времени жизни флуоресценции с использованием оптических срезов позволяет изучать события передачи сигналов живыми клетками. Опт. Экспресс 15 , 15656–15673 (2007).

    ADS CAS PubMed Google ученый

  • 64

    Talbot, C. B. et al. Высокоскоростной конфокальный многолуночный планшет-ридер для анализа высокого содержания. Дж. Биофотоника 1 , 514–521 (2008).

    PubMed Google ученый

  • 65

    Алибхай, Д.и другие. Автоматизированный считыватель планшетов для визуализации времени жизни флуоресценции и его применение для считывания Förster-резонансного переноса энергии агрегации белка Gag. J. Biophotonics 6 , 398–408 (2013).

    CAS PubMed Google ученый

  • Анализ на основе FRET для быстрого определения антигена

    Исследователи из Хельсинкского университета разработали новый экспресс-тест для обнаружения вирусных антигенов и применили его для диагностики инфекций SARS-CoV-2.Исследование, доказывающее жизнеспособность экспресс-теста, было опубликовано на этой неделе в mBio .

    Тест основан на резонансном переносе энергии Фёрстера с временным разрешением (TR-FRET), который позволяет измерять вирусные частицы или собственные белки организма с помощью тестов смешивания и считывания сложных биологических образцов, таких как сыворотка или даже цельная кровь.

    Новый экспресс-тест SARS-CoV-2 работает следующим образом: мазок из носоглотки, взятый у испытуемого, смешивается с тестовым раствором, который содержит антитела, распознающие нуклеопротеин SARS-CoV-2 или спайковый белок.Антитела, помеченные флуоресцентными метками, связываются с частицами SARS-CoV-2, образуя молекулярные сборки или комплексы, существование которых может быть подтверждено / обнаружено с помощью анализа TR-FRET. Результаты приходят примерно через 10 минут: образование каких-либо комплексов с высокой степенью достоверности демонстрирует инфекцию, вызванную SARS-CoV-2 у испытуемого.

    Поиск антител
    Поиск сейчас Воспользуйтесь нашим инструментом поиска антител, чтобы найти нужное антитело для вашего исследования. Фильтр
    по типу, применению, реактивности, хозяину, клональности, конъюгату / метке и изотипу.

    По словам старшего автора Юсси Хепойоки: «В нашем исследовании мы продемонстрировали, что метод, основанный на феномене TR-FRET, может использоваться для диагностики инфекций SARS-CoV-2 на клинических образцах».

    Hepojoki говорит, что еще одним преимуществом нового экспресс-теста, разработанного исследователями, является его безопасность для тестировщиков, поскольку вирус становится инактивированным вскоре после того, как он был добавлен в тестовый раствор.

    В дополнение к новому коронавирусу принцип анализа может быть использован для обнаружения других респираторных инфекций или практически любой молекулы: единственное, что необходимо, — это антитело, способное идентифицировать целевую молекулу.

    Универсальный, масштабируемый и быстрый анализ на основе TR-FRET для обнаружения антигена SARS-CoV-2

    ВВЕДЕНИЕ

    Продолжающаяся пандемия коронавирусного заболевания 2019 (COVID-19) к декабрю 2020 года охватила почти полтора миллионов жизней во всем мире, с более чем 60 миллионами подтвержденных инфекций. Для лечения болезни ключевое значение имеют точные диагностические инструменты. Обнаружение возбудителя, тяжелого острого респираторного синдрома, коронавируса 2 (SARS-CoV-2) или его частей, является краеугольным камнем диагностики, поскольку проявления болезни часто неотличимы от других респираторных инфекций.Основой диагностики COVID-19 является тестирование RT-PCR, которое обычно проводится с помощью мазка из носоглотки (NPS), при этом также используются мазки из ротоглотки или средней носовой раковины, а также образцы слюны. В качестве альтернативы все чаще используются менее трудоемкие тесты на обнаружение антигенов. Тесты на антигены, как правило, специфичны, но аналитически менее чувствительны, чем ОТ-ПЦР. ОТ-ПЦР может обнаруживать вирусную нуклеиновую кислоту даже после того, как инфекционный вирус исчез, при этом индивидуум в это время вряд ли представляет риск передачи 1-3 .Имеющиеся данные свидетельствуют о том, что тестирование на антиген может лучше коррелировать с восстановлением инфекционного вируса, чем бинарная ОТ-ПЦР 4 . В качестве альтернативного подхода к снижению передачи SARS-CoV-2 5 было предложено частое тестирование на антигены.

    SARS-CoV-2 представляет собой оболочечный (+) ssRNA вирус рода Betacoronavirus семейства Coronaviridae из отряда Nidovirales . Он содержит четыре структурных белка: нуклеопротеин (NP) образует рибонуклеопротеидный комплекс с несегментированным вирусным геномом размером 30 т.п.н.Белки оболочки (E) и мембраны (M) встроены в оболочку, как и белок-шип (SP), выступающий из поверхности вириона и образующий большие выступы на поверхности, называемые короной. SP подвергается процессингу с образованием S1, который содержит рецептор-связывающий домен (RBD), первоначально прикрепляющий вирус к ангиотензин-превращающему ферменту-2 (ACE-2) на мембране клетки-хозяина, и S2, который опосредует слияние вирус-клетка. В ответ на пандемию доступны десятки коммерческих тестов на антиген SARS-CoV-2, преимущественно латерального потока или иммуноферментного типа.Наиболее целевой NP в качестве аналита 6 . Из семи тестов на антигены, получивших к декабрю 2020 года разрешение на экстренное использование (EUA) от Управления по санитарному надзору за качеством пищевых продуктов и медикаментов США (FDA), шесть целевых N и один S 7 .

