Грета ттх: Технические характеристики автомобилей Hyundai Creta / Хундай Крета

Содержание

плюсы и минусы Daewoo Gentra

Взял Gentra полтора года назад, накатал уже 39 тысяч и вот какие достоинства и недостатки, в основном по сравнению с предыдущей Нексией.Достоинства: мы имеем более мощный автомобиль, с улучшенной безопасностью, управляемостью и динамикой.Не все разделяют этот взгляд — да — Daewoo Gentra это переработка Лачетти, однако все не так плохо, как пишут те, кому не повезло с конкретным экземпляром.Во первых более динамичный двигатель — цепной, чуть более громкий, чем у Нексии, однако весьма надежный. Уже 39 т. км., но по движку ничего, ттт. Да и, собственно, все остальное не вызывает нареканий.Дисковые тормоза спереди и сзади заметно лучше, чем у Нексии. Зимой машина не идет юзом, на шипованой резине. Заводится всегда «с полпинка», хотя и стоит на улице. И это учитывая то, что я всегда использую автоподзавод с сигнализации, то есть нет выжимания педали сцепления. Езжу я весьма активно и в любую погоду, что видно по накатанному километражу. Печка показалась немного слабее Нексиевской, но ее вполне хватает. Кондиционер довольно мощный — не то что у Нексии — там включаешь и сразу минус один цилиндр по мощности, да и дует еле-еле. Тут же с кондером все в порядке.Что еще — две подушки безопасности, удобный подлокотник и две полочки спереди, дефлекторы печки под передними сиденьями к ногам задних пассажиров, откидывающиеся задние сиденья, электрозеркала и пр.Из минусов: автомобиль «сыроват» однако это относится ко всяким мелочам, не касаясь основных функций. Пластик в салоне выглядит непрезентабельно, оформление приборной панели, так сказать, бедновато и другая ерунда. Например, центральные и боковые дефлекторы обдува имеют немного разную температуру — боковые чуть теплее — когда направляешь их на себя — это чувствуется. Клиренс немного меньше, чем у Нексии — и нижняя точка расположена не между передних колес, а в 40 сантиметрах за ними — вроде проехал и тут задеваешь.Но это все мелочи, а в целом за свои деньги машина стоящая — в обслуживании неприхотлива и недорога. Я могу лишь предположить — почему у некоторых изредка есть неполадки еще на ранних стадиях. В Узбекистане эту обкатанную модель (читайте о «платформе J200» — первая же ссылка в яндексе) начали производить в 2013 году. Так как модель была нераскручена, то продажи 2013-го года выпуска продаются и в 15 и в 16-м годах. Вы представляете — машина 2-3 года стояла под открытым небом и не эксплуатировалась. Естественно, у нее многие комплектующие пришли в негодность — ведь известно — и дом, и машина без использования разрушаются гораздо быстрее.Так что совет — берите Gentrа не более чем годовой давности. Даже при наличии серьезных скидок (мне предлагали 2013-го аж на 70 т. р. дешевле).Пользуйтесь Gentra с уважением и осторожностью — и машина прослужит вам долго и верно!

The Drive о турецких дронах-камикадзе Kargu и атаке роем БПЛА


Турция создает рои беспилотников-камикадзе, которые может не только использовать в своих целях, но и экспортировать. Об этом пишет автор издания The Drive Джозеф Тревитик.

Основные характеристики беспилотного дрона Kargu


Турецкая компания Defense Technologies Engineering and Trade Inc., также известная по турецкой аббревиатуре STM, поставляет вооруженным силам Турции дроны-камикадзе Kargu вертолетного типа с 2017 года. В 2019 году начались первые поставки усовершенствованных дронов Kargu-2.

В январе 2020 года правительство Турции заключило договор о приобретении 356 дронов, а позже стало известно, что к 15 июня 2020 года компания должна была поставить более 500 беспилотников. Идет ли речь о новых 500 дронах или в эту цифру включается 356 дронов, о которых говорилось ранее, пока неизвестно.

Компания-производитель подчеркивает, что беспилотные летательные аппараты Kargu-2 предназначены для борьбы с террором и «асимметричной войны». Вес БПЛА составляет всего 15 кг. При этом Kargu-2 может находиться в воздухе до 30 минут.

Управление беспилотником осуществляется оператором с земли. Оператор может направлять дроны на любые объекты, в том числе и движущиеся. Если дроны не уничтожили цель, то они могут вернуться к оператору для последующего использования.


Как пишет Джозеф Тревитик, каждый такой беспилотный летательный аппарат может быть оснащен боезарядами разных типов – осколочным для поражения личного состава противника и других небронированных целей, кумулятивным для атаки на легкобронированные угрозы, термобарическим для поражения целей в замкнутом пространстве. Помимо этого, дрон может быть использован для поражения неподвижных целей.

Полуавтономный режим использования беспилотника предполагает, что Kargu может самостоятельно обнаруживать и поражать цели, а оператору остается лишь направить его в определенную зону. При необходимости оператор может отменить атаку дрона или перенаправить его на другую цель.


На видеокадрах мы можем наблюдать, как действуют на практике беспилотные камикадзе Kargu.

Джозеф Тревитик обращает внимание на очевидный успех турецкой военной промышленности в деле создания дронов-камикадзе, поскольку прежде пионером в данной отрасли был Израиль, несомненно, более развитый в технологическом отношении, чем Турция.

Атака роем: какие преимущества новой технологии


Что самое интересное, в 2019 году компания-производитель беспилотных аппаратов-камикадзе STM объявила о работе над предоставлением дронам Kargu дополнительной автономии, а также возможности действовать вместе в рамках одного большого скопления («роя») дронов.

Технология атаки роем разрабатывается в рамках специальной правительственной программы, направленной на улучшение возможностей беспилотных летательных аппаратов. Понятно, что возможность одновременного использования до 29 беспилотных камикадзе значительно увеличит результативность атак турецких вооруженных сил.

Колонны и конвои из легких бронеавтомобилей и обычных грузовиков и внедорожников, склады боеприпасов, находящиеся на базах самолеты – все эти объекты превосходно поражаются с помощью дронов Kargu.

Если же в дело вступит рой дронов, то он сможет подавить оборону противника и с гораздо большей эффективностью поразить цели.


Как отмечает автор The Drive, разрабатываемая турецкой компанией STM технология роения может впоследствии быть применена и к другим беспилотным летательным аппаратам и боеприпасам. По мнению Тревитика, уже сейчас Турцию можно назвать локомотивом мирового производства БПЛА. При этом возможности и технологии турецких дронов активно испытываются в обстановке реальных боевых действий в Ливии и Сирии.

Не исключено, что будут наращиваться и темпы экспорта БПЛА турецкого производства. Не случайно глава Центрального командования США генерал морской пехоты Кеннет МакКензи утверждает, что будущее в сфере воздушных атак будет принадлежать именно беспилотным летательным аппаратам.

ТОП-10 красоток из американских фильмов 1920-1950 гг | Авто ЮГ

Друзья, всем привет! Сегодня мы с вами посмотрим на красивейших женщин с противоположного континента. Да не простых, а актрис. Бытует мнение, что раньше фигуры были другие, а теперь барышни, как селёдки. Действительно ли это так мы проверим по фотографическому материалу, который я для вас, уважаемые подписчики и читатели канала, бережно собрал. Голливуд всегда славился своими яркими представительницами, думаю, Фабрика Мечт не подкачает и в этот раз. Поехали!

Mae West

Mae West

Американская актриса Mae West прямиком из 1930-х годов. Талантливая, блистательная, артистичная, харизиматичная, статная — что ещё нужно, чтобы покорить зрителя?

Diahann Carroll

Diahann Carroll

А вот перед нами «шоколадка» Diahann Carroll. Есть мнение, что женщины с короткими стрижками привлекают противоположный пол реже, но сильнее, чем с длинными. Лично я так не думаю. Дело-то в человеке, а не его ТТХ!

Rita Moreno

Rita Moreno

А вот и Rita Moreno собственной персоной. Это уже 1955 год. Самый расцвет автомобильной моды и авиакосмической темы в их дизайне. Мне нравится США того периода. А какие женщины, вы только посмотрите!

Greta Garbo

Greta Garbo

Дальше нам позирует Greta Garbo. Аристократичная внешность и изысканные манеры не помешали ей воплотиться в актёрском амплуа. Возможно, многие помнят фильмы с её участием, как их можно забыть?

Bette Davis

Bette Davis

И снова на сцене прекрасная Bette Davis из 30-х годов. Неудивительно, что тогда в моде были столь яркие и стремительные образы, ведь в стране был экономический кризис, Великая Депрессия. Чтобы они там без женщин делали?..

Veronica Lake

Veronica Lake

Великая и несравненная королева нуара Veronica Lake. Все смотрели детективы с её участием. Людям, даже далёким от кинематографа не может не запомниться Такая леди. Не будет преувеличением назвать её образ идеальным для своего времени.

Audrey Hepburn

Audrey Hepburn

А вот и наша «ювелирная» Audrey Hepburn гостья. Помните, какие солнцезащитные очки она рекламировала в том фильме? Нет?! Тогда срочно пересмотрите шедевр с её участием. Критики сегодня говорят, что фильм заурядный, с ними я не согласен!

Dorothy Dandridge

Dorothy Dandridge

Ещё одна претендентка на роль самой обаятельной и привлекательной. Зовут её Dorothy Dandridge. Она снималась в 50-х гг, отметилась в ряде кинокартин. Не все из них известны советскому обывателю. А очень напрасно, посмотрите!

Lauren Bacall

Lauren Bacall

Резкий, как чёрно-белое кино, образ Lauren Bacall навсегда остался в истории. Девушка снималась в нуаре, драмах и даже комедиях. Всегда исполняла свои роли на отлично, что не удивительно.

Anna May Wong

Anna May Wong

Первая китайская актриса в США. И зовут её Anna May Wong. Не думаю, что нужно объяснять, какой фурор вызывали её работы. Впрочем, потом были и другие звёзды, но первой стала именно она.

Вот и подошёл наш хит-парад к концу. Думаю, именно такие материалы помогают людям на разных континентах быть ближе и не испытывать вражду.

Спасибо за просмотры, подписывайтесь на канал и ставьте лайк!

Рено Дастер технические характеристики, ТТХ, сколько весит и описание

Общая информация о Дастере

Автомобилестроительная компания Рено представила мировой общественности на продажу свой внедорожный автомобиль, получивший название Дастер, 10 лет тому назад. Сначала собирали Рено Дастер на мощностях румынского автомобильного концерна Dacia. Под этой маркой и сейчас Дастер продается в ряде европейских стран. Уже после на рынок вышла полностью идентичная машина, но только уже под французским брендом Renault. Отметим также, что производство популярной модели осуществляется в нескольких странах мира. При повышенном спросе, многих потенциальных покупателей интересуют технические характеристики данной машины, а также интересует вопрос, сколько весит она, и об этом мы расскажем ниже.

Многие современные модели принадлежащие концерну Рено имеют схожие ттх с Рено Дастер, поскольку базируются они все на единой платформе В0. Также эта платформа была задействована в производстве некоторых моделей марки Nissan. Также для рынка Южной Америки выпускается Duster в кузове пикап.

Данный автомобиль производят с системой полного и переднего привода. Российским потребителем он доступен в 7-и комплектациях, среди которых присутствует такая версия как Dakkar. Каждая модификация без исключения имеет свои коробки передач и силовые агрегаты.

За то время, пока существует эта популярная модель от Рено, она прошла всего лишь одну генерацию, и получила изменения в ттх.

Вес Renault Duster рестайлинг 2015 года

Зависимость веса Renault Duster первого поколения в килограммах от объема мотора, типа коробки передач и привода представлена в таблице:

Объем мотора1,51,62,0 АКПП2,0 МКПП
передний привод1190
полный привод1390136013941370

Если сравнить приведенные данные с цифрами из предыдущего раздела видно, что максимальное изменение веса в меньшую сторону составило всего 15 кг. Концерн Рено явно не ставил своей целью достижение лучших скоростных характеристик за счет снижения этого показателя. Основной целью проведения рестайлинга было обновление внешнего вида и интерьера, а также линейки силовых агрегатов.

Габаритные размеры Дастера

Технические характеристики, касающиеся габаритных размеров, в модели меняются, зависимо от модификации. Кроссовер, выпускаемый в период 2011-15 гг., имеет такие показания:

  • Длина – 4315мм;
  • Высота составляет 1695мм;
  • Ширина – 1822мм;
  • Дорожный просвет модели – 190мм;
  • Колесная база – 2673мм.

Точно такие же показатели имеет и новая модификация автомобиля. Их разница заключается лишь в размере дорожного просвета. У текущего поколения Рено Дастер этот самый показатель – 200мм. При этом любая генерация имеет одинаковый угол съезда, равный 35-градусов, и угол въезда, равный 30-градусов.

Машины с системой переднего привода оснащены багажником на 475л., если сложить задние спинки кресел, то объем увеличится до 1636л. В Рено Дастер с системой полного привода объем отделения багажника составляет 409л.

Запасное колесо Рено Дастер

Запаска в полноприводной и переднеприводной машине размещается в разных местах. Различия обусловлены конструкцией подвесок. В моноприводной версии запасное колесо крепится на специальных кронштейнах под днищем автомобиля. Таким образом, освобождается дополнительное место в багажнике, но грязное колесо неудобно менять в дороге.

В полноприводной версии запасное колесо находится в специальном пенале под фальшполом

В полноприводной версии запаска размещается под фальшполом в специальном контейнере с дополнительными выемками под инструменты и другие мелочи. Для России такой вариант более предпочтительный. Даже в ненастную погоду колесо чистое. Минусы заключаются в уменьшении багажного отделения до 67 литров и трудном доступе к колесу под фальшполом. Чтобы добраться до запаски потребуется разгрузить багажник. Смотрите видео, как трансформировать фальшпол.

Трансформация фальшпола в багажнике

Удобный фальшпол багажника

Ходовые характеристики французской модели от Рено

Технические характеристики рассматриваемого нами сегодня автомобиля по ходовой части тоже изменяются, зависимо от комплектации. Кроме этого, в версиях Рено Дастер с системой переднего привода имеется задняя полунезависимая подвеска, оснащенная торсионной балкой. С системой полного привода модель имеет многорычажную заднюю подвеску. Муфта GKN между колесами авто перераспределяет непосредственно крутящий момент и на такой скорости как 80км/час может быть заблокирована.

Спереди на всех комплектациях установлена подвеска McPherson, и она независимая. Такаже имеются стойки с наполненными газом амортизаторами, что позволяет сделать езду более комфортной. И это далеко не все технические характеристики модели, разберем все ниже по порядку, в том числе узнаем, сколько весит популярный в нашей стране кроссовер.

Каждая версия «француза» оснащена колесными 16-дюймовыми дисками. Что касается тормозной системы, то сзади установлены барабанные тормоза, а спереди, вентилируемые дисковые тормоза.

Силовые установки на Дастере

Все мы знаем, что самые главные технические характеристики в любом автомобиле определяются типом установленного силового агрегата, а не тем, какие габариты, сколько весит и так далее. То же самое можно сказать и про Рено Дастер. Популярная модель второй генерации получила такие силовые установки:

  • Бензиновый мотор объемом 1.6л.;
  • Бензиновый двигатель 2л.;
  • Дизельный турбированный агрегат объемом 1.5л.

Каждый из представленных бензиновых агрегатов ставится на все без исключения модификации рассматриваемой нами популярной в нашей стране модели, а вот дизельная силовая установка ставится лишь на Дастер с системой полного привода. Количество клапанов у бензиновых агрегатов 16, у дизельной версии – 8, а количество цилиндров одинаковое – 4.

Подлокотник на Рено Дастер

Руководство по эксплуатации Рено Дастер

Что лучше Дастер или Ховер

Параметры и размер салона Дастер

Далее предлагаем изучить размеры салона нашего Рено Дастер, это поможет многим потенциальным покупателям понять уровень комфортабельности.

Общие характеристики салона:

  • Ширина внутри машины на уровне локтей составляет спереди 1411мм, сзади 1438мм.
  • Ширина внутри салона на уровне плеч составляет спереди 1387мм и сзади – 1400мм.
  • Высота салона составила 1020мм.
  • При открытой задней двери проем составит 710мм. Этот параметр следует учитывать, если машину вы планируете ставить в гараж, так как к 2000мм ширины авто, можно прибавить по 710мм.

Задний ряд кресел:

  • Высота от пассажирского кресла до крыши составляет 935мм.
  • Расстояние между кресел регулируется в пределах 150-380мм.

Передний ряд кресел:

  • Расстояние от передней панели и кресла составляет 370-560мм в зависимости от регулировки.
  • Высота посадки также регулируется и составляет 270-300мм.
  • Высота от кресла до крыши варьируется в пределах 950-980мм.

С точки зрения комфорта, в любом положении будет удобно, несмотря на небольшие габариты Renault Duster. Удобно и комфортно будут себя чувствовать в машине даже люди, рост которых превышает средний. А это большой плюс.

В любом случае, не стоит забывать о том, что данная модель принадлежит к бюджетному сигменту. Это замечается по отделке внутри, пластик применяется недорогой, следовательно в авто вы не найдете никаких технических дополнительных новшеств и про изыск придется забыть. Передние кресла не имеют боковую поддержку.

Парктроник штатный на Рено Дастер

Замена ремня ГРМ Рено Дастер

Задний бампер Рено Дастер

Показатели мощности модели от Рено

Рено Дастер, равно как и некоторые другие автомобили, производимые на платформе В0, имеют в базовом оснащении бензиновую силовую установку с распределенным впрыском, которая изготавливается на автомобильном заводе в городе Тольятти. Данный мотор способен выдавать мощность 102л/сил. Крутящий момент мотор развивает 145Нм. Указанные показатели доступны при 5500 оборотах в минуту.

2-литровый бензиновый агрегат имеет мощность 143л/сил при оборотах в минуту 5750. При этом максимальный крутящий момент составляет 195Нм.

Версия Renault Duster с турбированной дизельной установкой, которая кроме прочего имеет непосредственный впрыск, имеет такие характеристики: мощность составляет 109л/сил, крутящий момент 240Нм на 1750об/мин.

Базовая комплектация машины оснащена мотором 1.6л. и работает на пару с механической 5-ступенчатой КПП. Модель с мотором 2л. предлагается потенциальным покупателям с механической 6-ступенчтой КПП или с автоматической 4-ступенчатой КПП. Турбодизель имеет одну единственную механическую 6-ступенчатую КПП. Продолжаем разбирать технические характеристики сверхпопулярного Дастера, в том числе расскажем, и сколько весит кроссовер.

Технические характеристики Рено Дастер

Компактные размеры позволяют Renault Duster комфортно чувствовать себя как в мегаполисе, так и на бездорожье. Длина нового авто – 4341 мм, ширина – 1804 мм, высота – 1621 или 1633 мм. Колесная база – 2673 мм. Такие габариты дают возможность водителю легко маневрировать и парковаться даже в тесном городском дворе.

Большой багажник универсален. Минимального объема в 428 литров достаточно для ежедневных задач – купить продукты в супермаркете, отвезти вещи на дачу, доставить чемоданы в аэропорт. Максимальный объем в 1761 литр рассчитан на загородный активный отдых с лыжами, сноубордами или горными велосипедами.

Бордюры мегаполиса, высокую траву, глубокую колею и лужи машина легко преодолеет благодаря клиренсу 210 мм.

Кроссоверу досталась роскошная гамма моторов. Вы можете выбрать один из бензиновых агрегатов мощностью от 114 до 150 л.с. и объемом от 1,4 до 2 л или дизель на 1,5 л и 109 л.с. Дизельная установка оборудована системой Common Rail. Достойную пару двигателям составляет механика 5 или 6 ступеней, а также бесступенчатый автомат. Привод – на передние или на все колеса.

Машина разгоняется до 194 км/ч, а для набора первой сотни ей требуется не больше 13,3 с. Расход топлива – от 5,3 до 8 л на 100 км пути (смешанный цикл).

Емкость бака для топлива – 50 литров. Это больше 600 км без дозаправки!

Показатели скорости Дастер 1 и 2 генерации

Скоростные показатели рассматриваемой машины, конечно же, будут отличаться в зависимости от модификации. В базовой комплектации авто с турбированным дизельным агрегатом способен разогнаться до 167км/час. Разгоняется при таких показателях машина за 11-секунд до 100км/час. Модель с 2-литровым мотором разгоняется с места до 100км/час за 11.5-секунд, и имеет максимальную скорость 174км/час. Версия с механической трансмиссией и бензиновым движком разгоняется с места до 100км/час за 10.3-секунды, максимальная скорость – 180км/час.

Показатели топливного расхода на Рено

Пришло время раскрыть технические характеристики по топливному расходу в модели из Франции Renault Duster. Расход горючего, конечно же, зависит от типа силовой установки, а также от того, какой вес, сопутствующее оснащение, и ряда других показателей. В базовой комплектации можно добиться таких показателей:

  • По трассе – 6.3л.;
  • По городу – 9.3л.;
  • В смешанном цикле – 7.4л.

Модификация с системой полного привода, оснащенная базовым движком и механической 6-ступенчатой КПП обладает такими показателями:

  • По трассе – 6.8л.;
  • По городу – 9.1л.;
  • В смешанном цикле – 7.6л.

Машина, оснащенная мотором объемом 2л. и автоматической КПП:

  • По трассе – 7.2л.;
  • По городу – 11.3л.;
  • В смешанном цикле – 8.7л.

Самыми выгодными характеристиками обладает авто с 2-литровым агрегатом и механической КПП:

  • По трассе – 6.5л.;
  • По городу – 10.1л.;
  • В смешанном цикле – 7.8л.

Самой экономичной признана дизельная версия кроссовера. Агрегат на дизельном топливе расходует топливо следующим образом:

  • По трассе – 5л.;
  • По городу – 5.9л.;
  • В смешанном цикле – 5.3л.

Разница в топливных показаниях, как мы писали выше, может меняться в зависимости не только от ттх модели. Как известно, от того, какая комплектация, меняется и вес машины. Недаром, многих интересует вопрос, сколько весит «француз»? Ответ таков: масса его варьируется в пределах 1190-1435кг. Теперь кроме всего прочего вы знаете, и сколько весит Renault Duster.

Используемые двигатели

Основные технические характеристики автомобилей определяются типом используемой силовой установки. Под капотом Дастер 2 скрываются следующие двигатели:

  • 1,6- и 2-литровый бензиновые;
  • 1,5-литровый турбодизель.

Моторы, работающие на бензине, устанавливаются на все модификации Рено Дастер, а турбированный дизельный — только на полноприводные версии. Число клапанов и цилиндров у моторов одинаковое и составляет соответственно 16 (у дизеля

и 4.

Мощность

Базовый агрегат бензиновый с распределенным впрыском производится на толльятинском автозаводе и используется на ряде других моделей, основанных на платформе В0. Этот двигатель выдает до 102 (в некоторых источниках указаны 114) л.с. мощности. Также базовый агрегат развивает до 145 (156) Н/м крутящего момента. Эти показатели доступны соответственно при 5500 и 4000 об/мин.

Бензиновый мотор объемом 2 литра развивает порядка 143 л.с. мощности при 5750 об/мин. Максимальный крутящий момент у этого агрегата равен 195 Н/м, доступные при 4000 об/мин.

Турбодизельная версия Дастера с непосредственным впрыском топлива обладает следующими характеристиками:

  • мощность — 109 л. с. при 4000 об/мин;
  • максимальный крутящий момент — 240 Н/м при 1750 об/мин.

В базовой комплектации вместе с 1,6-литровым силовым агрегатом устанавливается 5-ступенчатая механическая КПП. В версиях с 2-литровым мотором на выбор предлагаются 6-ступенчатая «механика» и 4-диапазонный «автомат». Турбодизельный двигатель дополняется 6-ступенчатой МКПП.

Скорость

Скоростные характеристики также отличаются у разных модификаций французской модели. Дастер в базовом и турбодизельном исполнении способен выдавать до 167 км/ч. При этом разгон до 100 км/ч занимает соответственно 10,9 и 13,2 секунды. Максимальная скорость у модели с 2-литровым двигателем ограничена отметкой 174 (версия с АКПП) и 180 (с МКПП) км/ч. В первом случае на разгон до 100 км/ч уходит 11,5 секунды, а во втором — 10,3 секунды.

Расход топлива

Расход топлива у Рено Дастер зависит не только от типа двигателя, но и сопутствующего оснащения. Характеристики базовой комплектации позволяют добиться следующих показателей:

  • городской цикл — 9,3 литра;
  • трасса — 6,3 литра;
  • смешанный цикл — 7,4 литра.

Полноприводная модификация с базовым двигателем и 6-ступенчатой МКПП отличается следующими характеристиками:

  • городской цикл — 9,1 литра;
  • трасса — 6,8 литра;
  • смешанный цикл — 7,6 литра.

Рено Дастер, оснащенный 2-литровым двигателем и автоматической КПП, потребляет при движении в городе 11,3 литра, на трассе 7,2 литра и в смешанном цикле 8,7 литра. Лучшими характеристиками в плане расходования топлива обладает аналогичная версия с механической КПП. В этом случае кроссовер потребляет соответственно 10,1, 6,5 и 7,8 литра.

Самым экономичным считается дизельная модификация Рено Дастер. Двигатель на тяжелом топливе потребляет в городских условиях порядка 5,9 литра, на трассе 5 литров и в смешанном цикле 5,3 литра.

Разница в показателях расхода объясняется не только характеристиками автомобиля. В зависимости от комплектации модели меняется общий вес. Этот показатель варьируется в пределах 1190-1435 кг.

Какие бывают комплектации у Рено Дастер

Автомобилестроительная компания Рено выпускает свой популярный кроссовер в 4-ех комплектациях:

  • Privilege;
  • Authentique;
  • Expression;
  • Luxe Privilege.

Технические характеристики данного авто определяются в большинстве своем типом комплектации, ведь каждая версия имеет свои силовые агрегаты. Добавим, что гидроусилитель руля имеется в кроссовере независимо от модификации. В 2-ух самых богатых комплектациях машина оснащена системой «круиз-контроль», благодаря чему повышена комфортабельность и безопасность.

Богатые комплектации Renault Duster оснащены:

  • Несколькими подушками безопасности;
  • Системой кондиционирования;
  • Электростеклоподъемниками;
  • Рулем с кожаной отделкой;
  • Парктроником;
  • Аудиосистемой с Bluetooth.

Для российских покупателей еще доступна модель Рено Дастер Дакар, ттх которой почти что не отличаются от остальных модификаций машины. Эта уникальная версия имеет выделяющийся фактурный внешний вид, также она оснащена специальными вставками внутри авто и на кузове.

Версия Дакар по своим характеристикам похожа на комплектацию Privilege. Данная версия является лимитированной и оснащена бензиновой силовой установкой объемом 2л. и системой полного привода. Особенностью данной машины является специальный режим под названием Eco Mode, благодаря которому ускоряется реакция движка при нажатии на педаль газа. Помимо всего прочего, благодаря данному ограничителю понижается отдача мотора и мощность кондиционера, плюс к этому улучшается процесс переключения передач на автоматической КПП.

Каждая из комплектаций Duster обладает самой главной характеристикой: производитель адаптировал моторы непосредственно к российским условиям, то есть агрегат без проблем запускается даже при очень сильных отрицательных температурах воздуха.

Changan CS55 | Обзор, технические характеристики, комплектации и цены нового автомобиля Чанган ЦС55

Чанган Центр АВТОАЛЬЯНС

105082 г. Москва, Спартаковская площадь, д. 1А, соор. 1

alianz.changanauto.ru

+7 (495) 374-64-39

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Автопассаж

117519 г. Москва, Варшавское ш. 138А

autopassage.changanauto.ru

+7 (495) 363-95-95

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр АЦ Кунцево

143026 г. Москва, Горбунова, д. 14

kuntsevo.changanauto.ru

+7 (495) 125-45-60

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр АЦ ОВОД

108820 г. Москва, МКАД 26км (внешняя сторона) вл.13

ovod.changanauto.ru

+7 (499) 281-93-53

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр БИОТЕ

141031 Московская обл. Мытищинский р-он, пос. Нагорное, ул. Центральная вл. 2, стр. 1

torgmash-avto.changanauto.ru

+7 (495) 292-72-43

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Дмитровка

127411 г. Москва, Дмитровское ш. д.157, стр.4

saloncentr.changanauto.ru

8 800 10-00-157

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Новорижский

143421, Московская обл., Красногорский район, автодорога «Балтия», 23 км, владение 2, строение 1, офис 1

novorijskii.changanauto.ru

+7 (499) 968-68-68

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр ОБУХОВ Измайлово

105037 г. Москва, Измайловский пр-д., 8 А

obukhov.changanauto.ru

+7 (495) 775-51-14

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Химки

МО, Химки, МКАД 74 км д5, зал 1

himki.changanauto.ru

8 (800) 333-33-33

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Ясенево

г. Москва, МКАД, 38 км, 6Бс2

yasenevo.changanauto.ru

+7 (495) 021-20-51

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр ABS Cars

050000, г. Алматы, пр. Суюнбая 66/6

abs-invest.changanauto.ru

+7 (727) 367-02-40

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр FRESH Волгоград

400010, г. Волгоград, пр. Жукова, д. 94Д

changanvolgograd.ru

+7 (8442) 200-847

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр FRESH Воронеж

г. Воронеж, Московское шоссе, 12

changanvoronezh.ru

+7 (473) 210-06-35

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр TERRA MOTORS

Казахстан, г. Нур-Султан, ул. Жанажол, 6

terramotors.changanauto.ru

+7 (7172) 54-60-60

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр АВЕРС-АВТО

454003 г. Челябинск, ул. Братьев Кашириных, д.130

avers-auto.changanauto.ru

+7 (351) 2-111-979

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Авто для Вас

350080 г. Краснодар, ул. Горячеключевская, д.2

krd-auto.changanauto.ru

+7 (861) 207-23-40

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Авто-Стандарт

160028 г. Вологда, ул. Ильюшина, д. 28 А

auto-standart.changanauto.ru

+7 (8172) 522-000

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр АвтоВилидж

454128 г. Челябинск, Университетская Набережная, д.68

avtovillage.changanauto.ru

+7 (351) 223-2-031

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Автогалерея

413124 Саратовская обл. г. Энгельс, ул. Студенческая, 205

avtogalereya.changanauto.ru

+7 (8452) 473-473

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Автодилер

664033 г. Иркутск, ул. Старо-Кузьмихинская, д.81д

autocentr-rivolta.changanauto.ru

+7 (3952) 500-544

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Автокласс

300045, г. Тула, Новомосковское шоссе, д.27

tula.changanauto.ru

+7 (4872) 70-90-90

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Автомир

Республика Хакасия, Усть-Абаканский р-н, п. Тепличный, ул. Ленина, 1/1

avtodom19.changanauto.ru

+7 (908) 326-26-59

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Автосити

394065 г. Воронеж, Патриотов пр-т, д. 47

avtositi.changanauto.ru

+7 (473) 200-80-20

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Автостиль Автово

198152 г. Санкт-Петербург, ул. Краснопутиловская, д.65

avtostyl.changanauto.ru

+7 (812) 445-79-43

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Автостиль Гражданский

195267, г.Санкт-Петербург, ул.Ушинского д.12м

avtostyl.changanauto.ru

+7 (812) 445-79-43

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Автостиль Красноярск

660133, г. Красноярск, ул. Партизана Железняка, 46д

changan-autostylekrsk.ru

+7 (391) 222-02-92

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Автотех

390000 г. Рязань, ул. Солнечная д.3

avtoteh-changan.ru

+7 (4912) 24-24-54

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр АвтоФорум

410020, г. Саратов, ул им. Шехурдина, д 2/4

avtoforum.changanauto.ru

+7 (8452) 65-33-55

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Алекс-Авто

450022 г. Уфа, ул. Кирова д.128, корп. 2а

alex-auto.changanauto.ru

+7 (937) 786 86 86

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Армада-Авто

432002, г. Ульяновск, ул. Урицкого, д. 39

changan-armada.ru

+ 7 (8422) 37-07-07

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Астрахань

414024 г. Астрахань, ул. Ширяева 8А

astrakhan.changanauto.ru

+7 (8512) 21-00-00

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Атырау

060000 г. Атырау, Промышленная зона, Солтустик, сооружение 64А

rus-motors.changanauto.ru

+7 (7122) 504-504

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Базис Моторс

625051 г. Тюмень, Пермякова, 19

bazis-motors.changanauto.ru

+7 (3452) 57-57-23

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Барнаул

656067 г. Барнаул, ул. Попова, 212

changanbrn.changanauto.ru

+7 (3852) 299-000

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Белгород

308010 г. Белгород, пр-т Б. Хмельницкого, 205 А, пом. 2

intercar.changanauto.ru

+7 (4722) 400-010

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Великий Новгород

173008 г. Великий Новгород, ул. Северная, д.2

avtostyl.changanauto.ru

+7 (8162) 500-525

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Владимир

600032 г. Владимир, ул. Растопчина, д. 1б

avtograd-vladimir.changanauto.ru

+7 (4922) 77-87-14

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Возрождение

302011, Орловская область, г. Орёл, Новосильское шоссе, 10

www.changan-orelavto.ru

+7 (4862) 488 860

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Восток

623700 Свердловская обл., г. Березовский, ул. Кольцевая, 4

vostok.changanauto.ru

+7 (343) 380-86-86

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Восток-Авто

460036 г. Оренбург, ул. Карагандинская, д.64

vostok-avto156.changanauto.ru

+7 (3532) 40-70-40

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Герман Авто

420098, РТ, г. Казань, пр. Победы, д. 200

german-auto.changanauto.ru

+7 (843) 211-11-30

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Герман Авто

423819, РТ, г. Набережные Челны, ул. Машиностроительная, 103

german-auto.changanauto.ru

+7 (8552) 20-40-70

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр ГК АсАвто Самара

443106 г. Самара, ул. Алма-Атинская, д.87

asavtomotors.changanauto.ru

+7 (846) 215-00-07

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр ГК АсАвто Самара

443046 г. Самара, Аэропортовское ш.оссе 1Ж.

asavtomotors.changanauto.ru

+7 (846) 215-00-07

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр ГК АсАвто Тольятти

445140 г. Тольятти, пос.Тимофеевка, ул. Солнечная, д.1а

asavtomotors.changanauto.ru

+7 (846) 215-00-07

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Демидыч Пермь

614013 г. Пермь, ул. Спешилова, д.61

demidich.changanauto.ru

+7 (342) 258-48-03

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Демидыч Уфа

450032 г. Уфа, ул. Дмитрия Донского, д.53

demidich.changanauto.ru

+7 (342) 258-48-03

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Диалог Авто

420004 г. Казань, Горьковское ш., д.47, к.1

dialogkazan.changanauto.ru

+7 (843) 288 88 40

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Долгопрудный

109145 г. Долгопрудный, Транспортный пр-д., д.3

dolavto.changanauto.ru

+7 (495) 617-61-69

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Йошкар-Ола

424913 г. Йошкар-Ола, Кокшайский проезд, 49 а

mag-motors.changanauto.ru

+7 (8362) 64-20-40

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Калининград

236011 г. Калининград, ул. Аллея Смелых, д.200 б

kgd.changanauto.ru

+7 (4012) 704 — 700

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Капитан Авто

426009 г. Ижевск, ул. Ленина, д. 101 А

kapitanavto.changanauto.ru

+7 (3412) 55-55-18

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Кемерово

650036 г. Кемерово, ул.Терешковой, д.68

kem.changanauto.ru

+7 (3842) 90-05-94

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Киров

610050, г. Киров, ул.Менделеева, 4

tskmotor.changanauto.ru

+7 (8332) 511-000

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр КЛЮЧАВТО Краснодар

350912, г. Краснодар, улица Аэропортовская, 4

krasnodar.changanauto.ru

+7 (861) 204-43-54

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр КЛЮЧАВТО Омск

644079 г. Омск, ул.31-я рабочая 1А

omsk.changanauto.ru

+7 (3812) 330-730

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр КЛЮЧАВТО Ставрополь

355035 г. Ставрополь, проспект Кулакова, д. 16А

keyauto.changanauto.ru

+7 (8652) 55-56-56

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Костанай

110000, Республика Казахстан г. Костанай, ул.Баймагамбетова, 151

tmc.changanauto.ru

+7 (7142) 500-205

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Леон Авто

350010 г. Краснодар, ул. Ростовское ш. д.34/10

leon-avto.changanauto.ru

8 861 290 01 19

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Лидер

390044 г. Рязань Московское ш. д.65в

lider.changanauto.ru

+7 (4912) 50-34-03

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Магнитогорск

г. Магнитогорск, ул. Советская, 160В

reginas.changanauto.ru

+7 (3519) 490-432

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Миасс

456300, Челябинская область, город Миасс, Тургоякское шоссе, 3/19

miass. changanauto.ru

+7 (3513) 265-200

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Минеральные Воды

Ставропольский край, Минераловодский район, х. Красный Пахарь, ул. Автомобильная, д.19

hermes.changanauto.ru

+7 (879) 222-33-00

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Мультимоторс

220007 Республика Беларусь, г. Минск, ул. Могилевская, 43а

multimotors.changanauto.ru

+375 (17) 220-44-44

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Мурманск

183052 г. Мурманск, Кольский пр-т., д.110Б

favorit-auto.changanauto.ru

+7 (815) 269-02-42

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр на Краснинском

214030, Смоленская обл, г. Смоленск, Краснинское шоссе, д. 40

changan-smolensk.ru

+7 (4812) 70-77-02

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр на Московском

603124 г. Нижний Новгород, Московское ш. д. 243

avtoliga-group.changanauto.ru

+7 (831) 266-68-20

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр на Петухова

г. Новосибирск, ул. Петухова, 17

sta.changanauto.ru

+7 (383) 325-31-00

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Нижневартовск

628615, г. Нижневартовск, ул. Северная д. 33

changan-nv.ru

+7 (3466) 31-31-10

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Новокузнецк

г. Новокузнецк, ул. Димитрова, 38

gmnk.changanauto.ru

+7 (3843) 40-44-45

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Новочебоксарск

429951 г. Новочебоксарск, ул. Коммунистическая, д.6

changan21.changanauto.ru

+7 (8352) 70-99-00

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Полюс-ДМ

625023 г. Тюмень, ул. Харьковская, д.77

changan-tyumen72.ru

+7 (3452) 562-444

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Радар Авто

153024 г. Иваново, ул. Полка Нормандия-Неман д. 7

radar-avto.changanauto.ru

+7 (4932) 584-224

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Регинас

454036, г. Челябинск, Свердловский тракт, 5Р

reginas74.changanauto.ru

+7 (351) 700-80-39

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Регинас

г. Екатеринбург, ул. Гурзуфская, д.63

reginas96.changanauto.ru

+7 (343) 385-85-25

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр САРМАТ

630108, г. Новосибирск, ул. Станционная, 17

sarmat-changan.ru

+7 (383) 3630373

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр СИАЛАВТО

660111, г. Красноярск, ул. Пограничников, 101

changan-krasnoyarsk.ru

+7 (391) 274-90-18

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр СК-Моторс

628418 г. Сургут, ул. Профсоюзов, 1/3

surgut.changanauto.ru

+7 (3462) 95-80-80

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Сокол Волгодонск

347375 г. Волгодонск, пр. Курчатова, д. 50

sokolmotors.changanauto.ru

+7 (8639) 29-12-12

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Сокол Доватора

344090 г. Ростов-на-Дону, ул. Доватора, 169

sokolmotors.changanauto.ru

+7 (863) 333-22-44

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Сокол Малиновского

344015 г. Ростов-на-Дону, ул. Малиновского, 17В

sokolmotors.changanauto.ru

+7 (863) 333-22-88

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Сокол Пойменная

344002 г. Ростов-на-Дону, ул. Пойменная, 1Г

sokolmotors.changanauto.ru

+7 (863) 309-26-43

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Сокол Таганрог

347900 Ростовская обл. г. Таганрог, ул. Галицкого,8.

sokolmotors.changanauto.ru

+7 (8634) 619-991

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Сокол Шахты

г. Шахты, ул. Дачная, 290

sokolmotors.changanauto.ru

+7(8636)28-3000

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Сокол Шолохова

344009 Ростов-на-Дону, ул. Шолохова, 235

sokolmotors.changanauto.ru

+7 (863) 333-22-99

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Софийская

192102 г. Санкт-Петербург Софийская, ул. д2

elan.changanauto.ru

+7 (812) 244-90-00

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Стерлитамак

453104 г. Стерлитамак, ул. Профсоюзная, д.3а

filcomstr.changanauto.ru

+7 (3473) 20-90-10

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Сыктывкар

167000 г. Сыктывкар, Республика Коми, ул. Гаражная, д.13

avtoresurs.changanauto.ru

+7 (8212) 400-032

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Тамбов

г. Тамбов, ул. Бастионная, 29

globus-changan.ru

+7 (4752) 70-05-08

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Тверь

170546, г. Тверь, ТПЗ Боровлево-1, стр. 3

changan-tver.ru

+7 (4822) 79-79-59

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр ТСС авто

603950 г. Нижний Новгород, ул. Удмуртская, д.4в

tssauto.changanauto.ru

+7 (831) 257-60-50

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Холдинг Кар

398055, г. Липецк, ул. Московская, строение 34

holdingcar.changanauto.ru

+7 (4742) 39-00-14

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

Чанган Центр Череповец

162677, Вологодская область, Череповецкий р-н, д. Солманское, ул.Центральная 11Б

changan35.ru

+7 (8202) 69-40-49

Записаться на тест-драйв

Автомобили в наличии

Выгодное предложение

По запросу ничего не найдено

Грета (округ Рефухио, Техас) — перепись

Данные переписи для Греты .