    В течение последних нескольких лет мы активно использовали резонансный перенос энергии Фёрстера с временным разрешением (TR-FRET) в качестве основы для быстрого гомогенного иммуноанализа «смешай и считывай» для обнаружения антител 8-14 . FRET возникает, когда донор и акцепторный флуорофор находятся в непосредственной близости, в результате чего возбужденный донор передает энергию акцептору, который затем излучает фотон с определенной длиной волны.Чем ближе донор и акцептор, тем чаще происходит передача энергии, при этом эффективность 50% обычно достигается на расстоянии от 15 до 60 Å. TR-FRET с активированным донором лантанида позволяет проводить измерения на автофлуоресцентных биологических образцах.

    Здесь мы описываем быстрый метод на основе TR-FRET для обнаружения SARS-CoV-2 NP и SP. В анализе поликлональные кроличьи антитела против NP и против RBD, каждое из которых мечено донорным или акцепторным флуорофором, объединяют в эквимолярном соотношении и смешивают с клиническим образцом.Антиген, если он присутствует, связывает меченые антитела и сближает флуорофоры. Это приводит к сигналу TR-FRET при возбуждении, указывающем на присутствие антигена. Сначала мы демонстрируем пределы обнаружения рекомбинантных NP и SP, а также SARS-CoV-2, выращенного на клеточной культуре. Затем мы оцениваем эффективность анализа среди 48 положительных при ОТ-ПЦР и 96 отрицательных клинических образцов НПВ и сравниваем результаты обнаружения антигена с результатами ОТ-ПЦР и культивирования вирусов.

    МАТЕРИАЛЫ И МЕТОДЫ

    Образцы пациентов и контрольные результаты

    Оценка TR-FRET-анализа SARS-CoV-2 проводилась с использованием образцов мазков из носоглотки (NPS), собранных в физиологическом растворе.Образцы были взяты у пациентов с клиническим подозрением на COVID-19, и первоначально они были отправлены в Диагностический центр HUS, HUSLAB для тестирования SARS-CoV-2 RT-PCR. Затем образцы хранили при -20 ° C.

    ОТ-ПЦР SARS-CoV-2 был основан на лабораторном тесте (LDT). Детали и выполнение теста в нашей лаборатории были описаны ранее 15 . В этом методе (на основе N-гена, модифицированного из Corman et al. 16 ) образцы были инактивированы путем объединения 250 мкл буфера для лизиса / связывания MagNA Pure (Roche Diagnostics GmbH, Мангейм, Германия) и 250 мкл буфера для лизиса / связывания. образец.Экстракцию нуклеиновой кислоты проводили из 450 мкл лизата образца с помощью набора MagNA Pure Viral NA SV 2.0 (Roche Diagnostics GmbH, Мангейм, Германия). ОТ-ПЦР выполняли с использованием набора SuperScript III Platinum One-Step qRT-PCR Kit с 600 нМ прямого праймера CACATTGGCACCCGCAATC, 800 нМ обратного праймера GAGGAACGAGAAGAGGCTTG и 200 нМ зонда FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQQ.

    Положительная панель ОТ-ПЦР SARS-CoV-2 включала 48 образцов со значениями порога цикла (Ct), находящимися в линейном диапазоне от 11.42 и 29,98 в LDT. Панель с отрицательными результатами ОТ-ПЦР SARS-CoV-2 включала 96 образцов, отрицательных по результатам LDT. Данные пациентов были собраны, а образцы обработаны в соответствии с разрешением на исследования, утвержденным местным наблюдательным советом, разрешение HUS / 32/2018 (Университетская больница Хельсинки, Финляндия).

    Клеточные линии, выделение и размножение вируса

    Клетки Vero E6 трансдуцировали лентивирусным вектором, экспрессирующим трансмембранную сериновую протеазу 2 человека, TMPRSS2, кДНК варианта транскрипта 2 (NM_005656.4) и в качестве селективного маркера бластицидин.В частности, 1 мл отфильтрованного 0,22 мкм (Millipore) инфекционного супернатанта клеток HEK293T, трансфицированных на 10-см планшете за 48 часов до этого, с использованием 30 мкг полиэтиленимина с 5 мкг pLenti6.3 / V5-DEST TMPRSS2 (получено из Biomedicum Functional Genomics Unit, University из Хельсинки) и 5 ​​мкг p8.9NDSB 17 плюс 2-5 мкг pMD2.G (подарок от Дидье Троно, плазмида Addgene № 12259; https://n2t.net/addgene:12259; RRID: Addgene_12259) добавляли к клеткам Vero E6, засеянным на 6-луночные планшеты. После 2 дней отбора с 15 мкг / мл Blasticidin S HCl (Invitrogen) клеткам давали возможность разрастаться до слияния и трижды пересевали.После подтверждения отрицательного результата на р24 получали клональную популяцию клеток Vero E6-TMPRSS2 путем ограничивающего разведения. Полученные клоны (N = 5) анализировали на экспрессию TMPRSS2 иммуноблоттингом с антителом V5 (Invitrogen). Клон, экспрессирующий наибольшее количество TMPRSS2, VE6-TMPRSS2-h20, был выбран для использования.