..

Хотя мы обнаружили упоминание о Грете во время нашего исследования, у нас мало информации о ней.<1> Со временем мы ожидаем обнаружить дополнительную информацию, которая будет добавлена ​​в наш Газеттер..

Одна часть информации, которую мы особенно хотели бы найти, — это местоположение (т. е. GPS-координаты) Греты. Если вы можете помочь нам найти Грету, свяжитесь с нами.


Насколько мы можем судить, Грета не была включена в прошлые подсчеты переписи населения, поэтому нет информации о населении этого сообщества.

Хотя у нас нет данных переписи населения для Греты, вам могут быть интересны некоторые близлежащие сообщества, где у нас есть:

Округ Рефухио …

Грета находится в графстве Рефухио<2>.

Для получения дополнительной информации посетите нашу страницу переписи населения округа Рефухио.

Разная информация для Греты…

Федеральное правительство присвоило каждому населенному пункту, округу и штату различные идентификационные коды. В то или иное время Бюро переписи населения США использовало один (или несколько) из следующих идентификаторов при обращении к округу Рефухио или общине Греты:

.
  • Коды FIPS
    • Более ранний (и в значительной степени устаревший) метод идентификации назывался Федеральным стандартом обработки информации (FIPS):
    • .
    • Код штата: 48 (Техас)
    • Код округа: 391 (округ Рефухио)
    • Код места: 31088 (Грета)
    • Код штата и округа: 48/391 (Техас / округ Рефухио)
    • Код штата и места: 48/31088 (Техас/Грета)
  • Разное. Коды переписи  …
    • Грета находится в Переписном округе № 3 (Южный округ) и округе № 7 (Западный юго-центральный округ).

Для получения дополнительной информации о различных федеральных идентификационных кодах посетите нашу страницу «Разное» для Греты.

Другие придорожные остановки …

Поиск сообщества Техаса

О округе Рефухио

О Техасе

Внедорожные ссылки .

..

Официальный сайт штата Техас: https://texas.правительство /

Официальный сайт Совета США по географическим названиям (BGN)

Официальный сайт Геологической службы США (USGS)

Сноски …

<1> Если мы сталкиваемся с названием того, что может быть сообществом, наша методология состоит в том, чтобы добавить это название в наш Газеттер. Например, мы можем найти такое предложение, как «Он прошел на юг мимо Греты, а затем повернул на восток». Хотя Грета может быть своего рода достопримечательностью, мы думаем, что это, скорее всего, сообщество.Мы добавили Грету в качестве заполнителя в надежде, что в будущем мы сможем добавить больше информации.

Напомню: наше определение общины довольно широкое и включает в себя те места (или районы), где проживало несколько семей, имевших название, которое идентифицировало это место. Например, вы можете услышать, как кто-то говорит, что идет к Майлу, чтобы увидеть Пита … Майл — это просто заправочная станция и пара домов на перекрестке. Хотя его может и не быть на карте, все в этом районе знают его под этим именем.

К достопримечательностям относятся здания на перекрестке, несколько семей, собравшихся в лощине, или, может быть, расположение промежуточной станции. Сюда также входят такие места, как шахты, лесозаготовки, паромные переправы и т. д. Сообщество может существовать до сих пор, уже исчезло или существовало совсем недолго.

Также имейте в виду, что Грета могла быть указана в исходном документе по ошибке, с ошибкой в ​​написании исходного/альтернативного названия сообщества, которое мы указали в другом месте, или оно было помещено в неправильный округ.Иногда почтовое отделение или железнодорожная станция могут иметь другое название, чем название сообщества, в котором они расположены, поэтому два названия могут относиться к одному и тому же сообществу — мы работаем над тем, чтобы исправить это.

Поскольку путаница между округами является обычным явлением, мы провели поиск и не смогли найти другое сообщество Техаса с названием Грета .

<2> Если вас интересует, как с течением времени менялась форма округов Техаса, включая Рефухио, мы рекомендуем Атлас исторических границ округов.

Индекс достопримечательностей и исчезнувших сообществ Техаса округа Рефухио

Наименование элемента

Ст

Название округа

Тип

Широта
Долгота

Описание

Имя отправителя
Адрес электронной почты

Аламеда Крик

ТХ

Рефухио

поток

281622Н
0

 

USGS

Ольха Лагерь Ветряная мельница

ТХ

Рефухио

локаль

281312Н
0972920В

 

USGS

Анаква Танк

ТХ

Рефухио

резервуар

282534Н
0

 

USGS

Артезианский Крик

ТХ

Рефухио

поток

281906Н
0

 

USGS

Оствелл

ТХ

Рефухио

поп-место

282324Н
0

 

USGS

Оствелл Кладбище

ТХ

Рефухио

кладбище

282338Н
01В

 

USGS

Бейсайд

ТХ

Рефухио

поп-место

280537Н
02В

 

USGS

Говядина Скважина

ТХ

Рефухио

скважина

282123Н
0

 

USGS

Большой Байу

ТХ

Рефухио

кишки

282516Н
0

 

USGS

Черный Мотт Велл

ТХ

Рефухио

скважина

281516Н
0

 

USGS

Черный Мотте Велл

ТХ

Рефухио

скважина

282124Н
0

 

USGS

Черный Точка

ТХ

Рефухио

накидка

280439Н
02В

 

USGS

Черный Танк

ТХ

Рефухио

резервуар

282558Н
0

 

USGS

Бланко Крик

ТХ

Рефухио

поток

281847Н
0971907В

 

USGS

Бонни Посмотреть

ТХ

Рефухио

поп-место

281003Н
0971759В

 

USGS

Бонни Посмотреть нефтяное месторождение

ТХ

Рефухио

нефтяное месторождение

281143Н
0971544В

 

USGS

Бьютт Озеро

ТХ

Рефухио

озеро

281817Н
0971907В

 

USGS

В ролях Чистый залив

ТХ

Рефухио

кишки

282504Н
03В

 

USGS

Чилтипин Скважина

ТХ

Рефухио

скважина

281812Н
0

 

USGS

Шоколад Суэйл

ТХ

Рефухио

поток

281237Н
0971721В

 

USGS

Копано Артезианская скважина

ТХ

Рефухио

скважина

282142Н
0

 

USGS

Копано Месторождение нефти и газа Бэй

ТХ

Рефухио

нефтяное месторождение

281053Н
0

 

USGS

Угловой Скважина

ТХ

Рефухио

скважина

281917Н
01В

 

USGS

Коттонвуд Полый

ТХ

Рефухио

долина

282806Н
0

 

USGS

Кранелл

ТХ

Рефухио

поп-место

281004Н
0972333В

 

USGS

Вырезать- от Скважина

ТХ

Рефухио

скважина

282022Н
0

 

USGS

Дьяволы Прогон

ТХ

Рефухио

поток

281232Н
0972038В

 

USGS

Дитрих Скважина

ТХ

Рефухио

скважина

282420Н
04В

 

USGS

Собака Филиал

ТХ

Рефухио

поток

282210Н
0972019В

 

USGS

Кизил Скважина

ТХ

Рефухио

скважина

282002Н
0

 

USGS

Сухой Крик

ТХ

Рефухио

поток

281550Н
0971551В

 

USGS

Утка Озеро

ТХ

Рефухио

озеро

281831Н
0971748В

 

USGS

Фаган Нефтяное месторождение

ТХ

Рефухио

нефтяное месторождение

282927Н
00В

 

USGS

Феннесси Квартира

ТХ

Рефухио

квартира

281254Н
0971552В

 

USGS

Квартира Байу

ТХ

Рефухио

кишки

282509Н
07В

 

USGS

Фокс Нефтяное месторождение

ТХ

Рефухио

нефтяное месторождение

282038Н
0

 

USGS

Грета Нефтяное месторождение

ТХ

Рефухио

нефтяное месторождение

282415Н
07В

 

USGS

Гваделупе Река

ТХ

Рефухио

поток

282604Н
0

 

USGS

Залив Прибрежный аэропорт

ТХ

Рефухио

аэропорт

282806Н
0

 

USGS

Гамильтон Озеро

ТХ

Рефухио

озеро

282537Н
05В

 

USGS

Услышано Кладбище

ТХ

Рефухио

кладбище

281704Н
0971730В

 

USGS

Услышано Скважина

ТХ

Рефухио

скважина

281229Н
0

 

USGS

Хайнс Озеро

ТХ

Рефухио

озеро

283118Н
0

 

USGS

Боров Озеро

ТХ

Рефухио

озеро

280756Н
0972045В

 

USGS

Святой Крестовое кладбище

ТХ

Рефухио

кладбище

281812Н
0971704В

 

USGS

Подкова Озеро

ТХ

Рефухио

озеро

282525Н
00В

 

USGS

Хафф Нефтяное месторождение

ТХ

Рефухио

нефтяное месторождение

283125Н
0

 

USGS

Инари

ТХ

Рефухио

поп-место

283050Н
0

 

USGS

КЗТХ-FM (Рефухио)

ТХ

Рефухио

башня

280815Н
0

 

USGS

КЗТХ-FM (Рефухио)

ТХ

Рефухио

башня

281956Н
0971645В

 

USGS

Кайзер Квартира

ТХ

Рефухио

квартира

281401Н
0971510В

 

USGS

Ла Кладбище Розы

ТХ

Рефухио

кладбище

281335Н
0971839В

 

USGS

Ла Нефтяное месторождение Роза

ТХ

Рефухио

нефтяное месторождение

281030Н
0971937В

 

USGS

Озеро Пастбищное нефтяное месторождение

ТХ

Рефухио

нефтяное месторождение

282458Н
09В

 

USGS

Ламберт Ранчо

ТХ

Рефухио

локаль

282108Н
0

 

USGS

Ланграфт Скважина

ТХ

Рефухио

скважина

282840Н
0

 

USGS

Круг Риф Банк

ТХ

Рефухио

бар

280816Н
04В

 

USGS

льва Городской парк

ТХ

Рефухио

парк

281749Н
0971646В

 

USGS

льва Парк

ТХ

Рефухио

парк

281352Н
0971934В

 

USGS

Маленький Скважина

ТХ

Рефухио

скважина

282443Н
0

 

USGS

Длинный Озеро

ТХ

Рефухио

озеро

282531Н
01В

 

USGS

Длинный Скважина

ТХ

Рефухио

скважина

281149Н
0

 

USGS

Лукас Озеро

ТХ

Рефухио

озеро

282443Н
0

 

USGS

Мадеро Скважина

ТХ

Рефухио

скважина

281345Н
0

 

USGS

Модлоу

ТХ

Рефухио

поп-место

282535Н
06В

 

USGS

Макдауэлл Точка

ТХ

Рефухио

накидка

282150Н
0

Тиволи SE

USGS

МакГрю Скважина

ТХ

Рефухио

скважина

281717Н
0

 

USGS

МакГилл Озеро

ТХ

Рефухио

озеро

281432Н
0971529В

 

USGS

Медио Крик

ТХ

Рефухио

поток

281847Н
0971907В

 

USGS

Меллон Ранчо Аэропорт

ТХ

Рефухио

аэропорт

281651Н
0

 

USGS

Дыня Крик

ТХ

Рефухио

поток

281129Н
0

 

USGS

Дыня Нефтегазовое месторождение Крик

ТХ

Рефухио

нефтяное месторождение

281802Н
0971521В

 

USGS

Дыня Нефтяное месторождение Крик

ТХ

Рефухио

нефтяное месторождение

281647Н
0971353В

 

USGS

Мемориал Больничная вертолетная площадка

ТХ

Рефухио

аэропорт

281823Н
0974748В

 

USGS

Средний Танк

ТХ

Рефухио

резервуар

282431Н
08В

 

USGS

Миллер Крик

ТХ

Рефухио

поток

282731Н
0

 

USGS

Миссия залив

ТХ

Рефухио

отсек

280920Н
0

 

USGS

Миссия Озеро

ТХ

Рефухио

озеро

280955Н
0

 

USGS

Миссия Река

ТХ

Рефухио

поток

280949Н
0

 

USGS

Миссия Речное нефтегазовое месторождение

ТХ

Рефухио

нефтяное месторождение

281632Н
0971550В

 

USGS

Обезьяна Слау

ТХ

Рефухио

поток

281249Н
0971956В

 

USGS

Крепление Голгофское кладбище

ТХ

Рефухио

кладбище

281807Н
0971657В

 

USGS

Крепление Салемская церковь

ТХ

Рефухио

церковь

283053Н
08В

 

USGS

Малленс Байу

ТХ

Рефухио

поток

280811Н
0

 

USGS

Мустанг Озеро

ТХ

Рефухио

озеро

281842Н
0

 

USGS

Николай Мемориальное кладбище Фагана

ТХ

Рефухио

кладбище

283025Н
01В

 

USGS

Девять миль Квартира

ТХ

Рефухио

квартира

282404Н
0971737В

 

USGS

Север Озеро Святого Николая

ТХ

Рефухио

озеро

282754Н
00В

 

USGS

О’Коннор Кладбище

ТХ

Рефухио

кладбище

283119Н
01В

 

USGS

О’Лири Мотте Велл

ТХ

Рефухио

скважина

282206Н
0

 

USGS

Дуб Школа

ТХ

Рефухио

локаль

282236Н
0972042В

 

USGS

Оквуд Кладбище

ТХ

Рефухио

кладбище

281631Н
0971729В

 

USGS

Старый Сент-Мэрис

ТХ

Рефухио

поп-место

280606Н
0

 

USGS

Внешний Обод Танк

ТХ

Рефухио

резервуар

282738Н
05В

 

USGS

Внешний Обод Колодец

ТХ

Рефухио

скважина

282745Н
0

 

USGS

Папалоте Крик

ТХ

Рефухио

поток

280953Н
0973225В

 

USGS

Персик Мотте Танк

ТХ

Рефухио

резервуар

282603Н
0

 

USGS

Доска Мост Байу

ТХ

Рефухио

кишки

282447Н
0

 

USGS

Сантехники Слау

ТХ

Рефухио

кишки

280932Н
06В

 

USGS

Сантехники Скважина

ТХ

Рефухио

скважина

280945Н
0

 

USGS

Полюс Мост Байу

ТХ

Рефухио

кишки

282438Н
0

 

USGS

Кинтана

ТХ

Рефухио

поп-место

282048Н
02В

 

USGS

Красный Мельничный резервуар

ТХ

Рефухио

резервуар

282336Н
01В

 

USGS

морской окунь Байу

ТХ

Рефухио

поток

282544Н
0

 

USGS

Рефухио

ТХ

Рефухио

поп-место

281818Н
0971630В

 

USGS

Рефухио округ

ТХ

Рефухио

гражданский

282000Н
00В

 

USGS

Рефухио Нефтяное месторождение

ТХ

Рефухио

нефтяное месторождение

281922Н
0971737В

 

USGS

Ринкон Изгиб

ТХ

Рефухио

изгиб

280648Н
0971856В

 

USGS

Роше Месторождение нефти и газа

ТХ

Рефухио

нефтяное месторождение

281212Н
0972246В

 

USGS

Роше Ранчо

ТХ

Рефухио

локаль

281316Н
0972538В

 

USGS

Рук Поле

ТХ

Рефухио

аэропорт

281737Н
0971922В

 

USGS

Рук Ранчо

ТХ

Рефухио

локаль

280822Н
0972246В

 

USGS

Роза Крик, Ла

ТХ

Рефухио

поток

281410Н
0971631В

 

USGS

Седло Одеяло Колодец

ТХ

Рефухио

скважина

281532Н
0

 

USGS

Святой Кладбище Бернар

ТХ

Рефухио

кладбище

281409Н
0971839В

 

USGS

Святой Деннис Черч

ТХ

Рефухио

церковь

283116Н
0

 

USGS

Святой Кладбище Марыс

ТХ

Рефухио

кладбище

282701Н
0

 

USGS

Соль Крик Колодец

ТХ

Рефухио

скважина

282212Н
0

 

USGS

Соль Пруд

ТХ

Рефухио

озеро

282248Н
0

 

USGS

Песок Скважина

ТХ

Рефухио

скважина

281110Н
0

 

USGS

Шульц Скважина

ТХ

Рефухио

скважина

281140Н
02В

 

USGS

Острые предметы Озеро

ТХ

Рефухио

озеро

282800Н
0

 

USGS

Снеллбанк Риф

ТХ

Рефухио

бар

280652Н
09В

 

USGS

Соммервиль Байу

ТХ

Рефухио

кишки

282513Н
03В

 

USGS

су Крик

ТХ

Рефухио

поток

281213Н
0971610В

 

USGS

Юг Озеро Святого Николая

ТХ

Рефухио

озеро

282721Н
0

 

USGS

Весна Крик

ТХ

Рефухио

поток

282337Н
0972118В

 

USGS

Закат Скважина

ТХ

Рефухио

скважина

282027Н
0

 

USGS

Лебедь Озеро

ТХ

Рефухио

озеро

282448Н
08В

 

USGS

Лебедь Озеро Байу

ТХ

Рефухио

кишки

282430Н
0

 

USGS

Томас Озеро

ТХ

Рефухио

озеро

281833Н
03В

 

USGS

Тиволи

ТХ

Рефухио

поп-место

282718Н
0

 

USGS

Том Нефтяное месторождение О’Коннор

ТХ

Рефухио

нефтяное месторождение

282119Н
06В

 

USGS

Туле Изгиб

ТХ

Рефухио

изгиб

280712Н
0971938В

 

USGS

Черепаха Ручка Квартиры

ТХ

Рефухио

болото

281140Н
02В

 

USGS

Черепаха Ручка Точка

ТХ

Рефухио

накидка

281207Н
08В

 

USGS

Твин Мотт Лейк

ТХ

Рефухио

озеро

282143Н
0

 

USGS

Аптон Угловой колодец

ТХ

Рефухио

скважина

281646Н
00В

 

USGS

Видаурри

ТХ

Рефухио

поп-место

282611Н
0

 

USGS

Сварщик Ранчо

ТХ

Рефухио

локаль

282547Н
05В

 

USGS

Запад Месторождение Видаури

ТХ

Рефухио

нефтяное месторождение

282822Н
0

 

USGS

Уильямс Кладбище

ТХ

Рефухио

кладбище

281826Н
0971853В

 

USGS

Ива Крик

ТХ

Рефухио

поток

281608Н
0

 

USGS

Ива Крик

ТХ

Рефухио

поток

281848Н
0

 

USGS

Ива Озеро

ТХ

Рефухио

озеро

282532Н
0971623В

 

USGS

Вудсборо

ТХ

Рефухио

поп-место

281417Н
0971911В

 

USGS

Запата Озеро

ТХ

Рефухио

озеро

281950Н
08В

. …………………………………………. ……………………………..