    Выделение SARS-CoV-2 из клинических образцов (хранящихся при -20 ° C со дня сбора, не подвергшихся замораживанию-оттаиванию) было предпринято как на клетках Vero E6, так и на клетках VE6-TMPRSS2-h20.Обе клеточные линии культивировали в Minimal Essential Medium Eagle (MEM, Sigma) с добавлением 10% фетальной бычьей сыворотки (FBS, Gibco), 100 МЕ пенициллина и 100 мкг / мл стрептомицина (Sigma) и 2 мМ L-глутамина (Sigma). . Для выделения клетки выращивали на 12-луночных планшетах примерно до 90% конфлюэнтности, ростовую среду заменяли 400 мкл MEM-2% (как указано выше, но с 2% FBS) с последующим добавлением 50 мкл образца NPS. (в условиях уровня биобезопасности 3) и инкубация в течение 1 часа при 37 ° C, 5% CO 2 .После двух промывок MEM-2% культуры хранили в 1 мл свежего MEM-2% в течение 4 дней при 37 ° C (5% CO 2 ), среду собирали и осветляли центрифугированием (3000 x rcf, 5 мин. ), и клетки фиксировали в течение 15 мин при комнатной температуре 3,7% формальдегидом в фосфатно-солевом буфере (PBS) с последующей промывкой PBS и УФ-инактивацией (5000 x100 мДж, УФ-сшивающий агент, CL-1000, Jena Analytik). Фиксированные клетки окрашивали кристаллическим фиолетовым, и степень цитопатического эффекта (CPE) оценивалась от 0 до 3 (от ненаблюдаемой до обширной гибели клеток).Для подтверждения инфекции РНК экстрагировали (набор для экстракции вирусной РНК QIAgen QIAamp, следуя протоколу производителя) из 100 мкл супернатанта каждой клеточной культуры, и наличие или отсутствие SARS-CoV-2 анализировали с помощью ОТ-ПЦР, нацеленной на RdRp (РНК- зависимой РНК-полимеразы), как описано 16 .

    Для экспериментов по обнаружению антигена TR-FRET мы произвели запас SARS-CoV-2 в клетках Vero E6 18 . Вкратце, 90-95% конфлюэнтных клеток Vero E6 инокулировали 500 мкл супернатанта, разведенного 1: 100, содержащего SARS-CoV-2 (пассаж 7, приблизительно 5 × 10 7 инфекционная доза культуры ткани 50, TCID50, на мл).Через 1 час адсорбции вируса среду заменяли MEM-2%, а через 2 дня при 37 ° C 5% CO2 супернатант собирали и осветляли центрифугированием (3000 x rcf, 5 минут) и хранили в аликвотах при −80 ° С. УФ-инактивацию супернатантов культур проводили, как описано выше.

    Коронавирус человека 229E (hCoV-229E, любезно предоставлен доктором Сиско Тауриайнен, Университет Турку, Турку, Финляндия) и NL63 (hCoV-NL63, любезно предоставлен Лией ван дер Хук, Академический медицинский центр, Амстердам, Нидерланды). в качестве контроля для оценки перекрестной реактивности анализа.Исходный материал hCoV-229E получали путем инокуляции клеток почек макака-резуса, LLC-MK2 (от ATCC), с 500 мкл супернатанта культуры клеток, разведенного 1: 1000 (приблизительно 5 × 10 9 TCID50 / мл) в течение 1 часа при 37 ° С. C 5% CO2. После адсорбции вируса среду заменяли на MEM-2%, клетки выращивали в течение 5 дней (37 ° C, 5% CO2), супернатант собирали, центрифугировали (3000 x rcf, 5 мин) и хранили в аликвотах при — 80 ° С. Исходный материал hCoV-NL63 получали инокуляцией фибробластов легких человека (MRC-5, от ATCC) 500 мкл супернатантов клеточных культур, разведенных 1: 100 (приблизительно 1 × 10 6 TCID50 / мл) в течение 1 ч при 37 ° C. 5% CO2.После адсорбции вируса среду заменяли на MEM-2%, клетки выращивали в течение 7 дней (до появления дефинитивного CPE), супернатанты собирали, центрифугировали (3000 x rcf, 5 мин) и хранили в аликвотах при -80 ° C. Супернатанты hCoV-229E и hCoV-NL63 были инактивированы для экспериментов путем смешивания в соотношении 1:10 в буфере RIPA (50 мМ Tris-HCl pH 8,0, 150 мМ NaCl, 1% NP-40, 0,1% SDS, 0,5% дезоксихолат натрия. и Roche cOmplete коктейль ингибиторов протеазы без ЭДТА).