Геологическая служба США …………………………………………

Делеция специфического для ноцицепторов гена выявляет основную роль Nav1.7 (PN1) в возникновении острой и воспалительной боли

Аннотация

Девять потенциалзависимых натриевых каналов экспрессируются сложным образом в нервах и мышцах млекопитающих. Три канала, Na v 1.7, Na v 1,8 и Na v 1,9, экспрессируются избирательно в периферических нейронах, чувствительных к повреждению. Поскольку не существует селективных блокаторов этих каналов, мы использовали удаление гена у мышей, чтобы изучить функцию Na v 1.7 (PN1) в проводящих путях боли. Было обнаружено, что глобальный мутант Na v 1.7-null погибает вскоре после рождения. Поэтому мы использовали систему Cre-loxP для создания нокаутов, специфичных для ноцицепторов. Na v 1.8 экспрессируется только в периферических, в основном ноцицептивных, сенсорных нейронах.Мы нокаутировали рекомбиназу Cre в локус Na v 1,8 для получения гетерозиготных мышей, экспрессирующих рекомбиназу Cre в Na v 1,8-положительных сенсорных нейронах. Скрещивание этих животных с мышами, у которых экзоны 14 и 15 Na v 1.7 были фланкированы сайтами loxP, давало мышей с ноцицептор-специфическим нокаутом, которые были жизнеспособны и, по-видимому, нормальными. У этих животных выявлены повышенные пороги механической и термической боли. Примечательно, что все воспалительные болевые реакции, вызванные рядом стимулов, таких как формалин, каррагинан, полный адъювант Фрейнда или фактор роста нервов, были уменьшены или устранены.Врожденный болевой синдром у людей недавно был картирован с геном Na v 1.7, SCN9A . Доминантные мутации Na v 1.7 приводят к отеку, покраснению, повышению температуры тела и двусторонней боли у пациентов с эритермалгией, что подтверждает важную роль Na v 1. 7 в воспалительной боли. Абляция ноцицептор-специфического гена должна оказаться полезной для понимания роли других широко экспрессируемых генов в путях боли.

V oltage-управляемых натриевых каналов лежат в основе электрической возбудимости нервов и мышц млекопитающих (1).Сложность экспрессии подтипа потенциалзависимых натриевых каналов позволяет предположить, что определенные изоформы могут играть специализированную роль в разных физиологических системах. В отсутствие блокаторов, специфичных для подтипа, анализ нулевых мутантных мышей оказался информативным (2). К настоящему времени у трансгенных мышей удалены четыре α-субъединицы и две разные β-субъединицы. Было показано, что Na x , гомолог натриевых каналов, не управляемых напряжением, играет важную роль в солевом гомеостазе (3), тогда как Na v 1.8, по-видимому, играет особую роль в болевом пути (4). Делеция Na v 1.2 приводит к массивному апоптозу нейронов ствола мозга и перинатальной гибели (5), а потеря Na v 1. 6 у природных мутантов «med» приводит к атаксии, дистонии и параличу (6). Делеция субъединиц β-1 или β-2 приводит к сложному фенотипу, приводящему к судорогам и эпилептогенной активности (7). Встречающиеся в природе кардиальные мутации Na v 1.5 связаны с эпилепсией и внезапной смертью у людей с синдромом Бругада (8).

Na v 1.7 впервые был клонирован из клеточной линии феохромоцитомы PC12 (9, 10). Его присутствие на высоких уровнях в конусах роста нейронов малого диаметра (9, 11) позволяет предположить, что он, вероятно, играет некоторую роль в передаче ноцицептивной информации. Иммунохимические исследования сенсорных нейронов морских свинок подтверждают мнение, что Na v 1.7 связан с ноцицепторами (12). Недавно было показано, что наследственное болевое состояние человека, первичная эритермалгия, соответствует Na v 1.7 (13). Поэтому мы изучили роль Na v 1.7 в путях боли путем создания нулевых мутантных мышей. Система Cre-recombinase-loxP делает возможной тканеспецифическую и/или индуцибельную делецию генов (14). Путем управления Cre тканеспецифическим промотором можно осуществить делецию гена в определенных тканях. Это усовершенствование технологии нуль-мутантов оказалось полезным для функциональных исследований (15-17). Чтобы выяснить физиологическую роль Na v 1.7, мы создали «флоксированных» мышей, у которых сайты loxP были вставлены в интроны, фланкирующие экзоны 14 и 15, которые кодируют большую часть домена II.Было показано, что делеции сенсоров напряжения S4 отменяют функцию натриевых каналов у Na v 1.8-null мутантов (4). Для глобальной абляции Na v 1.7 мы использовали обычных мышей с делетором, у которых рекомбиназа Cre экспрессируется во всех тканях (18). Затем мы использовали мыши Cre, специфичные для ноцицепторов, для удаления Na v 1.7 только в сенсорных нейронах, чувствительных к повреждению. Экспрессия ноцицептор-специфичной рекомбиназы Cre была достигнута путем управления этим геном промотором Na v 1,8. Na против 1. 8 экспрессируется преимущественно в ноцицептивных сенсорных нейронах и полностью отсутствует в других тканях, кроме сенсорных нейронов (19). Гетерозиготные нуль-мутантные мыши Na v 1.8 идентичны мышам WT (4), что позволяет предположить, что «включение» рекомбиназы Cre в локус Na v 1.8 вряд ли окажет вредное воздействие на гетерозиготных мышей, экспрессирующих одиночные аллели Na . v 1.8 и Cre. Эти мыши были сконструированы и проанализированы, и у них не было обнаружено фенотипических нарушений, хотя экспрессия рекомбиназы Cre идентична Na v 1.8 (20). Скрещивание этих мышей с флоксированными мышами Na v 1.7 приводило к получению жизнеспособных животных, которые демонстрировали специфическую делецию Na v 1.7 только в подмножестве сенсорных нейронов. Здесь мы представляем анализ последствий удаления Na v 1.7 на поведение мышей при болевом синдроме.

Методы

Нацеливание на гены: Na v 1. 8 Cre Construct. Зонд кДНК крысы, кодирующий Na v 1,8 экзона 10–12, использовали для идентификации геномных клонов из библиотеки бактериальных искусственных хромосом мыши (ВАС) RCPI-22 129S6/SvEvTac.Вектор-мишень был получен из двух соседних фланкированных фрагментов Bam HI размером 6,5 и 8,5 т.п.н., содержащих экзоны 1-3 Na . v 1,8 ген. Продукт ПЦР, кодирующий ≈400 п.н. выше сайта начала трансляции Na v 1.8 и первые 45 п.н. гена Cre , был получен методом ПЦР с использованием фрагмента 8.5 т.п.н. в качестве матрицы (праймеры 5′-AGCAAGAGGCAAATCATAGTCAGC-3 ‘ и 5′-TCGACCGGTAATGCAGGCAAATTTTGGTGTACGGTCAGTAAATTGGACATCTTCTCATTCTTCTTGGGGAAGGATTTACA-3’).Этот продукт был клонирован в модифицированный вектор pBSSK с использованием Xma I и Age I. Остаток гена Cre , полученный из pBS500 (1), был клонирован с использованием Age I и Mlu . I. Остаток 5′-плеча гомологии был клонирован с использованием Xma I с последующим расщеплением и повторным лигированием Bst EII. Кассету устойчивости к неомицину ( neo r ), фланкированную (флартированную) FRT-сайтом, для положительной селекции клонировали в отдельный модифицированный вектор pBSSK с использованием Sac I и Sal I.Два сигнала полиаденилирования клонировали с использованием Nsi I и Hin dIII. 3′-UTR получали с помощью ПЦР из геномного клона ВАС (праймеры 5′-AGGGATCC AACTCGAGAGACACTCCAGCATGCACGGGGCG-3′ и 5′-CGCGGATCCGGCCGACCCTCAGGTATTGTCCGG-3′) и клонировали с использованием Bam HI. 3′-плечо гомологии вырезали из геномного субклона Na v 1.8 размером 6,5 т.п.н. и клонировали с использованием Bam HI и Xma I.

Два фрагмента были клонированы в вектор, содержащий тимидинкиназу вируса простого герпеса (4), с использованием Not I и Sac II. Вектор линеаризовали с использованием Not I и электропорировали в эмбриональные стволовые клетки, полученные из 129. В общей сложности 192 клона пережили отбор G418, и их скринировали на предмет гомологичной рекомбинации с помощью Саузерн-блоттинга. ДНК расщепляли с помощью Bam HI и подвергали скринингу с помощью 3′-зондов и Cre-зондов. Семь клонов были правильно нацелены, и их вводили в бластоцисты C57BL/6J для создания химер. F 1 гетерозигот скрещивали с животными с делецией FLPe для удаления маркера положительной селекции.

Na v 1.7 Конструкт. Библиотеку BAC мыши RCPI-22 129S6/SvEvTac подвергали скринингу с помощью зонда, представляющего фрагмент 900 п.н. 14 и 15, и только один был положительным. Затем два геномных фрагмента, содержащих экзон-14-15, субклонировали из положительного ВАС в pBSSK , 7,5 т.п.н. Eco RI и 8.Фрагмент 2-kb Apa I. Вектор-мишень был сконструирован из трех геномных областей, полученных из субклонов. 5′-плечо представляет собой фрагмент размером 4,7 т.п.н. от сайта Sac I после экзона 11 до Hin dIII перед экзоном 14. Флоксированная последовательность представляет собой фрагмент от Hin dIII до Hin dIII размером 2,9 т.п.н., содержащий экзоны. 14 и 15. 3′-плечо представляет собой фрагмент размером 4,5 т.п.н. от сайта Hin dIII после экзона 15 до сайта Nsi I перед экзоном 16.

Сайт loxP выделен в виде фрагмента длиной 111 п.н. Eco RI- Pst I из вектора Pl2- neo r (подарок R.Schoepfer, Университетский колледж Лондона) и клонировали в модифицированный pBSSK . Фрагмент размером 2,9 т.п.н. от Hin dIII до Hin dIII, содержащий экзоны 14 и 15, был вставлен в сайт Hin dIII сайта loxP, содержащего вектор. Затем правильная ориентация была определена с помощью расщепления Eco RI, и продукт был назван pPN1415lox. Сайт loxP и кассета neo r с передним флангом были объединены в модифицированный pBSSK . Затем фрагмент loxP neo r сливали с фрагментом 1415lox размером 3 т.п.о. в pBSSK . Продукт получил название pPN1415loxneolox.

. pBSSK с модифицированным полилинкером был получен путем вставки олигонуклеотидов MAN-PL2 (GCGGCCGCCCGGGAATTCAATTGAAGCTTGGGCCCGCTAGCACTAGTAT) и MANPL2a (CGATACTAGTGCTAGCGGGCCCAAGCTTCAATTGAATTCCCGGGCGGCCGCAGCT) в сайты I Clay Sac ; продукт называется pMANPL2.5′-плечо гомологии Na v 1,7 было получено в pMANPL2 из двух геномных фрагментов. Это фрагменты Hin dIII → Mfe I размером 1 т.п.н. и Mfe I → Xma I размером 3,9 т.п.н.; продукт называется pPN15’arm. Часть экзона 11, присутствующая в плече pPN15′, была делетирована путем расщепления Sac I- Xma I с последующим затуплением Т4; продукт называется pPN15’armΔ. Фрагмент Xho I → Spe I из p1415loxneolox был вставлен в Xho I- Nhe I pPN15’armΔ. Продукт называется pPN15′-Neo. Гомология 3′-плеча Na v 1,7 была получена в pBSSK из двух геномных фрагментов из субклона Eco RI. Это фрагменты Hin dIII → Apa I размером 1 т.п.н. и Apa I → Nsi I размером 3,7 т.п.н. Они были вставлены в Hin dIII → Pst I из pBSSK . Продукт называется pPN13’arm. Затем удаляли часть полилинкера pBSSK в плече pPN13′.Плечо pPN13′ расщепляли с помощью Not I- Xma I с последующим затуплением с помощью T4. Этот продукт был назван pPN13’armΔ. Окончательная конструкция была собрана из трех фрагментов, а именно: ( i ) скелет, модифицированная pBSSK , содержащая кассету тимидинкиназы вируса простого герпеса, расщепленную Sac II+ Not I; ( ii ) pPN13’armΔ, 4,5 т.п.н. Sac II → Xho I фрагмент; и ( iii ) pPN15-1415loxneolox, фрагмент 9 т.п.н. Xho I → Not I.

3′-зонд, делеционный клон, был получен из субклона Eco RI. Расщепление его Pst I+ Nsi I с последующим лигированием оставило только геномную вставку из 700 п.н. Зонд 600 п.н. вырезали с использованием Xma I+ Mfe I.

Внутренний зонд I12 представлял собой фрагмент Pac I- Kpn I длиной 450 п.н. из субклона Apa I.

Полный нацеливающий вектор линеаризовали с использованием Not I и электропорировали в эмбриональные стволовые клетки, полученные из 129.192 клона, переживших отбор G418, подвергали скринингу на гомологичную рекомбинацию с использованием Саузерн-блоттинга. Пять положительных клонов идентифицировали с использованием расщепления Eco RI и 3′-зонда. Клоны дополнительно анализировали с использованием расщеплений Apa I и внутреннего зонда к интрону 12. Два клона были правильно нацелены и введены в бластоцисты C57BL/6J для получения химер. F 1 гетерозигот скрещивали с животными с делецией FLPe для удаления маркера положительной селекции (22).

Электрофизиологические и иммунохимические исследования. Эти исследования были проведены, как описано ранее (20), с использованием записей потенциал-фиксации нейронов одиночного ганглия задних корешков (DRG) диаметром до 25 мкм в культуре с использованием цельноклеточного варианта методики патч-клэмп. Измерения электрического входа в нейроны с широким динамическим диапазоном в нейронах спинного мозга проводились, как описано в ref. 4. Поликлональные антисыворотки к Na v 1.8, и антитела к другим маркерам сенсорных нейронов использовали, как описано в ссылках. 19 и 20.

Поведенческий анализ. Все тесты были одобрены Законом Министерства внутренних дел Соединенного Королевства о животных (научные процедуры) 1986 г. и проводились, как описано в ref. 4. На момент тестирования мышам было от 10 до 20 недель.

Результаты

Поколение трансгенных мышей. Стратегия создания конструкции для нацеливания Cre показана на рис. 1. Рекомбиназа Cre с 3′-UTR Na v 1,8 была нокаутирована в метионине инициатора Na v 1,8, так что сайт начала трансляции Na v 1.8 был заменен рекомбиназой Cre (21). После скрининга гомологичной рекомбинации в эмбриональных стволовых клетках 129/Sv, отобранных на наличие кассеты neo r , единственную положительную клеточную линию использовали для получения трансгенных мышей, которых анализировали на передачу по зародышевой линии с помощью Саузерн-блоттинга с зонды, показанные на рис.1 Б . Геномные дайджесты Bam HI отличают аллель WT (6,5 т.п.н.) от целевого аллеля (8,5 т.п.н.). После установления мышиной линии, экспрессирующей Cre в локусе Na v 1. 8, кассету neo r вырезали путем скрещивания мышей с мышами с универсальным делетором Flp перед анализом экспрессии рекомбиназы Cre (22). . Затем были обнаружены фрагменты рестрикции Bam HI длиной 7,2 т.п.н. (рис. 1).

Инжир.1.

Поколение мышей Na v 1.8Cre. ( A ) Диаграмма нативного аллеля Na v 1,8, конструкта, нацеленного на Na v 1,8Cre, и аллеля, нацеленного на Na v 1,8Cre, до и после удаления neo r . ( B и C ) Гистологическая локализация Na v 1,8Cre-опосредованная активность β-галактозидазы. Серийные 10-мкм срезы животных, фиксированных 4% параформальдегидом Na v 1.8Cre +/- , R26R +/- , окрашивали антителами к β-галактозидазе ( B ) и анти-Na v 1 . 8 поликлональные антисыворотки ( С ). Стрелки выделяют ячейки с двойной меткой. (Шкала, 50 мкм.) ( D ) Саузерн-блоттинг с Bam HI и внешним зондом подтверждает правильное нацеливание и удаление neo r . Полосы WT размером 6,5 т.п.н. видны на всех дорожках, а полосы 8,5- и 7,3 т.п.о. представляют целевой аллель до (+ neo r ) и после (- neo r ) удаления neo р соответственно.

При анализе паттерна экспрессии функциональной рекомбиназы Cre использовали репортерных мышей ROSA26, у которых β-галактозидаза экспрессируется в результате активности Cre (23). Функциональный Cre был выражен по схеме, идентичной Na v 1.8. Экспрессия начинается на 14-й день эмбрионального развития в нейронах малого диаметра в дорсальных корешках, тройничном и узловом ганглиях, но отсутствовала в не-нейрональных тканях и тканях ЦНС. Этот паттерн экспрессии не изменился у взрослых животных.

Мыши с floxed Na v 1.7 (fNa v 1.7) были сконструированы путем вставки сайтов loxP в сайтов Hin dIII в интронах, фланкирующих экзоны 14 и 15, с neo r xP lo’ cassette . сайт. Для гомологичной рекомбинации в эмбриональных стволовых клетках 129/Sv использовали фрагмент от сайта Sac I 5′ экзона 11 до сайта Nsi I перед экзоном 16. Трансгенных мышей подвергали скринингу с помощью Саузерн-блоттинга с рестриктазами Eco RI и внешний датчик, как показано на рис.2. Кассету neo r вырезали путем скрещивания со штаммом с делетором Flp и снова анализировали Саузерн-блоттингом с Apa I гидролизатов и внутренним зондом, как показано на рис. 2. C .

Рис. 2.

Генерация и анализ Na v 1.7 фоксовых мышей. ( A ) Структура родного ALALE NA V 1.7 ALLELE, NA V 1.7 Tarching Construct, FNA V 1.7 ALLELE, FNA V 1.7 ALLELE После удаления NEO R , а также NA v 1,7 нокаутный аллель. ( B ) Саузерн-блоттинг с Eco RI и внешним зондом подтверждает правильное нацеливание. ( C ) Саузерн-блоттинг с использованием Apa I и внутреннего зонда подтверждает удаление кассеты neo r .( D ) Саузерн-блоттинг подтверждает делецию экзонов 14 и 15 в Na v 1,7 -/-. ( E ) ПЦР использовали для обнаружения делеции экзона 14-15 в геноме и кДНК из DRG , но не спинного мозга в Na v 1.7R -/- .

Na v 1.7-Нулевые мутанты. Универсальную мышь Cre-deletor использовали для получения обычных мышей Na v 1,7 -/- путем скрещивания с fNa v 1.7 мышей. Гетерозиготные спаривания Na и 1,7 проводили для сравнения глобальных нулевых мышей и мышей дикого типа. Саузерн-блоты продемонстрировали делецию экзонов 14 и 15 в геномной ДНК. Из 92 выживших детенышей 72% были гетерозиготами, а остальные были Na v 1,7 WT. Na v 1,7 -/- детенышей все умерли вскоре после рождения, по-видимому, из-за отказа от кормления. Таким образом, удаление Na v 1.7 во всех сенсорных и симпатических нейронах вызывает летальный перинатальный фенотип.

Мы последовательно скрестили fNa v 1.7 мышей с мышами Na v 1.8Cre, чтобы в конечном итоге получить животных, гомозиготных по аллелю fNa v 1.7 и гетерозиготных по Na v 1.8Cre. При дальнейшем скрещивании этих животных с гомозиготными мышами fNa v 1,7 были получены пометы, включающие примерно равное количество мышей fNa v 1,7 и ограниченных по тканям Na v 1,7 -/- (Na v 1,7R -/) мышей. Таким образом, мы могли сравнить поведение животных без DRG (Na v 1.7R -/- ) с однопометными контрольными животными (fNa v 1.7). Мы оценили делецию Na v 1.7 двумя способами. Во-первых, мы использовали праймеры для ПЦР для исследования геномной ДНК мышей Na v 1.7R -/- и однопометных мышей fNa v 1.7. Продукт ПЦР показал, что соседние экзоны 13 и 16 присутствовали в ДНК из Na v 1.7R -/- DRG, но не в спинном мозге. fNa v 1.7 Геномная ДНК DRG не давала такого продукта. кДНК, скопированная с Na v 1.мРНК 7R -/- DRG также показала аналогичный продукт, который отсутствовал в мРНК fNa v 1,7 DRG. Таким образом, удаление экзонов 14 и 15 Na v 1,7 происходило только в DRG.

Мы исследовали функциональные последствия делеции Na v 1.7 на экспрессию натриевых каналов в нейронах DRG в культуре с помощью электрофизиологической записи (20, 24). Небольшое влияние на пиковый ток, чувствительный к тетродотоксину (ТТХ), согласуется с остаточными высокими уровнями Na v 1.1 и Na v 1,6 в нейронах DRG, наблюдалось в нокауте Na v 1,7R -/- . Резистентные к ТТХ токи, определяемые экспрессией Na v 1,8, были нормальными (рис. 3). Таким образом, в отличие от нулевого мутанта Na v 1.8 (4), не было реципрокных изменений в экспрессии ТТХ-резистентных натриевых каналов в результате делеции Na v 1.7. Это открытие было подтверждено исследованием электрических свойств сенсорных нейронов с использованием препарата спинного мозга.Опять же, в отличие от Na v 1,8-нулевого мутанта (4), у мышей Na v 1,7R -/- не было изменений в электрических порогах активации С- или А-волокон.

Рис. 3.

Электрофизиология Na v 1,7 -/- .( A ) ТТХ-чувствительная и резистентная пиковая плотность тока натрия в Na v 1.7R -/- (черные) ( n = 7) и fNa v 1,7 (белые) ( n = 14) мыши. ( B ) Устойчивые к ТТХ токи у мышей дикого типа (заштрихованы) ( n = 22), Na v 1.8Cre гетерозигот (закрашены) ( n = 22) и гомозиготных ( n = 26) мышей . ( C F ) Реакция нейронов дорсального рога пластинки V (L3 и L4), получающих сигналы от задней лапы, на периферические стимулы в Na v 1,7 R -/- (черный) ( n = 14 ) и однопометница fNa v 1.7 (белые) ( n = 18) мышей. ( C ) Вызванные ответы на волоски фон Фрея показали механический дефицит у мышей Na v 1,7R -/- ( P = 0,048). Температура (струя воды) ( D ), щипок, кисть и вредный холод ( E ), приложенные к периферическому рецептивному полю в течение 10 с, были нормальными. Данные выражены как средние пики (±SEM), вызванные в течение 10 с. ( F ) Ответ на чрескожную электрическую стимуляцию рецептивного поля (серия из 16 электрических импульсов длительностью 2 мс, при 0.5 Гц, при трехкратном пороге С-волокна). Спайки, возникающие между 0 и 50 мс, были классифицированы как вызванные входом по А-волокну, а вызванные между 50 и 250 мс — как вызванные входом по С-волокну. «Вход» представляет собой количество спайков, вызванных первым стимулом серии (50–800 мс), и отражает непотенцированный ответ нейронов дорсального рога, вызванный С-волокнами. Избыточные спайки, дополнительные спайки, зарегистрированные сверх прогнозируемого постоянного базового ответа, являются мерой «накрутки», определяемой как повышенная возбудимость нейронов к повторной постоянной стимуляции.

Мы исследовали вызванные ответы отдельных нейронов V пластинки спинного мозга с широким динамическим диапазоном, используя in vivo методов внеклеточной регистрации (25). Применение ряда безвредных и вредных тепловых раздражителей к периферическому рецептивному полю над задними лапами мышей Na v 1,7 R -/- и однопометников fNa v 1,7 выявило сходные паттерны нейронного кодирования. Однако наблюдался явный дефицит реакций, вызванных вредным механическим воздействием на спинной мозг.При использовании нитей фон Фрея реакции задних рогов были снижены у мышей Na v 1,7 R -/- по сравнению с контрольными однопометниками в вредоносном диапазоне, в то время как низкопороговое механическое воздействие не пострадало. Не наблюдалось различий между нокаутными и контрольными мышами в уровнях продолжающейся спонтанной активности, активности нейронов при щипании или прикосновении или вредных холодовых раздражителях. Аналогично, в ответ на чрескожную электрическую стимуляцию Na v 1.7R -/- и fNa v 1.У 7 мышей были сходны пороги активации входа А- и С-волокон в спинной мозг и вызванных нейронных ответов через эти афференты после серии стимулов (рис. 3).

Na v 1.7R -/- Болевое поведение. Мы исследовали поведение мышей Na v 1.7R -/- (26). Двигательная активность была нормальной при измерении с помощью вращающегося стержня (fNa против 1,7 87,8 ± 20,1 с; ноль 69 ± 10,4 с), и не было очевидных различий в весе (fNa против 1.7 самец, 30,6 ± 0,92 г; Na v 1,7R -/- , 29,3 ± 0,58 г; fNa v 1,7 самка, 24 ± 0,63 г; и Na v 1,7R -/- , 22,9 ± 0,94 г), или соотношение полов между мышами Na v 1,7R -/- и контрольными мышами fNa v 1,7. Болевое поведение, индуцированное на горячей пластине при 50°С, 52°С или 55°С, было идентичным. Однако латентность отмены, полученная с использованием тепловых раздражителей, применяемых с помощью аппарата Харгрива, показала, что мыши Na v 1,7R -/- были на ≈20% менее чувствительны к вредной тепловой стимуляции, чем контрольная группа (рис. 4). Кроме того, резко уменьшилась болезненная механочувствительность. Хотя реакции на волосы фон Фрея были сходными, применение болезненного давления с помощью аппарата Рэндалла-Селитто выявило выраженную анальгезию у мышей Na v 1,7R -/- . Эти наблюдения согласуются с периферическим дефицитом, продемонстрированным при электрофизиологическом анализе входа в спинной мозг (рис. 3).

Инжир.4.

Поведение при острой боли у мышей Na v 1.7R -/- . ( A ) Болезненная тепловая стимуляция мышей fNa v 1,7 (белые) и Na v 1,7R -/- (черные) с использованием аппарата Харгрива. Латентный период отдергивания задней лапы был значительно увеличен у мышей Na v 1,7R -/- (11,01 ± 0,47, n = 14 и 8,23 ± 0,67, n = 12 соответственно) ( P 9 P 9). 0,003, т тест).( B ) Реакция на вредную тепловую стимуляцию с использованием аппарата с нагревательной пластиной существенно не отличалась у fNa v 1,7 ( n = 12) и Na v 1,7R -/- ( n = 12) ) мыши ( P = 0,27, 0,11 и 0,79, тест t ). ( C )Na v 1,7R -/- мышей (396,4 ± 4,0, n = 19) продемонстрировали глубокую анальгезию в ответ на вредное механическое давление при использовании аппарата Рэндалла-Селитто по сравнению с fNa v 1.7 мышей (195,5 ± 4,8, n = 18) ( P < 0,0001, t тест). ( D ) Реакция на механическую стимуляцию при использовании волос фон Фрея достоверно не отличалась у fNa v 1,7 ( n = 11) и Na v 1,7R -/- ( n 9 = 11) мышей.

Контроли Na v 1.7R -/- и fNa v 1. 7 отличаются не только удалением Na v 1.7, но и в экспрессии рекомбиназы Cre. Поэтому мы оценили гетерозигот Na v 1.8Cre во всех вышеупомянутых тестах на острую боль и показали, что они неотличимы от мышей C57Bl6 (20). Таким образом, поведенческие различия, которые мы наблюдаем между мышами Na v 1.7R -/- и мышами fNa v 1.7, обусловлены удалением натриевого канала Na v 1.7, а не дифференциальной экспрессией рекомбиназы Cre. .

На v 1.7 и воспалительная боль. У мышей Na v 1,7R -/- наблюдались поразительные нарушения в развитии воспалительной боли. Поведение мышей в ответ на интраплантарное введение формалина показало снижение первой фазы ответа и значительное снижение и задержку наступления второй фазы (рис. 5). Длительное воспаление, вызванное инъекцией полного адъюванта Фрейнда (CFA), вызывало значительную термическую и механическую гипералгезию у fNa v 1. 7 мышей, но мыши Na v 1,7R -/- практически не подвергались воздействию во все моменты времени. Напротив, не было различий в отеке, вызванном CFA, между двумя линиями мышей (вес лапы с инъекцией/без инъекции = 1,59 ± 0,04 для fNav1.7 и 1,62 ± 0,06 для Na v 1,7R -/- ).

Инжир.5.

Воспалительные боли в Na v 1.7R -/- . ( A ) Анализ поведения мышей fNa v 1,7 (белые) и Na v 1,7R -/- (черные) в моделях воспалительной боли. ( Aa ) Болевое поведение мышей fNa v 1,7 ( n = 14) и Na v 1,7R -/- ( n = 17) после интраплантарной инъекции 20 % формалина . Регистрировали время, затрачиваемое на облизывание/кусание инъецированной задней лапы в фазе I (1-10 мин) и фазе II (10-55 мин). В I фазе наблюдается снижение ( P = 0,03, t тест) (fNa v 1,7, 93,1 ± 7,2; Na v 1,7R -/- , 70,4 ± 6,6). В фазе II у мышей Na v 1,7R -/- также наблюдалось значительное снижение болевого поведения (тест P = 0,004, t ) (101,3 ± 18,9 и 220,9 ± 34,8 соответственно). ( Ab ) Динамика формалинового ответа во времени ( P <0,05 через 5, 20, 25 и 30 минут). ( Ac ) Термическая гипералгезия после внутриподошвенной инъекции 20 мкл CFA.У мышей fNa v 1,7 развилась выраженная гипералгезия (0,56 ± 0,1, n = 9) с 1-го дня, тогда как у мышей Na v 1,7R -/- ее не было (0,97 ± 0,06, n = ). ( P <0,001, ANOVA; P <0,05 во все моменты времени). ( Ad ) Механическая аллодиния, вызванная внутриподошвенной инъекцией 20 мкл CFA. У мышей fNa v 1,7 выраженная аллодиния развивалась с 1-го дня (0,50 ± 0,16, n = 8), тогда как у мышей Na v 1. 7R -/- мышей — нет (1,05 ± 0,12, n = 13) ( P = 0,012, ANOVA; P <0,05 в дни 2, 3, 4 и 10). ( Ae ) Термическая гипералгезия после внутриподошвенной инъекции 20 мкл 2% каррагинана. У мышей fNa v 1,7 развилась выраженная гипералгезия (0,47 ± 0,03, n = 7) в течение часа, тогда как у мышей Na v 1,7R -/- ее не было (1,07 ± 0,04, n = 5). ( P < 0,001, ANOVA; P < 0.05 во все моменты времени). ( Af ) Термическая гипералгезия после внутриподошвенной инъекции 500 нг NGF. У мышей fNa v 1,7 ( n = 15) термальная гипералгезия развивалась по двухфазному типу, тогда как у мышей Na v 1,7R -/- ( n = 8) фаза I (первый час) не наблюдалась и восстановленная фаза II ( P <0,05 при 0,25, 0,5, 1, 2, 6,5 и 8 ч, ANOVA). ( B ) Боль при воспалении является нормальным явлением у мышей Na v 1. 8Cre. Анализ поведения Na v 1.Мыши 8Cre +/- (черные) и C57BL/6 (белые) в моделях воспалительной боли. ( Ba ) Поведение мышей Na v 1.8Cre +/- ( n = 6) и C57BL/6 ( n = 6) после интраплантарного введения 20 мкл 5% формалина не отличалось между группами в фазе I (107 ± 12,6 с и 96,1 ± 10,3 с соответственно; P = 0,51) и фазе II (230 ± 47,7 и 290 ± 45,4 с соответственно; P = 0,38, t тест) . ( Bb ) Термическая гипералгезия после внутриподошвенной инъекции 20 мкл CFA не отличалась у Na и 1.8Cre +/- (0,58 ± 0,05, n = 6) и WT (0,55 ± 0,05, n = 6) однопометники ( P = 0,79, ANOVA). ( Bc ) Механическая аллодиния после интраплантарного введения 20 мкл CFA не отличалась у Na v 1,8Cre +/- (0,30 ± 0,16, n = 6) и WT (0,27 ± 0,04, n = 6) однопометников ( P = 0,74, ANOVA). ( Bd ) Термическая гипералгезия, вызванная интраплантарной инъекцией 20 мкл 2% каррагинана, не отличалась у Na и 1.8Cre +/- (0,40 ± 0,26, n = 9) и C57BL/6 (0,36 ± 0,03, n = 7) мыши ( P = 0,31, двухфакторный ANOVA). ( Be ) Термическая гипералгезия, вызванная интраплантарной инъекцией 500 нг NGF, не различалась у Na и 1,8Cre +/- (0,58 ± 0,02) ( n = 6) и C57BL/6 (0,56 ± 0,03) ( n = 6) мышей ( P = 0,83, двусторонний дисперсионный анализ).

Две другие формы воспаления обычно изучаются у грызунов.Каррагинан вызывает кратковременное воспаление с участием простаноидов (27). Фактор роста нервов (NGF), действующий через рецепторы TrkA, также вызывает гипералгезию (28). В обеих этих моделях воспалительной боли развитие термической гипералгезии отсутствовало у мышей Na v 1.7R -/- .

Еще раз, чтобы подтвердить, что этот фенотип не был результатом присутствия рекомбиназы Cre у мышей Na v 1. 7R -/- , мы сравнили мышей C57/Bl6 с гетерозиготными мышами Na v 1.мыши 8Cre. В этих контрольных экспериментах не было различий в поведении при воспалительной боли, подтверждая, что отсутствие воспалительной гипералгезии можно объяснить отсутствием Na v 1.7.

Решающую роль Na v 1.7 в установлении воспалительного болевого порога можно объяснить тремя возможными механизмами. Во-первых, канал может формировать существенный компонент комплекса, содержащего киназы, каркасные белки и ионные каналы, функция которых заключается в изменении возбудимости нейронов.Во-вторых, внутренние свойства Na v 1.7 могут быть изменены посттрансляционными модификациями, такими как фосфорилирование, для увеличения пиковой плотности тока по механизму, аналогичному механизму, который работает с Na v 1.8. Наконец, проникновение канала в мембрану может регулироваться воспалительными медиаторами, вызывая повышенную возбудимость нейронов.

Мы проверили первую возможность, изучив влияние PGE 2 на Na v 1.8 Резистентные к ТТХ токи в нейронах ДРГ, лишенных Na v 1.7. Как контрольные (35,2 ± 4,7%; n = 3), так и нулевые нейроны (69 ± 26%; n = 3) показали резкое увеличение пика Na по сравнению с 1,8 минут тока после микромолярного применения PGE 2 , предполагая, что посттрансляционная регуляция других каналов была нормальной у условно нулевого мутанта.

Вторую возможность можно не принимать во внимание, поскольку фосфорилирование, опосредованное как протеинкиназой А, так и С, уменьшает пик Na v 1.7 токов в системе экспрессии ооцитов (29).

Напротив, третья возможность, усиленный перенос Na v 1.7 в функциональную форму, индуцированная медиаторами воспаления, подтверждается экспериментальными данными (30). Na v 1.7 вносит небольшую долю в общий ТТХ-чувствительный ток в нейронах DRG, а терминали сенсорных нейронов трудно изолировать для электрофизиологических исследований (4). Однако практически возможно исследовать хромаффинные клетки PC12 и надпочечников, которые экспрессируют только Na v 1.7, и здесь были получены убедительные доказательства усиленного переноса Na v 1.7 в ответ на повышенные уровни цАМФ или NGF. Как связывание тритиевого сакситоксина, так и функциональные исследования демонстрируют увеличение плотности тока Na по сравнению с 1,7 от 50% до нескольких раз (30). Это увеличение плотности тока хорошо коррелирует с повышенной периферической возбудимостью, вызванной медиаторами воспаления.

Обсуждение

Na v 1.7 экспрессируется в периферических, преимущественно сенсорных и симпатических нейронах малого диаметра. Он коэкспрессируется в сенсорных нейронах со многими другими изоформами натриевых каналов, включая на высоких уровнях Na v 1,1, -1,2 и -1,6, а также устойчивые к ТТХ каналы Na v 1,8 и -1,9. Пока еще нет специфических блокаторов отдельных подтипов натриевых каналов, хотя ТТХ различает подгруппы натриевых каналов (1). Na v 1,7 попадает в категорию чувствительных к ТТХ, демонстрируя IC 50 , равную 2 нМ для ТТХ.В последнее время наблюдается возрождение интереса к натриевым каналам как к потенциальным мишеням для обезболивающих препаратов на основании исследований антисмысловых и нуль-мутантных мышей (31, 32). Интерпретация нулевых мутантных фенотипов может быть проблематичной, потому что могут иметь место компенсаторные механизмы развития, а иногда эмбриональная или перинатальная смерть исключает поведенческие исследования. У Na v 1.7 глобальная делеция гена приводит к гибели вскоре после рождения, по-видимому, вследствие отказа от питания. Этот эффект может отражать дисфункцию центральных, вегетативных или кишечных сенсорных нейронов.

Делеция гена в подмножестве сенсорных нейронов, которые являются преимущественно ноцицептивными, демонстрирует, что Na v 1.7 играет важную роль в механизмах боли, особенно в развитии воспалительной боли. Специфический дефицит острой механочувствительности, а не тепловой чувствительности, связанный с делецией Na v 1.7, поразителен. Однако, поскольку ТТХ не блокирует механически активированные токи в сенсорных нейронах (33), Na v 1.7 должен играть нисходящую роль в механотрансдукции. Na v 1,8-нулевые мыши также невосприимчивы к механическим стимулам, индуцированным Randall-Selitto (4). TrpV4, потенциальный первичный механосенсорный преобразователь, показывает сходный нулевой фенотип (34). Эти данные свидетельствуют о том, что Na v 1.7 и механочувствительные каналы связаны на окончаниях ноцицепторов, а генераторный потенциал, создаваемый активацией механосенсоров, активирует Na v 1.7.

Роли Na v 1.7 и -1,8 в болевых путях могут быть связаны. У Na v 1,8-нулевых мышей NGF-индуцированная термическая гипералгезия снижена, и есть небольшой дефицит в других моделях воспалительной боли (4, 35). Однако у мышей Na v 1,8-null была отмечена повышающая регуляция мРНК Na v 1,7, а также увеличение ТТХ-чувствительной плотности тока натрия (4). Таким образом, Na v 1,7 может частично компенсировать истощение Na v 1,8. Напротив, делеция Na v 1.7 не компенсируется повышенной резистентной к ТТХ текущей активностью (рис. 3) и приводит к драматическому фенотипу с точки зрения воспалительной боли.

Периферические изменения болевого порога, по-видимому, связаны с несколькими механизмами, включая фосфорилирование каналов. NGF, действующий через TrkA-опосредованную активацию фосфолипазы C, снимает блокаду фосфатидилинозитол-4,5-бисфосфатного [PtdIns(4,5)P2] канала TRPV1; Активируемая митогенами протеинкиназа p38 также играет роль в индуцированной NGF гипералгезии (36, 37).Каррагинан повышает уровень простаноидов, которые, действуя через рецепторы ЕР, вызывают фосфорилирование натриевых каналов с участием протеинкиназы А (38). CFA вызывает долговременные изменения, которые частично блокируются аспириноподобными препаратами (39). Примечательно, что все эти формы воспалительной гипералгезии ослабляются делецией Na v 1.7, возможно, в результате дефицита переноса Na v 1.7.

Недавнее открытие того, что первичная эритермалгия, преобладающее заболевание человека, связанное с повторяющимися эпизодами сильной боли, соответствует SCN9A , подтверждает важную роль Na v 1.7 в болевых путях как у мышей, так и у людей (40). Поразительно, что это состояние связано с хроническим воспалением, сопровождающимся отеком, покраснением и двусторонней болью, особенно в конечностях, которые могут быть вызваны стоянием или физическими упражнениями. Эти симптомы обратны дефициту, обнаруженному у ноцицептор-специфического мутанта Na v 1.7-null.

Эти исследования продемонстрировали роль Na v 1.7 в воспалительной боли, которую невозможно определить фармакологически. Как и Na v 1.7, предполагается, что ряд белков, экспрессируемых как в сенсорных нейронах, так и в других типах клеток, играют важную роль в проводящих путях боли (1, 41, 42). Делеция широко экспрессируемых генов только в ноцицепторах с использованием мышей Na v 1.8Cre, вероятно, окажется полезной для понимания механизмов ноцицепции и боли.