    Антигены и антитела

    Производство и очистка антигенов SARS-CoV-2 NP и SP осуществлялась согласно описанному протоколу 14,19,20 .RBD SP продуцировали в клетках Expi293F, как описано 19,20 . Кроличьи антисыворотки против RBD и NP были созданы в BioGenes GmbH (Берлин, Германия): начальная доза на 0-й день 150 мкг, на 7-й день бустера 75 мкг, на 14-й день бустер 75 мкг, на 28 день бустер 150 мкг и на 42 день окончательное кровотечение. Для аффинной очистки RBD и NP были связаны с CNBr-сефарозой 4B (Cytiva) в соответствии с протоколом производителя. Соответствующие антисыворотки пропускали через связанные сефарозы, упакованные в хроматографические колонки Poly-Prep (Bio-Rad), промывали 20 объемами колонки фосфатно-солевым буфером (PBS), элюировали (0.1 M глицин, 150 мМ NaCl, pH 2,5) с 2 M Tris, pH 9,0, концентрировали с использованием центробежного фильтра Amicon Ultra 15 мл 100 кДа-NMWL (Millipore / Merck) и диализовали против PBS с использованием кассет для диализа Slide-A-Lyzer ( Thermo Scientific).

    Маркировка

    Мы пометили аффинно очищенные антитела, 250 мкг / реакцию, донором (европий, Eu) и акцептором (Alexa Fluor 647, AF647), соответственно, с помощью набора для маркировки хелатных белков QuickAllAssay Eu (BN Products and Services Oy) и Alexa Fluor ™ 647 NHS Ester (Thermo Scientific) в соответствии с инструкциями производителя.Одноразовая колонка для обессоливания PD-10 со смолой Sephadex G-25 (Cytiva), служащая для удаления непрореагировавших флуорофоров, и центробежный фильтр Amicon Ultra 0,5 мл 50 кДа-NMWL (Millipore / Merck) для концентрирования меченых антител, которые затем хранились в виде аликвот. при -80 ° C до использования.

    Анализы TR-FRET

    Сначала мы настроили анализы TR-FRET для антигенов SARS-CoV-2 SP и NP, используя соответствующие очищенные белки, а также соответствующие меченные Eu и AF анти-RBD и антигены. -NP антитела.Принцип анализа и рабочий процесс изображены на фиг. 1. Вкратце, смеси антител с эквимолярными концентрациями меченных Eu и AF концентраций антител против RBD и антител против NP готовили в буфере RIPA. Для настройки анализа пул из четырех образцов НПВ, отрицательных по SARS-CoV-2, был разделен на аликвоты и дополнен белками NP или SP в различных концентрациях. 10 мкл смеси антител вносили пипеткой в ​​384-луночный микропланшет (ProxiPlate 384 Plus F, Black 384-мелколуночный микропланшет, PerkinElmer, США), а затем 10 мкл образца с добавленным антигеном.Сигнал TR-FRET измеряли непосредственно после этого и в моменты времени 7, 15, 22, 30, 45, 60 и 90 минут после первого измерения с помощью считывающего устройства для микропланшетов Hidex Sense (Hidex Oy, Финляндия). Возбуждение донора FRET осуществляли при 330 нм, и после задержки в 70 мкс сигналы донора и акцептора измеряли в течение 100 мкс при 616 и 665 нм, соответственно. Сигналы TR-FRET выражали в виде отношений HTRF, рассчитанных следующим образом: отношение HTRF = излучение при 616 нм / излучение при 665 нм x 10000. После этого отношения HTRF, измеренные для образцов с добавленным антигеном, сравнивали с значениями, измеренными для образцов, не содержащих антиген. образец с добавлением добавок в том же цикле, чтобы рассчитать кратное увеличение отношения HTRF.Концентрации антител в планшете от 5 до 500 нМ (половина Eu- и половина AF-меченные) подвергали перекрестному титрованию с концентрациями антигена в планшете от 5 до 500 нМ.

    Рисунок 1.

    Рабочий процесс и принцип анализа TR-FRET. Слева показаны компоненты реакции. В центре находится лунка, содержащая меченные донором и акцептором антитела в молярном соотношении 1: 1 в реакционном буфере, в нашей установке общая концентрация антител в этот момент составляет 24 нМ, а объем — 10 мкл. Стрелки указывают на добавление материала образца в нашей установке либо 10 мкл очищенного рекомбинантного белка, либо 10 мкл образца NPS.В правом верхнем углу схематически показаны комплексы антиген-антитело, образованные после добавления образца, содержащего антиген, реакционный объем на этом этапе в нашей установке составляет 10 мкл. Правая нижняя сторона схематически демонстрирует, что меченые антитела не образуют активных комплексов TR-FRET в отсутствие антигена.

    Затем оценивали диапазоны концентраций антигена, определяемые с помощью TR-FRET (при концентрациях меченных Eu и AF анти-NP / -RBD 6 + 6 нМ), выполняя анализ, как описано выше, с использованием концентраций N и S на чашках От 5 фМ до 5 нМ.