Благодарности

Мы благодарим Gail Mandel, Monica Mendelson, Liam Drew, Tom Jessell и Kenji Okuse за полезные комментарии.Мы благодарим Медицинский исследовательский совет и The Wellcome Trust за неоценимую поддержку. Э.А.М. и М.А.Н. в настоящее время поддерживаются Лондонским консорциумом по борьбе с болью, финансируемым Wellcome Trust.

Сноски

  • ↵ ‡ Кому должна быть адресована корреспонденция. Электронная почта: j.wood{at}ucl. ac.uk.

  • Сокращения: BAC, бактериальная искусственная хромосома; CFA, полный адъювант Фрейнда; DRG, спинномозговой ганглий; фНа против 1.7, флюс Na v 1,7; Na v 1,7R -/- , тканевые ограничения Na v 1,7 -/- ; neo или , устойчивость к неомицину; NGF, фактор роста нервов; ТТХ, тетродотоксин.

  • Copyright © 2004, Национальная академия наук

Уродливая Грета ненавидит канадцев | Page 2

Я не не ненавижу Грету, хотя я склонен пренебрегать ее избирательностью, когда дело доходит до определенных вопросов… и я действительно нахожу тех, кто ухаживал за ней и поддерживал ее, чтобы она была действительно прискорбной для многих уровни.

Но с самого начала я никогда не видел ее «маленькой девочкой».

Когда она появилась на МСМ, я увидел низкорослую 16-летнюю девочку со всеми (отсутствием) проницательности и (отсутствием) утонченности, которые я склонен ожидать от ребенка этого возраста. Внешний вид Скальдилока был таким же надуманным, как и все остальное в этом ребенке, но я помню, какими были 16-летние девочки, когда мне было 16, и знаю, что они никоим образом не все (или даже в основном) очаровательные маленькие ангелочки.

Между тем, из молодых людей получаются отличные идеологи, потому что они просто недостаточно опытны, чтобы видеть вещи со всех сторон или видеть вещи такими, какие они есть на самом деле, и поэтому их легко поляризовать какой-нибудь благозвучно звучащей идеологией.

Таким образом, молодежь всегда использовалась, как и Грета, различными группировками.

В недавней истории все, от Мао Цзэдуна до Пол Пота и того немца (вы знаете, кто) стремились использовать молодых людей в качестве революционных элементов, чтобы очистить общество от любых традиционных или укоренившихся элементов, стоящих на пути автократического руководства. .

Это не означает, что не существует такой вещи, как умирающая окопа, которая должна исчезнуть. Вместо этого я просто говорю, что молодежь можно использовать для того, чтобы делать вещи, которые на самом деле не так альтруистичны, как утверждает их руководство.

Во всем этом нет ничего нового: детей просто легко программировать, и им требуется много времени, чтобы даже понять, что значительная часть того, во что они твердо верят, ошибочна из-за того, что они не учитывают оперативные элементы, у которых есть счетчик влияние на те же проблемы, к которым они так предрасположены.

*****

Это мой третий пост о Грете, так что я бы не сказал, что полностью поглощен ею. Когда кто-то появляется в качестве предмета разговора и таким образом обсуждается, это не обязательно является признаком навязчивого интереса к собеседнику, если кто-то решает внести свой вклад в разговор…

…особенно если почти никогда не участвовать в обсуждениях интересующего человека.

*****

Но теперь, когда я говорю о ней, я скажу следующее:

Грета — просто пропагандистское лицо для группы коллективистских социальных элементов, и она не так уж и символична для меня. как можно предположить, она является для других — особенно для ее сторонников и тех, кто ее обожает.

Можно также логически присвоить те же отрицательные значения тем, кто настаивает на восхвалении Греты как форме жуткой одержимости… но я тоже не буду играть в эту игру.

Лично я am рад видеть, что она не так общепризнана, как некоторые пытаются ее представить… и не так повсеместно отвергнута, как некоторым хотелось бы.

Но я скажу так: если кто-то хочет быть очень убедительным, вероятно, потребуется кто-то более убедительный, чем болтливый подросток, чтобы сделать эту работу.

Я по-прежнему считаю, что у нас есть проблемы с загрязнением, которые необходимо решать. Но я также по-прежнему считаю, что существует много театральности (исходящей от обеих сторон проблемы) относительно нашей текущей ситуации, и я хочу, чтобы люди перестали играть в «Игру с обвинением» достаточно долго, чтобы действительно сделать что-то эффективное, чтобы справиться с некоторыми из этих вещей. .

И, как я уже говорил во многих других темах: одной из самых больших проблем на самом деле является население и спрос на потребительские товары. У вас есть потогонные мастерские, потому что население другой страны требует модных кроссовок… и так далее.

Возлагать вину за ситуацию на одну группу больше, чем на другую, не совсем логично. Мы могли бы сказать, что владелец потогонной мастерской не *должен* управлять потогонной мастерской так же просто, как сказать, что люди, которым нужны модные кроссовки, не *должны* их иметь…

Это все равно, что наркотики, рабство и прочее дерьмо, о котором только можно подумать. Все указывали пальцем, желая обвинить кого-то в чем-то. Но обычно это улица с двусторонним движением.

Это все равно, что слушать, как Оливер Харди говорит Стэну Лорелу: «Теперь посмотри, что ты заставил меня сделать!»

И Грета на самом деле не является голосом кого-либо, кроме своих покровителей. Она для меня просто странная маленькая марионетка.

—R

Астроцитарные внеклеточные везикулы модулируют гомеостаз нейронов кальция посредством трансглютаминазы-2

2+ ] i ) и идентифицировали трансглутаминазу-2 (TG2) как поверхностный груз EV, происходящих из астроцитов.Инкубация нейронов гиппокампа с примированными EV, происходящими из астроцитов, привела к увеличению [Ca 2+ ] i , в отличие от EV из TG2-нокаутных астроцитов. Воздействие внеклеточного TG2 на нейроны или срезы мозга вызывало повышение [Ca 2+ ] i , которое было обратимым при удалении TG2 и зависело от притока Ca 2+ через плазматическую мембрану. Патч-зажим и запись изображений кальция выявили TG2-зависимую деполяризацию нейронной мембраны и активацию внутренних токов из-за открытия VOCC L-типа и работы Na + /Ca 2+ -обмена (NCX) в обратный режим, на что указывают фармакологические ингибиторы VOCC/NCX.Субъединица Na + /K + -АТФазы была выбрана с помощью сравнительной протеомики и идентифицирована как функционально ингибируемая внеклеточным TG2, что указывает на ингибирование Na + /K + -АТФазы в обратном переключении режима NCX, что приводит к Приток Ca 2+ и выше базальный [Ca 2+ ] i . Эти данные свидетельствуют о том, что реактивные астроциты контролируют внутринейрональные [Ca 2+ ] i посредством высвобождения EVs с TG2 в качестве ответственного груза, что может оказывать значительное влияние на синаптическую активность при воспалении головного мозга.

Введение

Регуляция Ca 2+ является фундаментальным биологическим процессом в нейронах, при этом передача сигналов Ca 2+ лежит в основе синаптической пластичности, выживания нейронов и их способности к коммуникации (Catterall & Few, 2008; Marambaud , Dreses-Werringloer и др., 2009). В нейронах базальные уровни Ca 2+ жестко регулируются в узком физиологическом диапазоне (Carafoli, 1987; Jones & Keep, 1988), а повышение внутриклеточной концентрации Ca 2+ ([Ca 2+ ] i ) является основным триггером высвобождения нейротрансмиттеров из нервных окончаний.Распространение потенциала действия и деполяризация мембраны (∼ 20 мВ) вызывает приток Ca 2+ через потенциалзависимые каналы Ca 2+ , который достигает микромолярного уровня в высоко локализованных пресинаптических участках аксонов (Forti, Pouzat et al. , 2000). . Так как малейшее изменение токов Ca 2+ может иметь существенное влияние на функцию нейронов, приток Ca 2+ контролируется действием мембранных переносчиков Ca 2+ на плазматической мембране, таких как Ca 2 + перекачивает АТФазу и натрий/кальциевый (Na + /Ca 2+ )-обменник (NCX), и он буферизуется большим набором белков, связывающих Ca 2+ , которые действуют как модуляторы клеточного Ca 2+ переходных процессов.Обширная литература указывает на то, что дисгомеостаз Ca 2+ в нейронах связан со старением и нейродегенерацией. Однако механизм(ы), приводящий к изменениям [Ca 2+ ] i , до сих пор не совсем ясен (Nikoletopoulou & Tavernarakis, 2012; Oh, Oliveira et al., 2013).

Трансглутаминаза-2 (TG2) представляет собой Са 2+ -зависимый сшивающий фермент, который, как известно, участвует в множественных нейродегенеративных заболеваниях, связанных с нарушением регуляции Са 2+ (Grosso & Mouradian, 2012), а также в различных состояниях. вызванные воспалительными процессами, такими как заживление ран и фиброз тканей (Verderio, Furini et al., 2015). Причастность TG2 была впервые предложена наблюдением, что фермент в присутствии активирующих [Ca 2+ ] i способен сшивать патогенные белки с неправильной укладкой, типичные для нейродегенеративных состояний (например, амилоид-β и α-синуклеин). ), что способствует образованию белковых агрегатов (Andringa, Lam et al., 2004; Benilova, Karran et al., 2012; Grosso, Woo et al., 2014; Hartley, Zhao et al., 2008; Junn, Ronchetti et al. ., 2003). Однако ряд недавних наблюдений, таких как усиление Ca 2+ -индуцированного повреждения гиппокампа TG2 в мозге мышей и более высокая чувствительность к судорогам, индуцированным каиновой кислотой (Tucholski, Roth et al., 2006), а также нейротоксическая роль астроцитарного TG2 после острого повреждения головного мозга (Feola, Barton et al., 2017; Monteagudo, Feola et al., 2018) указывают на возможную роль TG2 в индуцированных эксайтотоксичностью нейронах. гибель клеток, которая может быть либо следствием увеличения [Ca 2+ ] i , либо, как новая гипотеза, вызвана TG2-опосредованными изменениями в [Ca 2+ ] i . Астроциты являются богатым источником TG2, который экстернализируется и накапливается во внеклеточном матриксе (ECM) в ответ на воспалительные стимулы (Pinzon, Breve et al., 2017). Важно отметить, что астроциты являются ключевыми медиаторами иммунных реакций головного мозга (Colombo & Farina, 2016), и было показано, что TG2 играет роль в нейровоспалении (Ientile, Curro et al., 2015). Астроциты контролируют синапсы либо путем прямого контакта, либо с помощью секретируемых факторов, высвобождаемых в виде отдельных молекул или упакованных во внеклеточные везикулы (EV), которые нацелены на пре- и постсинапсы, тем самым регулируя синаптическое поведение (Farhy-Tselnicker & Allen, 2018). В этом исследовании мы предположили, что внеклеточный TG2 может нарушать гомеостаз Ca 2+ в нейронах. Мы обнаружили новую роль экстранейронального TG2, высвобождаемого реактивными астроцитами через EV, в увеличении количества нейронов [Ca 2+ ] i и показали, что это происходит за счет открытия VOCC L-типа и работы NCX в обратный способ, посредством регуляции активности Na + /K + -АТФазы. Этот процесс является новым примером регуляции нейронов с помощью груза EVs, полученного из астроцитов, как при физиологических, так и при нейровоспалительных состояниях.

Результаты

TG2, высвобождаемый первичными астроцитами в связи с ЭВ, увеличивается [Ca

2+ ] i в нейронах

Предыдущие исследования показали, что астроциты являются основным источником внеклеточного TG2 в головном мозге, особенно в ситуациях воспаление/астроглиальный ответ на травму (Colak & Johnson, 2012; Monteagudo et al., 2018; Пинзон и др., 2017; Куинн, Юнес-Медина и др., 2018). Гранулярный паттерн распределения TG2 был обнаружен с помощью иммунофлуоресценции либо в пермеабилизированных, либо в непермеабилизированных фиксированных культурах астроцитов, что позволяет предположить, что TG2 имеет преобладающее внеклеточное расположение в астроцитах (рис. 1А). Оценка эндогенного TG2 клеточной поверхности с помощью оптимизированного анализа активности выявила высокую внеклеточную активность TG2 (чувствительную к специфическому ингибитору ZDON) в культивируемых астроцитах (рис. EV1). Напротив, в нейронах гиппокампа TG2 показал значительно более высокое окрашивание пермеабилизированных клеток (рис.1B), где он частично локализован в синаптических участках, на что указывает совместное окрашивание пре- и постсинаптических маркеров VGLUT1 (синий) и SHANK2 (красный) (рис. 1C). Вестерн-блоттинг-анализ необработанных синаптосом мозга взрослой мыши выявил значительное обогащение TG2 в синаптических контактах (рис. 1D), подтверждая присутствие TG2 в синаптических сайтах in vivo либо в окончаниях нейронов (подтверждено экспрессией NR2B , PSD95, VGAT и VGLUT1) или в астроцитарных отростках, окружающих синапсы (подтверждено экспрессией GFAP) (фиг.1А и 1D) (Gylys, Fein et al., 2000).

Рисунок 1. TG2 локализуется внеклеточно в первичных астроцитах и ​​в синаптических участках нейронов.

А) Иммунофлуоресцентное окрашивание первичных астроцитов. Клетки фиксировали в растворе 4% параформальдегида и 4% сахарозы (масса/объем), подвергали пермеабилизации (левые панели) или непермеабилизировали (правая панель) и окрашивали анти-TG2 IA12 (зеленый), DAPI (синий) и астроцитарным маркером анти- GFAP (красный). Покровные стекла визуализировали с помощью лазерного сканирующего конфокального микроскопа Leica SP5 с масляным иммерсионным объективом 63X.Последовательные серийные оптические срезы (1 мкм) были записаны на плоскости 8 мкм. Масштабная линейка 20 мкм. Интенсивность TG2 рассчитывали с помощью программного обеспечения Leica, делили на количество ядер и нормализовали к значениям проницаемости. Данные выражены как среднее значение ± стандартное отклонение (N=3, критерий Манна-Уитни: p=NS). B) Нейроны в 12 DIV были зафиксированы и пермеабилизированы (левая панель) или не пермеабилизированы (правая панель) и окрашены антителами против TG2 IA12 (зеленый), анти-β-TUB или анти-NR2B (красный) и DAPI (синий). Масштабная линейка 10 мкм. Интенсивность TG2 рассчитывали, как описано в A (N=3, критерий Манна-Уитни: *p<0.05). C) Нейроны через 22 дня in vitro (DIV) фиксировали, пермеабилизировали и окрашивали антителами против TG2 IA12 (зеленый), против SHANK2 (красный) и против VGLUT1 (синий) (N=3). Покровные стекла визуализировали, как описано в A. Масштабная линейка 20 мкм (малое увеличение) и 5 ​​мкм (большое увеличение). D) Неочищенные синаптосомы выделяли из мозга взрослых мышей и исследовали с помощью пре- и постсинаптических маркеров и астроцитарного маркера GFAP. В-тубулин использовали в качестве контроля нагрузки. TG2 обогащен синаптической фракцией (Syn) по сравнению с низкоскоростным супернатантом (LSS), представляющим общий лизат.Данные выражены как среднее значение ± стандартное отклонение (N=4 независимых эксперимента, критерий Манна-Уитни: *p<0,05).

После экстернализации на поверхности астроцитов TG2 может связываться с матриксным фибронектином (FN) (Pinzon et al. , 2017), и наши данные подтвердили частичную совместную локализацию TG2 с FN (рис. EV2). Мы предположили, что TG2 может высвобождаться через внеклеточные везикулы (EV), как недавно было описано в других клеточных системах (Antonyak, Li et al., 2011; Diaz-Hidalgo, Altuntas et al., 2016; Furini, Schroeder et al., 2018). ).В этой форме TG2 может перемещаться к нейронам, если только он не высвобождается из астроцитов при прямом контакте с синапсами. Чтобы проверить эту возможность, EV, происходящие из астроцитов, выделяли из кондиционированной среды первичных астроцитов, полученных из мозга мышей дикого типа (TGM2 +/+ ) и нокаутных (TGM2 -/- ) мышей (De Laurenzi & Melino, 2001). Характеристика с помощью анализа отслеживания наночастиц (рис. 2А), ПЭМ (рис. 2В), обнаружения везикулярных маркеров ALIX и Flotillin-2 и отсутствия отрицательного маркера TOM20 подтвердила размер, морфологию и везикулярный груз ЭВ (рис.2С). NTA показал тенденцию к увеличению количества EV при лечении LPS (рис. 2A). Ни среднее число частиц, ни размер моды существенно не отличались между клетками WT и TG2KO, как необработанными, так и обработанными LPS (рис. 2A-I и 2A-II), тогда как при просмотре наблюдалась значительная разница между количеством частиц WT и WT + LPS. при определенных размерах (диапазон 45-195 нм) (рис. 2А-III). ПЭМ-анализ и мечение везикул дикого типа иммунозолотом показали, что они имели ожидаемую чашеобразную форму, и подтвердили наличие на поверхности ЭВ специфических маркеров ЭВ CD63 и TG2 (рис.2Б). Вестерн-блоттинг лизатов ЭВ, полученных из астроцитов, выявил наличие белка TG2 в ЭВ дикого типа, который демонстрировал тенденцию к увеличению при провоспалительной стимуляции ЛПС (рис. 2С). Кроме того, незначительное количество TG2 было обнаружено в супернатантах без пузырьков после восстановления всех белков с помощью преципитации TCA, что свидетельствует о заметной везикулярной локализации TG2 в первичных астроцитах (рис. 1А). Эти данные впервые показывают, что TG2 высвобождается из культивируемых астроцитов в качестве груза EV как в физиологических условиях покоя, так и в условиях стимуляции (воспаления). Локализация TG2 в EV была исследована с использованием чувствительного ферментативного анализа, как мы описали ранее (Furini et al., 2018). TG2 был обнаружен на сопоставимых уровнях как в интактных, так и в лизированных EV, что свидетельствует о преимущественном расположении EV на поверхности (рис. 2D). Чтобы исследовать влияние груза TG2 астроцитов EV на функцию нейронов, модуляцию [Ca 2+ ] i EV, выделенными из WT и TG2KO LPS-примированных астроцитов, отслеживали в нейронах гиппокампа, нагруженных fura-2.Чтобы исключить вариации [Ca 2+ ] i из-за утечки везикулярного АТФ из ЭВ, происходящих из астроцитов (D’Arrigo, Gabrielli et al., 2021), анализ проводили в присутствии разрушающего АТФ фермент апираза. Как показано на рис. 2E, TG2-содержащие EV (EVs WT) были способны повышать базальное [Ca 2+ ] i , тогда как добавление TG2KO EV не вызывало значительных изменений. Эти данные имеют два новых следствия: что EV, полученные из астроцитов, совпадают с регуляцией гомеостаза нейронов Ca 2+ , и что TG2, который экспонируется на поверхности EV, полученных из астроцитов, отвечает за эту специфическую функцию.

Рисунок 2. Астроцитарный TG2 высвобождается в ассоциации с EV и модулирует гомеостаз кальция в нейронах.

A) Характеристика электромобилей с помощью анализа слежения за наночастицами (NTA). Средняя концентрация частиц (I) и размер моды (II) электромобилей, выделенных из необработанных и обработанных ЛПС астроцитов WT и TG2KO, охарактеризованных с помощью NTA (ZetaView, Particle Metrix). Данные представлены как среднее значение ± стандартное отклонение (N = 3 независимых эксперимента, критерий Крускала-Уоллиса Данна: p = NS). (III) График, показывающий среднюю концентрацию частиц в зависимости от размера электромобилей (критерий Крускала-Уоллиса Данна, WT необработанный – WT LPS: *p<0.05). B) Характеристика электромобилей с помощью просвечивающей электронной микроскопии (ПЭМ). ПЭМ-анализ ЭВ, выделенных из необработанных астроцитов дикого типа и окрашенных антителами к CD63 (Abcam) или антителами к TG2 (IA12) и 6-нм коллоидным золотом против мышиных IgG (верхние панели), или негативным окрашиванием уранилацетатом метилцеллюлозы ( Нижняя панель). C) Вестерн-блоттинг ЭВ, происходящих из астроцитов, и белки, преципитированные ТХУ из супернатантов без везикул (СН без ЭВ), для обнаружения маркеров ЭВ ALIX и FLOT-2, негативного маркера ЭВ TOM20, глиального маркера GFAP и ТГ2.β-тубулин использовали в качестве контроля нагрузки для TL. Показан репрезентативный блот из 3 независимых экспериментов. Обработанные клетки примировали ЛПС (1 мкг/мл) в течение 24 ч в бессывороточной среде перед выделением ЭВ. Вертикальные черные линии разделяют участки одной и той же мембраны, полученные при разном времени экспозиции. D) Сравнение активности TG2 в интактных и лизированных EV, выделенных из астроцитов WT и TG2KO. EV либо ресуспендировали как интактные в PBS, либо лизировали в буфере для мягкого лизиса для определения активности поверхностного TG2 или общей активности соответственно.Данные выражены как среднее значение ± стандартное отклонение, нормализованное к значениям интактных EV WT (N = 3 независимых эксперимента; критерий Крускала-Уоллиса Данна: * p <0, 05). E) Количественное определение [Ca 2+ ] i , выраженное как F340/380, в 13 нейронах DIV до и после стимуляции EV, выделенными из обработанных LPS астроцитов WT или TG2KO (N≥75 нейронов из препарата полученный из ≥10 крысиных эмбрионов E18). EV из клеток WT или TG2KO ресуспендировали в KRH с добавлением 30 ЕД/мл апиразы и добавляли к нейронам в присутствии 1 мкМ TTX, 50 мкМ APV и 10 мкМ CNQX.[Ca 2+ ] i измеряли в нескольких полях до (базального) и через 20-60 минут после добавления либо WT, либо TG2KO EV. Данные выражены как среднее значение ± стандартное отклонение (односторонний тест ANOVA: *p<0,05).

Внеклеточный TG2 увеличивает концентрацию кальция в цитоплазме как в культивируемых нейронах, так и в срезах гиппокампа

] и динамика при добавлении к внеклеточному раствору очищенного TG2.Дифференцированные нейроны гиппокампа часто обнаруживают синхронные колебания Ca 2+ в соме, отражающие взрыв возбуждения нейронов (Bacci, Verderio et al. , 1999). Инкубация с очищенным TG2 способствовала возникновению синхронного спайка Ca 2+ и увеличению межспайкового спайка [Ca 2+ ] i , что приводило к блокированию осцилляторной активности (рис. 3A-I, «TG2»). После удаления TG2 промывкой KRH (рис. 3A-I, «Промывка») межспайковые [Ca 2+ ] и уменьшились до значений до обработки, и спонтанные колебания Ca 2+ возобновились, что указывает на то, что действие растворимого ТГ2 было обратимым.Для дальнейшего изучения действия TG2 на [Ca 2+ ] i нейроны подвергали воздействию TG2 в присутствии TTX (1 мкМ), что предотвращает спонтанную синаптическую и синхронную активность Ca 2+ . Практически во всех протестированных нейронах добавление TG2 приводило к небольшому, но очень значимому увеличению [Ca 2+ ] i в телах нейронов (рис. 3A-II, «TG2»), в то время как [Ca 2+ ] i изменения наблюдались в астроцитах, присутствующих в культурах. Чтобы исключить, что это явление было обнаружено только в диссоциированных культурах, мы исследовали влияние TG2 на срезы гиппокампа. Аналогичный ответ Ca 2+ вызывался TG2 в нейронах срезов гиппокампа мыши, нагруженных fura-2, когда белок TG2 добавляли в режиме перфузии (фиг. 3B). Чтобы выяснить, увеличивает ли внеклеточный TG2 базальные уровни Ca 2+ за счет усиления притока Ca 2+ в нейроны, мы подвергали культивируемые нейроны воздействию очищенного TG2 в растворе, не содержащем Ca 2+ (рис.3С-I). Не было повышения базального [Ca 2+ ] i в условиях отсутствия Ca 2+ , в то время как TG2-зависимое повышение Ca 2+ четко регистрировалось в тех же нейронах после добавления Ca 2+ ионов (2 мМ Ca 2+ ) во внеклеточную среду (фиг. 3C-II). Это устанавливает, что повышение [Ca 2+ ] i , вызванное экзогенным TG2, опосредуется притоком Ca 2+ из внеклеточной среды через плазматическую мембрану. Интересно, что действие TG2 было обратимым, что наблюдалось в отсутствие ТТХ (рис. 3А-I), и нейроны восстанавливали базальные [Ca 2+ ] i при удалении белка («Wash») из внеклеточной раствор (рис. 3А-I, 3А-II и 3В). Это открытие означает, что наблюдаемый процесс не может быть связан с трансамидированием, которое приводит к ковалентной необратимой модификации белковых субстратов и не должно исчезать после удаления TG2. Чтобы проанализировать это далее, мы проверили активность экзогенного TG2, добавленного к нейронам гиппокампа во время записи изображений с кальцием, и обнаружили, что он был каталитически неактивен в тех же экспериментальных условиях визуализации с кальцием, если только не был активирован добавлением восстанавливающего агента (рис.EV3). Примечательно, что ранее мы показали, что внеклеточный TG2, связанный с ECM, каталитически неактивен или малоактивен в отсутствие восстанавливающего агента (Verderio, Telci et al., 2003).

Рисунок 3. Экзогенный TG2 увеличивает межспайковый и базальный [Ca 2+ ] i в нейронах гиппокампа в культуре и в срезах головного мозга.

A) (I) Репрезентативный временной анализ синхронных колебаний Ca 2+ , выраженных как F340/380, спонтанно возникающих в 14 нейронах гиппокампа, нагруженных DIV Fura-2.Добавление экзогенного TG2 способствовало всплеску Ca 2+ , за которым следовало устойчивое плато Ca 2+ (обозначенное ΔF340/380) с блоком колебаний. После удаления TG2 (промывка KRH) возобновились синхронные колебания Ca 2+ . Три репрезентативных следа нейронов [Ca 2+ ] i показаны на каждом графике. На графике показана количественная оценка индуцированных TG2 межспайковых возвышений [Ca 2+ ] i по сравнению с базальным [Ca 2+ ] i (N = 23 нейрона, критерий Стьюдента: ****p <0.0001). (II) Добавление экзогенного TG2 в присутствии ТТХ (1 мкМ) значительно увеличивало [Ca 2+ ] i (обозначено ΔF340/380). На графике показана количественная оценка TG2-индуцированного повышения [Ca 2+ ] i (пик повышения Ca 2+ ) по сравнению с исходным [Ca 2+ ] i в присутствии TTX (N = 33). нейронов, критерий Стьюдента: ****p<0,0001). Данные представлены как среднее F340/380 ± SD. B) (I) Репрезентативные ДИК-изображения (вверху) и флуоресцентные изображения при 380 нм (внизу) нейронов пирамидального слоя (sp) срезов гиппокампа мыши, загруженных Fura-2/AM, для экспериментов по визуализации кальция.Stratum oriens (so) и stratum radiatum (sr) указаны выше и ниже sp соответственно. (II) Репрезентативный временной график роста [Ca 2+ ] i , вызванный перфузией внеклеточного TG2 в загруженных fura-2 срезах гиппокампа в 1 мкМ TTX (N = 3 среза мозга, всего 28 нейронов). C) Временной анализ изменений [Ca 2+ ] i в 14-20 нейронах DIV, подвергшихся воздействию экзогенного TG2 в отсутствие (I) или в присутствии (II) внеклеточного Ca 2+ .Добавление TG2 в отсутствие внеклеточного Ca 2+ не приводило к изменениям [Ca 2+ ] i (N=31 нейрон).

Затем мы спросили, может ли TG2, секретируемый/выводимый из нейронов, повышаться базально [Ca 2+ ] i подобно экзогенному/производному из астроцитов TG2. С этой целью мы сначала трансфицировали нейроны гиппокампа с помощью TG2 и измерили [Ca 2+ ] i . Трансфицированные клетки (pEGFP-N1-TG2) продемонстрировали увеличение покоящихся [Ca 2+ ] и по сравнению с контрольными нейронами (pEGFP-N1) (фиг.4А). Это указывает на то, что при избыточной экспрессии нейрональный TG2 может действовать внеклеточно аутокринным образом, контролируя базальные [Ca 2+ ] i , хотя мы не можем исключить внутриклеточное действие белка. Обработка трансфицированных клеток BOCDON, непроницаемым ингибитором TG2, нацеленным на внеклеточный TG2, не влияла на изменения [Ca 2+ ] i , вызванные трансфицированным TG2 (фиг. 4B). Тестирование трансамидирующей активности TG2, солюбилизированного во внеклеточном солевом растворе, подтвердило, что внеклеточный TG2 преимущественно неактивен, если его не обработать восстанавливающим агентом (фиг.EV3), и что ингибирование внеклеточного TG2 не влияет на внутриклеточные изменения Ca 2+ , мы заключаем, что TG2, вызывающий ответы Ca 2+ , преимущественно неактивен в качестве белкового сшивающего агента.

Рис. 4. Трансфицированный TG2 вызывает аутокринный рост кальция в нейронах.

A) (I) Репрезентативные следы, показывающие базальные [Ca 2+ ] i , выраженные как F340/380, в нейронах, трансфицированных pEGFP-N1-TG2 или pEGFP-N1 (8 DIV). (II) График, показывающий [Ca 2+ ] i в трансфицированных нейронах, выраженный как среднее значение F340/380 ± стандартное отклонение, нормализованное к EGFP (N>100 нейронов.Критерий Манна-Уитни: ****p<0,0001). B) Подгруппу трансфицированных нейронов обрабатывали непроницаемым ингибитором TG2 BOCDON (200 мкМ), который не влиял на [Ca 2+ ] i (N>45 нейронов). Значительная разница в [Ca 2+ ] i между EGFP и EGFP-TG2 наблюдалась в этой подгруппе, как на графике A-II (однофакторный тест ANOVA: **p<0,01).

Внеклеточный TG2 вызывает приток кальция через VOCC L-типа

Затем мы спросили, как внеклеточный TG2 способствует притоку Ca 2+ через плазматическую мембрану. Нейроны стимулировали экзогенным TG2 в присутствии блокаторов основных путей входа Ca 2+ в нейроны, а именно рецепторов глутамата и VOCC. Антагонист рецептора NMDA APV и антагонист AMPA/каинатного рецептора CNQX не влияли на увеличение количества Ca 2+ при добавлении TG2, что исключает участие этих лиганд-зависимых проницаемых рецепторов Ca 2+ в этом процессе (рис. 5A- I и 5А-II). Чтобы проанализировать возможный вклад VOCC, мы использовали подборку фармакологических ингибиторов этих каналов.Предварительная обработка кадмием, общим блокатором VOCC, снижала TG2-зависимые ответы Ca 2+ примерно на 82,4% (рис. 5B-I) и вызывала почти полное восстановление (88,3%) [Ca 2+ ] i по отношению к базальным уровням при применении во время фазы плато ответа Ca 2+ , индуцированного экзогенным TG2 (фиг. 5C-I). Точно так же предварительная обработка никелем, более специфическим ингибитором VOCC Т-типа, снижала TG2-зависимый рост Ca 2+ на 66,2% (рис. 5B-II), в то время как вызывала падение [Ca 2+ ] и ниже базового уровня (151% ингибирование) при применении во время фазы плато (рис.5С-II). На участие VOCC также указывало наблюдение, что переходные процессы Ca 2+ , вызванные деполяризацией (15 мМ KCl), нарастали быстрее и достигали более высокого пика в присутствии внеклеточного TG2 со значительным увеличением среднего Ca 2+ приток (рис. 5D). Среди VOCC, контролирующих транспорт Ca 2+ через плазматическую мембрану, VOCC L-типа очень распространены в соматодендритной области нейронов гиппокампа (Condliffe, Corradini et al., 2010; Leitch, Szostek et al., 2009; Праветтони, Баччи и др., 2000). Поэтому мы спросили, могут ли эти каналы способствовать притоку Ca 2+ в сому нейронов, вызванному экзогенным TG2. Мы обнаружили, что ответы Ca 2+ на TG2 были снижены примерно на 36% в нейронах, предварительно обработанных селективным блокатором L-типа нифедипином (NF) (рис. 5E-I). Кроме того, препарат вызывал частичное восстановление [Ca 2+ ] и до уровня покоя при применении во время фазы плато ответа Ca 2+ , индуцированного TG2 (фиг.5E-II), предполагая, что TG2-зависимый приток Ca 2+ частично происходит через VOCC L-типа.

Рисунок 5. Экзогенный TG2 опосредует приток Ca 2+ из внеклеточной среды.

A) Временной анализ изменений [Ca 2+ ] i в 14-20 нейронах DIV, подвергшихся воздействию экзогенного TG2 в отсутствие (I) или в присутствии (II) APV (антагонист рецептора NMDA) и CNQX (антагонист AMPA/каинатных рецепторов). Блокаторы не влияли на рост TG2-зависимого Ca 2+ .(III) Соответствующее количественное определение индуцированного TG2 пика [Ca 2+ ] i возрастает. Данные представлены как среднее значение ΔF340/380 ± SD (N = 46 и 9 нейронов для одного TG2 и блокаторов TG2 + соответственно; критерий Манна-Уитни: p = NS). B) Предварительная обработка кадмием (I), общим блокатором каналов Ca 2+ , и никелем (II), блокатором VOCC Т-типа, уменьшала TG2-зависимые ответы Ca 2+ примерно 82,4% и 66,2% соответственно, как определено количественно в (III), путем измерения общего притока Ca 2+ .Данные выражены как средняя площадь под кривой (AUC) ± стандартное отклонение блокаторов TG2 +, нормализованное только к TG2 (N = 7 и 15 нейронов для лечения Cd 2+ и Ni 2+ , соответственно, ранговый критерий Уилкоксона: *р<0,05; ****р<0,0001). C) Добавление кадмия (I) и никеля (II) во время фазы плато индуцированного TG2 ответа Ca 2+ приводило к восстановлению [Ca 2+ ] i до базового уровня. (III) Гистограммы показывают остаточные средние ответы Ca 2+ после того, как блокаторы нормализовали до пикового ответа Ca 2+ , вызванного TG2 ± SD (N = 18 и 25 нейронов для лечения Cd 2+ и Ni 2+ соответственно; ранговый критерий Уилкоксона: ****p<0. 0001). D) Переходные процессы Ca 2+ , индуцированные 15 мМ KCl в присутствии NMDAR и блокаторов ампа/каинатных рецепторов APV и CNQX, показали, что [Ca 2+ ] i рос быстрее и приводил к двукратному увеличению более высокий общий приток Ca 2+ в присутствии TG2. Данные выражены как среднее значение AUC TG2 + KCl, нормализованное по отношению к лечению одним KCl ± SD (N = 22 нейрона; знаковый ранговый критерий Уилкоксона: ****p<0,0001). E) Временной анализ [Ca 2+ ] i изменений, индуцированных TG2 в присутствии блокатора VOCC L-типа нифедипина (NF).(I) Общий приток Ca 2+ в ответ на TG2 был снижен примерно на 36% в нейронах, предварительно обработанных NF. Данные выражены как среднее значение AUC ± SD, индуцированное TG2 в присутствии NF, нормализованное только к TG2 (N = 21 нейрон; знаковый ранговый критерий Уилкоксона: ****p<0,0001). (II) NF вызывал частичное восстановление примерно 63% концентрации Ca 2+ до уровня покоя при применении во время фазы плато ответа Ca 2+ , индуцированного экзогенным TG2. Гистограммы показывают средние остаточные ответы Ca 2+ ± стандартное отклонение после нормализации НФ до пикового ответа Ca 2+ , вызванного одним TG2 (N = 25 нейронов; ранговый критерий Уилкоксона: ****p<0.0001).

Внеклеточный TG2 индуцирует деполяризацию мембраны и генерацию ионных внутренних токов, которые ингибируются нифедипином. . При токовом зажиме перфузия TG2 индуцировала медленную деполяризацию мембраны (около 20 мВ) (рис. 6A-I), которая устранялась добавлением никеля (рис. 6A-II). При фиксации напряжения TG2 стимулировал возбуждающие постсинаптические токи (EPSC), что согласуется с активацией внутреннего тока Ca

2+ (рис.6Б). В той же конфигурации анализ отношения ток/напряжение (кривые I/V) с использованием протокола выделения VOCC L-типа показал, что перфузия TG2 (рис. 6C-I, красная кривая I/V) приводит к повышенный входящий ток по сравнению с контролем (черная кривая I/V), который был полностью предотвращен присутствием блокатора VOCC L-типа NF (рис. 6C-II, красная кривая I/V по сравнению с контрольной черной кривой I/V) . Эти данные показали, что VOCC L-типа являются одной из возможных основных мишеней TG2, ответственных за нарушение регуляции базальной концентрации Ca 2+ в нейронах.

Рисунок 6. TG2 активирует внутренний кальциевый поток через деполяризацию мембраны VOCC L-типа.

A) Токовые клещи для цельных ячеек. (I) Добавление TG2 вызывало медленную деполяризацию мембран около 20 мВ (N=3). (II) Добавление никеля после того, как TG2 восстановил мембранный потенциал покоя. B) Зажим напряжения. Перфузия TG2 стимулировала возбуждающие постсинаптические токи (EPSC), что согласуется с активацией внутреннего тока Ca 2+ (N = 3). C) Результаты фиксации напряжения всей ячейки, выраженные в виде кривых ток/напряжение (I/V).(I) Перфузия TG2 (красная кривая I/V) привела к увеличению входящего тока по сравнению с контролем (черная кривая I/V). На графике справа показаны текущие записи того же эксперимента при −20 мВ. Протокол выделения VOCC L-типа применяли, как описано в Методах. (II) В присутствии NF (синяя кривая I/V) перфузия TG2 (красная кривая I/V, левая панель) не увеличивала входящий ток по сравнению с контролем (черная кривая I/V). На графике справа показаны текущие записи того же эксперимента при -20 мВ (N = 3).

Вклад обменника натрия/кальция в кальциевый ответ, вызванный TG2

На данный момент данные идентифицировали VOCC L-типа как основной канал, через который внеклеточный TG2 индуцирует приток Ca 2+ и деполяризацию мембраны. Несмотря на то, что электрофизиологические записи показали полное ингибирование внутреннего тока Ca 2+ , вызванного TG2, при блоке VOCC L-типа (рис. 6C), в экспериментах по визуализации Ca 2+ наблюдался остаточный ответ Ca 2+ , в основном чувствителен как к кадмию, так и к никелю (рис.5Е). В дополнение к VOCC известно, что и кадмий, и никель ингибируют активность обменника Na + /Ca 2+ (NCX), ключевого регулятора транспорта Ca 2+ через плазматическую мембрану. NCX обычно удаляет Ca 2+ из нейронов в обмен на Na + , который проникает в нейрон по его градиенту через плазматическую мембрану (Blaustein & Lederer, 1999). Однако нарушение градиента Na + приводит к работе NCX в обратном режиме, вызывая приток Ca 2+ в нейроны (Blaustein & Lederer, 1999).Чтобы исследовать участие NCX в обратном режиме в TG2-индуцированном притоке Ca 2+ , мы удалили Na + (и калий K + ) из внеклеточного физиологического раствора. В этих условиях ответ на внеклеточный TG2 был поразительно увеличен (примерно в 8 раз) (фиг. 7A), что свидетельствует о том, что NCX может усиливать TG2-зависимое вхождение Ca 2+ . И наоборот, добавление ингибитора NCX YM-244769 значительно снижало TG2-зависимый приток Ca 2+ как в нормальной среде, так и в среде без Na + (фиг.7B), что еще раз подтверждает вклад NCX в повышение уровня Ca 2+ в нейронах, подвергшихся воздействию TG2.

Рисунок 7. Вклад NCX в TG2-зависимое повышение уровня кальция.