    Для оценки эффективности анализа с образцами, содержащими вирионы, использовали супернатанты клеточных культур, содержащие примерно 10 7 TCID50 / мл SARS-CoV-2. Для начальных экспериментов (проведенных в лаборатории BSL-3) использовали супернатант культуры инфекционных клеток (неразбавленный, 1:10, 1:25, 1:50 и 1: 100, разведенный в RIPA). После проверки того, что УФ-инактивированный вирус дает аналогичные результаты, в матрицу отрицательного NPS-образца добавляли УФ-инактивированный вирус, содержащий супернатант клеточной культуры, с получением серии разведений от 1:10 до 1: 20480.Образцы тестировали в анализах TR-FRET, проводимых, как указано выше, при концентрациях меченных Eu и AF антител к NP / -RBD 6 + 6 нМ.

    Анализ образца NPS выполняли путем смешивания 10 мкл образца с 10 мкл смесей антител (концентрации меченных Eu и AF анти-NP / -RBD составляли 6 + 6 нМ). Анализы TR-FRET с использованием SARS-CoV-2 RT-PCR-положительных образцов НПВ проводились в лаборатории BSL-3, а отрицательные RT-PCR — в лаборатории BSL-2. Сигналы, продуцируемые hCoV-229E и hCoV-NL63, оценивали путем смешивания 10 мкл (неразбавленного, 1:10, 1:25, 1:50 и 1: 100, разведенного в RIPA) супернатанта клеточной культуры с 10 мкл смеси антител (при концентрациях меченных Eu и AF анти-NP / -RBD 6 + 6 нМ).

    РЕЗУЛЬТАТЫ

    Подтверждение концепции для анализа гомогенного определения антигена

    Мы предположили, что гомогенное, то есть в растворе, обнаружение антигенов может быть достигнуто с использованием поликлональных антител, отдельно меченных флуорофорами, образующими пару FRET. Чтобы проверить гипотезу и принцип анализа, представленные на рис. 1, мы создали антисыворотку против SARS-CoV-2 NP и RBD SP, титры> 204 800 на основе NP и SP ELISA соответственно. После аффинной очистки антитела метили хелатным европием (Eu, донор) и AlexaFluor 647 (AF647, акцептор).В первых экспериментах мы проверили принцип анализа, смешивая рекомбинантные NP и SP с 1 мкМ (500 нМ меченых Eu + 500 нМ AF647) смесей антител против NP и RBD в присутствии увеличивающегося количества бычьего сывороточного альбумина (BSA ) концентрации. Добавление BSA увеличивало отношение сигнал / шум, побуждая нас оценивать характеристики анализа с дальнейшим использованием надосадочных жидкостей клеточных культур, содержащих инфекционный SARS-CoV-2, и различных буферных составов. Анализ с концентрацией антител 1 мкМ дал приличное отношение сигнал / шум в буфере RIPA (анализ радиоиммунопреципитации), содержащем детергент (рис.S1). Используемый здесь буфер RIPA (полный рецепт см. В материалах и методах) содержал 1% NP-40 и 0,1% SDS, которые, как было показано, эффективно инактивируют SARS-CoV-2 21,22 в оболочке, поэтому мы должны использовать RIPA для последующих анализов.

    Оптимизация анализа с использованием рекомбинантных антигенов и SARS-CoV-2

    Для оптимизации результатов анализа мы смешали меченые антитела в эквимолярном соотношении с известными количествами рекомбинантных NP и SP и записали полученные сигналы TR-FRET (как HTRF, однородная флуоресценция с временным разрешением, значения) как функция времени.Результаты показали, что анализы дают самые высокие значения HTRF, когда концентрация меченых антител равна концентрациям очищенных соответствующих антигенов (рис. S2). Более высокие концентрации антител сокращают время, необходимое для достижения пика сигнала (кратное увеличение значения HTRF, HTRF образец / HTRF буфер ): при концентрации антитела 5 нМ (2,5 нМ Eu- + 2,5 нМ AF647-меченного) для достижения пика сигнала как для NP, так и для SP требуется ~ 60 минут, тогда как при концентрации антитела 500 нМ пик сигнала NP наступает через 7 минут, а пик сигнала SP достигается за ~ 30 минут.Мы также проверили характеристики анализа с Eu- и AF-меченными антителами, смешанными в неравных пропорциях 1: 2 и 2: 1, но это не увеличило отношение сигнала к фону (Таблица S1).

    Затем мы оценили эффективность анализа при общих концентрациях антител 50, 25, 12 и 6 нМ с использованием супернатантов клеточных культур, содержащих SARS-CoV-2, в различных разведениях. Мы включили УФ-инактивированный супернатант клеточной культуры, чтобы выяснить, повлияет ли УФ-инактивация на анализ. Результаты совпали с результатами, полученными с использованием рекомбинантных антигенов, и показали зависимость кинетики сигнала TR-FRET от концентрации антигена (рис.S3). Результаты также показали, что общая концентрация антител 12 нМ позволяет измерять антигены в широком диапазоне концентраций вирусов, и что инфекционный и УФ-инактивированный SARS-CoV-2 дает аналогичные результаты.

    Пределы обнаружения

    Чтобы оценить пределы обнаружения (LOD) для анализов при общей концентрации антител 12 нМ, мы добавили в пул образцов NPS либо очищенные антигены, либо инактивированный SARS-CoV-2 в различных разведениях. Для очищенных антигенов самые низкие концентрации, дающие легко обнаруживаемые сигналы, были равны 0.05 нМ для NP и 0,5 нМ для SP (рис. S4, a-b). С УФ-инактивированным SARS-CoV-2 разведения супернатанта до 1: 5120 и 1: 160 давали надежно измеряемые сигналы с антителами против NP и против RBD, соответственно (рис. S4, c-d). При объеме образца 10 мкл предел обнаружения анализа для рекомбинантных NP составлял ~ 25 пг (с использованием молекулярной массы 50 кДа) и 875 пг для SP (с использованием молекулярной массы 175 кДа). Соответственно, анализ NP может выявить примерно 15, а анализ RBD — примерно 420 бляшкообразующих единиц (преобразованных с использованием 0.7 x TCID50 / мл = БОЕ / мл) на реакцию.

    Обнаружение антигенов SARS-CoV-2 в образцах НПВ

    После настройки условий анализа с использованием рекомбинантных белков и вируса, выращенного на культуре клеток, мы протестировали тесты на обнаружение вирусного антигена в НПВ, положительных при ОТ-ПЦР SARS-CoV-2 образцы. У нас было 48 образцов НПВ со значениями порога цикла ОТ-ПЦР (Ct) в линейном диапазоне от ~ 12 до 30 (рис. S5), и использовали общие концентрации антител 50, 25, 12 и 6 нМ. Мы наблюдали, что образцы со значениями Ct ≤25 давали сигнал в анализе NP (рис.S6). При использовании оптимизированных условий с общим количеством меченых антител 12 нМ чувствительность анализа NP TR-FRET по сравнению с RT-PCR составила 77,1% (37/48). Анализ SP показал большее разнообразие; большинство образцов со значениями Ct ≤15 дали положительный результат (рис. S6). Мы также провели иммуноблоттинг для обнаружения NP и SP в образцах NPS, охватывающих диапазон значений Ct от 12,8 до 26,2, и смогли обнаружить SP и NP в образцах со значением Ct <22 (рис. S7).

    Связь между инфекционным вирусом и обнаружением антигена

    Чтобы определить, в какой степени антигенные анализы соответствуют количеству инфекционного вируса в образце, мы подвергли 48 SARS-CoV-2 RT-PCR-положительных НПВ вирусам.Сообщалось, что трансмембранная сериновая протеаза 2 (TMPRSS2) действует при праймировании пика SARS-CoV-2 для входа 23 , и поэтому мы выбрали использование как дикого типа, так и клональной популяции экспрессирующих TMPRSS2 (VE6-TMPRSS2-h20). ) Vero E6 клетки (рис. S8). Как показали цитопатические эффекты, а также ОТ-ПЦР из супернатантов клеточных культур, SARS-CoV-2 был выделен из 35/48 и 38/48 образцов NPS с клетками Vero E6 и VE6-TMPRSS2-h20 соответственно. Интересно, что супернатанты клеточных культур от клеток VE6-TMPRSS2-h20 дали положительный результат на 3-5 циклов раньше, чем супернатанты от клеток Vero E6, что указывает на эффективность продукции вируса в ~ 10-40 раз (рис.S9). В целом инфекционный SARS-CoV-2 был выделен из всех образцов, показывающих значения Ct ≤24,5. Затем мы сравнили анализ антигена с выделением вируса из соответствующих образцов и наблюдали, что все образцы со значениями Ct ≤24,5 оказались положительными в анализе NP (рис. 2а). Из образцов со значениями Ct> 24,5 все дали отрицательный результат в анализе TR-FRET NP, а SARS-CoV-2 был восстановлен только из одного (Ct 24,87). При использовании оптимизированных условий с общим количеством меченых антител 12 нМ чувствительность анализа NP по сравнению с выделением вируса составила 97.4% (37/38). Производительность теста SP была хуже; только 8/38 образцов с восстанавливаемым SARS-CoV-2 дали положительный результат (рис. 2b).

    Рисунок 2.

    Сравнение обнаружения антигена на основе TR-FRET и количества вируса, проанализированного с помощью ОТ-ПЦР SARS-CoV-2 и выделения вируса из образцов НПВ. Общая концентрация антител в анализах составляет 12 нМ (6 нМ Eu- и 6 нМ антитела, меченного AF647). а) Результаты анализа против NP. б) Результаты анализа анти-RBD. Ось Y (логарифмическая шкала) показывает кратное увеличение отношения HTRF (HTRF , образец / HTRF буфер ), измеренное непосредственно после пипетирования образцов на планшете.По оси абсцисс показано значение Ct, измеренное в диагностической ОТ-ПЦР SARS-CoV-2. Горизонтальная черная линия представляет собой границу положительного результата теста на антиген, соответствующую среднему значению плюс четыре стандартных отклонения сигналов, индуцированных отрицательными образцами ОТ-ПЦР SARS-CoV-2. Вертикальная черная линия разделяет образцы НПВ с положительной (n = 48) и отрицательной (n = 96) ОТ-ПЦР SARS-CoV-2. Цвет на графиках указывает на наличие (красный) или отсутствие (синий) цитопатического эффекта (ЦПЭ) после инокуляции клеток VE6-TMPRSS2-h20 50 мкл образца NPS, черный = не культивированный.TR-FRET = резонансный перенос энергии Фёрстера с временным разрешением, NP = нуклеопротеин, RBD = рецептор-связывающий домен, HTRF = гомогенная флуоресценция с временным разрешением.

    Ложноположительная реакция и перекрестная реактивность

    После того, как общая концентрация антител в 12 нМ была идеальной для проведения анализа, нам было интересно узнать частоту ложноположительных результатов. С этой целью мы протестировали в тестах на антиген TR-FRET 96 SARS-CoV-2 ОТ-ПЦР-отрицательных образцов НПВ. Параллельно мы изучали потенциальную перекрестную реактивность выращенных на культуре клеток сезонных коронавирусов простуды hCoV-229E и hCoV-NL63 в анализах TR-FRET.Среди образцов NPS с отрицательными результатами ОТ-ПЦР SARS-CoV-2 только один дал положительный сигнал HTRF. Мы повторно проанализировали этот образец с помощью другого анализа RT-PCR (Xpert Xpress SARS-CoV-2, Cepheid), подтвердив отрицательный результат. Чтобы оценить антиген-специфичность сигнала, мы также проанализировали этот образец, используя несовпадающие комбинации меченых антител против NP и против RBD. Все комбинации дали положительный результат, что свидетельствует о том, что меченые антитела связывают не только антигены, но и нечто иное.При использовании оптимизированных условий с общим количеством меченых антител 12 нМ специфичность анализов NP и SP TR-FRET по сравнению с RT-PCR составила 99,0% (95/96), а по сравнению с выделением вируса — 100% (10/10). Затем мы установили в качестве пороговых значений для анализов TR-FRET среднее значение плюс четыре стандартных отклонения сигналов от SARS-CoV-2 RT-PCR отрицательных образцов NPS (за исключением одного выброса). При использовании этих пороговых значений ни hCoV-229E, ни hCoV-NL63 не давали значимого сигнала TR-FRET в анализе NP или SP (рис.3). Результаты со значениями отсечения, выбранными с использованием отрицательных образцов NPS, совпадали с результатами произвольных отсечений, использованных ранее, и суммированы на рис. 2.

    Рисунок 3. Анализ перекрестной реактивности

    SARS-CoV-2 TR-FRET на антиген, оцененный с помощью супернатанты культур клеток сезонных коронавирусов человека hCoV-229E и -NL63. a) Результаты анализа анти-NP с супернатантами культур клеток HCoV-229E и -NL63 при различных разведениях. б) Результаты анализа анти-NP с супернатантами культур клеток HCoV-229E и -NL63 при различных разведениях.Ось Y (логарифмическая шкала) показывает кратное увеличение отношения HTRF (образец HTRF / буфер HTRF ). Горизонтальные линии указывают соответствующие пороговые значения анализа TR-FRET. УФ-инактивированный SARS-CoV-2, содержащий супернатант клеточной культуры, включен в качестве положительного контроля.

    ОБСУЖДЕНИЕ

    Эпидемия SARS-CoV-2, начавшаяся в Китае в конце 2019 года, быстро переросла в пандемию весной 2020 года. После первоначального отставания в наращивании возможностей тестирования ОТ-ПЦР быстро стала золотым стандартом острой атипичной пневмонии. -CoV-2 диагностика.Хотя ОТ-ПЦР очень чувствительна к выявлению людей с острой инфекцией, недостатком является то, что пациенты, выздоравливающие от COVID-19, могут оставаться положительными на ОТ-ПЦР в течение длительного периода. С другой стороны, тестирование на антигены несколько менее чувствительно для выявления пациентов с острой инфекцией; тем не менее, похоже, что существует лучшая корреляция между присутствием антигена и инфекционного вируса в образцах NPS. В этой рукописи мы описываем разработанный в лаборатории тест для обнаружения антигена SARS-CoV-2 в образцах НПВ и сравниваем его эффективность с выделением вируса и ОТ-ПЦР.Анализ является быстрым и очень простым в использовании, кроме того, анализ довольно несложен в настройке при условии, что доступны специфические антитела против структурных белков вируса. Хотя мы используем в анализе поликлональные антитела, его, вероятно, можно было бы настроить с помощью моноклональных антител. Флуорофоры (хелатный Eu и AlexaFluor 647) легко доступны, и результаты можно прочитать на любом считывающем устройстве для микропланшетов, способном измерять флуоресценцию с временным разрешением. Примечательно, что мы настроили анализ в содержащем детергент буфере RIPA, который содержит 1% NP-40 и 0.1% SDS, оба из которых инактивируют SARS-CoV-2 21,22 . Таким образом, сбор образцов НПВ непосредственно в эту матрицу значительно повысил бы безопасность конечного пользователя.

    Мы настроили анализ для обнаружения как NP, так и SP SARS-CoV-2, но наблюдали четкую разницу между LOD в двух анализах с NP, обнаруживаемым примерно в 35 раз более низкой концентрации. Вероятно, это объясняется тем, что мы использовали антитело, направленное против RBD, которое составляет лишь около одной шестой SP.Тот факт, что используемое антитело распознает только один домен, может сделать стерически невозможным для двух молекул антитела связывание одной молекулы SP, и поэтому мы предполагаем, что полученный сигнал исходит от тримеров SP, то есть шипов. NP более многочисленны как в вирионах, так и в инфицированных клетках (см. Рис. S7), что дополнительно способствовало более высокой чувствительности обнаружения NP в супернатантах клеточных культур и образцах NPS.

    Анализ эффективности анализа антигена с использованием образцов NPS от 48 SARS-CoV-2 RT-PCR-положительных и 96 отрицательных лиц показал, что анализ NP правильно идентифицировал 37 положительных образцов и все отрицательные образцы, кроме одного.Все 37 истинно положительных результатов имели значение Ct <25 циклов диагностической ОТ-ПЦР. Как и в других исследованиях, мы наблюдали сильную связь между инфекционностью образца и положительным результатом теста на антиген; из 38 образцов, которые дали изолят 37, дали положительный результат в анализе NP. Мы использовали 50 мкл для выделения вируса, в то время как для анализа антигена требуется только 10 мкл, что может объяснить, почему один из образцов с инфекционным вирусом не был взят. Мы намеренно выбрали образцы NPS в широком диапазоне значений Ct в ОТ-ПЦР SARS-CoV-2, чтобы получить оценку предела обнаружения по сравнению с ОТ-ПЦР.Тот факт, что мы проанализировали образцы, которые не были собраны в свежем виде и были подвергнуты по крайней мере одному циклу замораживания-оттаивания, мог отрицательно повлиять на чувствительность анализа. В любом случае наш тест смог обнаружить 97,4% образцов NPS с инфекционным вирусом.

    Поскольку анализы антигенов NP и SP дали положительный результат для одного отрицательного образца ОТ-ПЦР SARS-CoV-2, мы повторно проанализировали его с помощью другой ОТ-ПЦР с отрицательным результатом. Мы также попытались выделить вирус из образца, но безуспешно.Не исключено, что ложноположительный результат является результатом перекрестной реактивности на человеческий коронавирус, hCoV, инфекцию. Из hCoV только hCoV-NL63 и SARS-CoV используют тот же рецептор, что и SARS-CoV-2, то есть ангиотензинпревращающий фермент 2 (ACE2) 24,25 . Таким образом, было бы наиболее логично, что реактивность этого образца будет обусловлена ​​hCoV-NL63, поскольку анализы SP (на основе RBD) и NP дали положительный результат. Тем не менее, мы протестировали два анализа с использованием hCoV-229E и hCoV-NL63, выращенных в культуре клеток, но с отрицательными результатами.Похоже, что образец, дающий ложноположительную реакцию, содержал мешающее вещество, которое вызывало агрегацию иммуноглобулинов, потому что также меченые антитела против различных антигенов давали сигнал TR-FRET. Использование антител с несовпадением может в будущем служить для различения истинных и ложноположительных результатов в анализе TR-FRET.

    В заключение мы сообщаем о разработке быстрого теста на антиген SARS-CoV-2, основанного на одновременном связывании двух или более молекул антител, меченных флуорофором, с антигеном.Тест на антиген на основе TR-FRET выполняется быстро, и его результаты хорошо коррелируют с наличием инфекционного вируса в клинической пробе. Анализ легко настроить, если доступны подходящие антитела против SARS-CoV-2 NP и планшет-ридер, позволяющий измерять TR-FRET. По нашим оценкам, один считыватель планшетов и опытный техник могут вручную анализировать сотни образцов в час, в идеале с 30-минутным временем обработки от прибытия образца до получения результатов (подробности см.

    Author:

    Добавить комментарий

    Ваш адрес email не будет опубликован.

    Белковая пара Максимум возбуждения донора
    (нм)
    Максимум эмиссии акцептора
    (нм)
    Квантовый выход донора Коэффициент молярной экстинкции акцептора Яркость акцептора 17
    EBFP2-mEGFP 383 507 0.56 57,500 4,8 1: 2
    ECFP-EYFP 440 527 0,40 83,400 4,9 1: 4 528 0,62 92,200 5,4 1: 2
    MiCy-mKO 472 559 0,90 51,600 492 528 0.85 92,200 5,1 1: 1
    CyPet-YPet 477 530 0,51 104 000 5,1 1: 4,5
    610 0,60 72,000 5,1 2,5: 1
    Venus-mCherry 528 610 0,57 72,000 5,7 528 581 0.57 138,000 5,9 1: 2
    Venus-mPlum 528 649 0,57 41,000 5,2 13177