Временной анализ изменений [Ca 2+ ] i в 14-20 нейронах DIV, подвергшихся воздействию экзогенного TG2. A) Добавление TG2 в KRH без Na + привело к 8-кратному увеличению среднего притока Ca 2+ по сравнению с нормальным KRH (N=20 нейронов; ранговый критерий Вилкоксона: **** р<0,0001). Данные выражены как среднее значение ± стандартное отклонение, нормализованное к значениям AUC TG2. B) Репрезентативный временной анализ ответов нейронов [Ca 2+ ] i , вызванных TG2 в отсутствие и в присутствии ингибитора NCX YM-244769 (10 мин) в Na + — без KRH. YM-244769 вызывал значительное снижение TG2-зависимого притока Ca 2+ . На графике показано среднее TG2-индуцированное AUC ± SD после YM-244769, нормализованное по одному TG2 в нормальном KRH (N = 25 нейронов; критерий знакового ранга Уилкоксона: ****p<0,0001) и KRH без Na + ( N=21 нейрон, ранговый критерий Уилкоксона: ****p<0. 0001).

Взаимодействие внеклеточных TG2 в нейронах гиппокампа: Na

+ /K + Ингибирование -АТФазы внеклеточными TG2 нейронов, мы иммунопреципитировали TG2 из лизата и секретома нейронов, обработанных внеклеточным TG2, и проанализировали иммунопреципитированные белки с помощью количественной сравнительной протеомики относительно иммунопреципитатов необработанных нейронов, как показано на рис.8A (полный список белков доступен в Таблице EV1).

Рис. 8. TG2-интеракторы во внеклеточной среде нейронов: ингибирование Na + /K + -АТФазы.

А) Рабочий процесс идентификации TG2-интеракторов. TG2 подвергали иммунопреципитации из нейронов гиппокампа (общий лизат, включая секретом), инкубированных с внеклеточным TG2 или необработанным (N=3 независимых иммунопреципитации, из нейронального препарата, полученного из ≥10 крысиных эмбрионов E18). Соосажденные белки TG2 (TG2-IP) расщепляли трипсином на гранулах и анализировали с помощью SWATH MS. Количественные данные SWATH были извлечены с использованием спектральной библиотеки, созданной с помощью дробовика / сбора данных (DDA) MS для всех образцов TG2-IP. B) Выбор интеракторов TG2 показан в соответствии с логарифмом кратности изменения (log 2 FC) между нейронами, подвергшимися воздействию внеклеточного TG2, и необработанными клетками. C) Активность АТФазы коры головного мозга свиньи (0,5 мЕд/лунку) анализировали в отсутствие или в присутствии gplTG2 (0,5 мЕд/лунку, 43,9 нМ) или уабаина (1 мМ). Данные представлены как среднее значение ± стандартное отклонение активности АТФазы (мЕд/мл), нормализованное к значениям только АТФазы (N = 3 независимых эксперимента, односторонний тест ANOVA: *p<0.05; ****р<0,0001).

Среди взаимодействующих факторов внеклеточного TG2 (рис. 8B) обнаружение связанного с везикулами мембранного белка 2 (VAMP-2) и альфа-растворимого белка прикрепления NSF (SNAA) (достоверность> 70%), предполагает, что внеклеточный TG2 локализуется в синапсы аналогично эндогенному белку (рис. 1). Ассоциация буферных белков Ca 2+ кальретинина, кальбиндина и субъединицы Ca 2+ /кальмодулин-зависимой киназы с внеклеточным TG2 согласуется со способностью внеклеточного TG2 вызывать [Ca 2+ ] i изменения в нейронах.Среди транспортеров, которые стали важными партнерами TG2, Na + / K + -транспортирующая субъединица АТФазы α (AT1A3) была в три раза больше связана с нейронами, подвергшимися воздействию внеклеточного TG2 (достоверность 70%) (рис. 8B). Мы предположили, что AT1A3 может быть частью механизма притока Ca 2+ , запускаемого внеклеточным TG2 посредством ингибирования Na + /K + -АТФазы TG2, с увеличением внутриклеточного Na + , приводящим к переключению NCX в обратном режиме (рис. 7A-B).Для проверки ингибирования АТФазы с помощью TG2 активность АТФазы измеряли с использованием АТФазы, выделенной из коры головного мозга свиньи в присутствии или в отсутствие TG2, с использованием специфического ингибитора Na + /K + -АТФазы уабаина в качестве контроля. Инкубация с TG2 привела к небольшому, но значительному снижению активности АТФазы, что свидетельствует о том, что нарушение транспорта Na + / K + внеклеточным TG2 может вызвать увеличение нейронального притока Ca 2+ (рис. 8C).

Согласно нашим данным, реактивные астроциты контролируют внутринейрональный [Ca 2+ ] i посредством высвобождения TG2 в ассоциации с внеклеточными везикулами (рис.9). При взаимодействии с нейронами внеклеточный TG2 способствует открытию кальциевых каналов L-типа и индуцирует работу Na + /Ca 2+ -обмена в обратном режиме, вероятно, за счет ингибирования Na + /K + -АТФаза, устанавливающая базальные [Ca 2+ ] i на более высокие уровни и усиливающая нейротрансмиссию. Эти результаты связывают астроглиоз, который обычно возникает при воспалении и дегенерации головного мозга, с дисгомеостазом Ca 2+ в нейронах и идентифицируют внеклеточный TG2 как ключевой астроцитарный фактор, вызывающий дисфункцию нейронов.

Рисунок 9. Схематическое изображение предлагаемого механизма.

A) Активированные астроциты высвобождают ЭВ, содержащие TG2 в качестве груза и отображаемые на поверхности ЭВ. B) Внеклеточный TG2 (либо связанный с астроцитами, либо свободный в среде) взаимодействует с нейронами и увеличивает [Ca 2+ ] i через (C) ингибирование Na + /K + -АТФаза, вызывающая деполяризацию мембраны (около 20 мВ) и активацию внутреннего тока Ca 2+ через (D) VOCC L-типа и (E) обменник Na + /Ca 2+ (NCX), что приводит к (F) увеличению [Ca 2+ ] i и Ca 2+ дисгомеостаза.

Обсуждение

Наше исследование раскрывает новый механизм, с помощью которого TG2 регулирует гомеостаз Ca 2+ в нейронах гиппокампа. Мы показываем, что внеклеточный TG2 управляет притоком Ca 2+ в нейроны как в культуре, так и в срезе мозга посредством ингибирования активности Na + /K + -АТФазы и последующей активации VOCCS L-типа и NCX, действующих в обратном направлении. режим.

Ключевым наблюдением является то, что источниками внеклеточного TG2 являются EV, полученные из астроцитов, которые имеют TG2 в качестве груза, отображаемого на поверхности EV.Связанный с EVs TG2 значительно увеличивает [Ca 2+ ] i в нейронах, что продемонстрировано селективным повышением [Ca 2+ ] i в ответ на EVs, происходящие из клеток WT, но не TG2KO. Примечательно, что содержание TG2 имеет тенденцию к увеличению в EV, высвобождаемых реактивными астроцитами. Это согласуется с опубликованными данными, показывающими более высокую экстернализацию астроцитарного TG2 в ответ на нейровоспаление (т.е. лечение TNF-α + IL-1β) (Pinzon et al., 2017) и повышение уровня TG2 в связи с астроглиозом, воспалительным процессом, который активируется в головном мозге в ответ на повреждение и высвобождение провоспалительных цитокинов (Hostenbach, Cambron et al., 2014; Иентиле и др., 2015). Астроциты играют ключевую роль в синаптическом масштабировании, то есть в регулировке силы синапсов в ответ на длительные изменения электрической активности для поддержания функции и выживания нейронов (Papouin, Dunphy et al. , 2017). Потенцирование синаптической силы в основном происходит за счет включения постсинаптических AMPA-рецепторов, управляемых высвобождением TNFα глиальными клетками (Stellwagen & Malenka, 2006). Однако точный механизм и молекулярные акторы, участвующие в синаптическом масштабировании, до сих пор неизвестны (Papouin et al., 2017). Путем усиления нейронов [Ca 2+ ] i TG2, высвобождаемый в ассоциации с астроцитарными EV, может способствовать передаче возбуждения, тем самым способствуя увеличению синаптического масштаба. Для рассмотрения этой интригующей гипотезы требуется дальнейшая работа.

EVs играют новую роль в перекрестных помехах нейрон-глия (Holm, Kaiser et al., 2018; Turola, Furlan et al., 2012). В частности, EV астроцитарного происхождения индуцируют длительную потенциацию спонтанной возбудительной передачи (Antonucci, Turola et al., 2012; Габриэлли, Баттиста и др., 2015 г.; You, Borgmann et al., 2020), но при хроническом воздействии EV из реактивных астроцитов оказывают пагубное влияние на стабильность синапсов (Prada, Gabrielli et al. , 2018), дифференцировку нейритов и возбуждение нейронов (You et al., 2020). ЭВ, полученные из астроцитов, выделенные из плазмы пациентов с болезнью Альцгеймера (БА), несут высокие уровни эффекторных белков комплемента по сравнению со здоровым контролем, что позволяет предположить, что они могут способствовать распространению воспалительных сигналов (Goetzl, Schwartz et al., 2018). Показав, что TG2, отсортированный на поверхности астроцитарных EV, обладает способностью регулировать гомеостаз нейронов Ca 2+ , мы добавили важную информацию для расшифровки сложной передачи сигналов от астроцитов к нейронам, опосредованной EV при физиологии и нейровоспалении.

Действие TG2, проявляющееся в EV, происходящих из астроцитов, также воспроизводится растворимым внеклеточным TG2. TG2-зависимый приток Ca 2+ устанавливает базальный [Ca 2+ ] i на более высокие уровни и способствует спонтанным EPSC.Это новая функция, которая ранее никогда не приписывалась TG2. Интересно, что [Ca 2+ ] i восстанавливается до исходного уровня после удаления TG2 из экстранейронального раствора, показывая, что этот процесс является обратимым и не связан с повреждением нейронов. Обратимость действия TG2 предполагает также, что гомеостаз [Ca 2+ ] i фермента регулирует скорее конформация, чем трансамидирующая активность фермента, поскольку ковалентное сшивание субстрата может привести к необратимым эффектам.Несколько прошлых и настоящих данных свидетельствуют о том, что TG2 способен к модификациям, независимым от сшивания (Акимов, Крылов и др., 2000; Стивенс, Гренар и др., 2004; Степпан, Бергман и др., 2017; Вердерио и др., 2003). и конформация TG2 важна для опосредования клеточного ответа (Katt, Antonyak et al., 2018). Было показано, что в клетках полосатого тела мышей TG2 в открытой конформации оказывает цитотоксическое действие, повышая восприимчивость клеток к гибели клеток, опосредованной недостатком кислорода/глюкозы. Однако основной механизм остается в значительной степени неизвестным (Colak, Keillor et al., 2011; Сингх, Чжан и др., 2016).

В соответствии с независимой от перекрестного связывания ролью TG2 в контроле динамики Ca 2+ , измерение активности очищенного TG2 in vitro в KRH, имитирующее внеклеточный раствор, используемый для Ca 2+ , и электрофизиологические записи, показали что белок в основном неактивен в этих экспериментальных условиях. Более того, специфический внеклеточный ингибитор TG2 (BOCDON) не влияет на внеклеточные TG2-опосредованные [Ca 2+ ] i изменения.С другой стороны, мы не можем исключить, что трансамидирующая активность фермента может частично способствовать контролю гомеостаза нейронов Ca 2+ . Например, можно предположить, что остаточная активность TG2 может воздействовать на субстраты, присутствующие во внеклеточной среде, которые могут способствовать притоку Ca 2+ при трансамидировании и которые удаляются вместе с TG2 на этапе промывки, что приводит к обратимости. В этом отношении трансамидирование моноаминовых нейротрансмиттеров, реакция, называемая моноаминилированием, является менее изученной функцией TG2, которая может играть роль в этом процессе (Muma, 2018).Следовательно, требуется дальнейшая работа, чтобы исключить возможный вклад активности TG2 в контроль динамики Ca 2+ .

Важно отметить, что мы показываем, что в физиологическом растворе TG2 индуцирует небольшое увеличение количества нейронов [Ca 2+ ] i , не связанное с гибелью клеток, устанавливая [Ca 2+ ] i до уровней, обычно отображаемых астроцитов в первичной культуре, которые значительно выше по сравнению с нейронами. Такое увеличение [Ca 2+ ] i является функционально значимым, поскольку оно способствует передаче нейронов (спонтанные EPSC).Это предполагает, что TG2 может выполнять фундаментальную гомеостатическую функцию в нейронах, способствуя нейротрансмиссии, а не только способствуя нейродегенеративным и нейровоспалительным процессам при перегрузке Ca 2+ (Grosso & Mouradian, 2012).

Идентификация VOCC L-типа и NCX как молекулярных мишеней TG2, опосредующих приток Ca 2+ и устанавливающих базальные [Ca 2+ ] i на более высоких уровнях в нейронах, обеспечивает механистическое понимание пути.Обе молекулярные мишени были идентифицированы с использованием фармакологических блокаторов в сочетании с Ca 2+ и электрофизиологических записей. Интересно, что активация VOCC L-типа важна для синаптической пластичности (Grover & Teyler, 1990; Raymond & Redman, 2002), такой как долговременная потенциация (LTP), предполагая, что через эту мишень TG2 может играть роль в физиологических функциях мозга. . Однако об изменениях активности VOCC также сообщалось при нейродегенерации, например, при AD (LaFerla, 2002; Nimmrich & Eckert, 2013), что позволяет предположить, что постоянная активация VOCC также может способствовать дегенеративным процессам.Подобно VOCC, NCX имеет основополагающее значение для регуляции [Ca 2+ ] i , а активация обратного режима (приток Ca 2+ ) была связана с невропатической болью, вызванной повреждением нерва (Jaggi & Singh , 2011), ишемическое повреждение (Matsuda, Arakawa et al. , 2001), повышенное повреждение нейронов, опосредованное дефицитом кислорода/глюкозы, и инфарктное повреждение (Secondo, Pignataro et al., 2015). Таким образом, устойчивые повышения TG2 во внеклеточной среде за счет открытия VOCC L-типа и обратной операции NCX могут участвовать в общей дисрегуляции гомеостаза Ca 2+ при нейродегенеративных состояниях.Анализ интерактома TG2 идентифицировал субъединицу Na + /K + -транспортирующей АТФазы в качестве партнера внеклеточной TG2, и наши данные предполагают, что ее ингибирование TG2 может обратить активность NCX, что приведет к Ca 2 + входящий поток и открытие VOCC L-типа.

В заключение, наши данные впервые подчеркивают специфическую функцию внеклеточного TG2, либо высвобождаемого астроцитами через EV, либо в растворимой форме, на гомеостаз Ca 2+ в нейронах посредством открытия VOCC L-типа и работы NCX в обратном режиме, вероятно, опосредованном Na + /K + -транспортирующей АТФазой (рис. 8). Это первое доказательство того, что астроциты контролируют внутринейрональный Ca 2+ посредством высвобождения TG2 в ассоциации с EVs.

Материалы и методы

Первичные культуры

первичные культуры нейронов гиппокампа были получены из эмбрионов крыс E18 Sprague Dawley, как описано ранее (Gabrielli et al., 2015). Через 14-21 день in vitro (DIV) культуры содержат значительный процент астроцитов (Verderio, Bacci et al., 1999). Первичные астроциты мышей C57BL/6 WT и нокаутных по TG2 (TG2 -/- или TG2KO) мышей P3 получали, как описано ранее (Gabrielli et al., 2015). Мыши TG2KO были первоначально получены от Gerry Melino (De Laurenzi & Melino, 2001) и полностью подвергнуты обратному скрещиванию, как описано ранее (Scarpellini, Huang et al., 2014). Для анализа активности поверхности клеток TG2 первичные астроциты были получены от BrainBits (BrainBits, Спрингфилд, Иллинойс, США) и обработаны в соответствии с протоколом производителя.

Реагенты

Печень морской свинки TG2 (Zedira GmbH, Дармштадт, Германия) 10–30 мкг/мл; ЛПС (Sigma-Aldrich, Сент-Луис, Миссури, США) 1 мкг/мл; ТТХ (Tocris, Бристоль, Великобритания) 1 мкМ; BOCDON (Zedira) 200 мкМ; нифедипин (Sigma-Aldrich) 1 мкМ; Кадмий (Sigma-Aldrich) 200 мкМ; никель (Sigma-Aldrich) 100 мкМ; YM-244769 (Токрис) 1 мкМ; APV (Tocris) 50 мкМ; CNQX (Tocris) 10 мкМ; биотин-кадаверин (Sigma-Aldrich) 0. 1 мМ; апираза (Sigma-Aldrich) 30 ЕД/мл; человеческий фибронектин (Sigma-Aldrich) 5 мкг/мл; АТФаза из коры головного мозга свиньи (Sigma-Aldrich) 0,5 мЕд; Уабаин (Токрис) 1 мМ.

Иммуноцитохимическое окрашивание

Клетки фиксировали в растворе 4% параформальдегида — 4% сахарозы (вес/объем) и проводили иммунофлуоресцентное окрашивание с использованием следующих антител: мышиные моноклональные анти-TG2 (IA12 – Tim Johnson, University of Sheffield (Scarpellini et al.) ., 2014)), анти-VGLUT1 морской свинки (Synaptic System, Геттинген, Германия), анти-GFAP кролика (Dako, Agilent, Санта-Клара, Калифорния, США), анти-Shank2 кролика (Synaptic System), анти-фибронектин кролика (Sigma-Aldrich), кроличьи анти-β-тубулины (Sigma-Aldrich) и кроличьи анти-NR2B (Аломоне, Иерусалим, Израиль).Вторичные антитела конъюгировали с флуорофорами Alexa-488, Alexa-555 и Alexa-633 (Invitrogen). Более подробная информация доступна в Таблице S1 Приложения. Покровные стекла визуализировали с помощью лазерного сканирующего конфокального микроскопа Leica SP5 с масляным иммерсионным объективом 63X. Последовательные серийные оптические срезы (0,5 мкм) регистрировали в плоскостях толщиной 5 мкм, и для количественного определения выбирали максимальные проекции. Интенсивность флуоресценции и совместную локализацию оценивали с использованием программного обеспечения Leica LAS AF Lite или программного обеспечения ImageJ, как указано в расширенных методах Приложения.

Неочищенный препарат синаптосом

Кортикальный слой двух взрослых мышей гомогенизировали в 10 мл холодного буфера SHE (4 мМ HEPES, pH 7,3, 320 мМ сахарозы, 1 мМ EGTA, ингибиторы протеазы) с использованием гомогенизатора со стеклянным тефлоновым покрытием на льду. Затем гомогенаты мозга центрифугировали при 1000 g в течение 10 мин при 4°C для получения супернатанта с низкой скоростью (LSS). Часть LSS сохраняли для анализа, а оставшийся объем центрифугировали при 12 500 g в течение 20 мин при 4°C для получения неочищенных синаптосом (пеллет). Осажденные синаптосомы однократно промывали в SHE (10 мл/мозг) и снова центрифугировали при 12 500×g в течение 20 мин при 4°C. Конечный осадок (неочищенная синаптосомная фракция) ресуспендировали в 1 мл буфера SHE и количественно определяли с помощью BCA (Sigma-Aldrich).

Вестерн-блоттинг

Образцы подвергали электрофорезу в полиакриламидных гелях с 10% SDS в соответствии со стандартными процедурами. Использовали следующие антитела: мышиные моноклональные анти-TG2 (IA12), анти-FLOT-2 (BD Biosciences, Wokingham, United Kingdom), анти-PSD-95 (Neuromab, Davis, C, USA), анти-TOM20 (Santa Круз, Даллас, Техас, США) и поликлональные кроличьи анти-TG2 (ab421) (Abcam), анти-β-тубулин (Abcam), анти-ALIX (Covalab, Брон, Франция), анти-NR2B (Аломоне, Иерусалим, Израиль ), анти-VGAT (Synaptic systems, Геттинген, Германия), анти-VGLUT1 (Synaptic systems), анти-GFAP (GeneTex).Более подробная информация доступна в Таблице S1 Приложения. Блоты проявляли с использованием усиленной хемилюминесценции (SuperSignal West Femto Maximum Sensitivity Substrate, Thermo Fisher Scientific), а интенсивность белковых полос определяли количественно с помощью Aida Image Analyzer v. 4.03 (Raytest, Германия).

Выделение внеклеточных везикул (ВВ)

ВВ выделяли из кондиционированной среды (КС) астроцитов с помощью дифференциального центрифугирования, как описано ранее (Furini et al., 2018; Prada et al., 2018).Центрифугирование при 10 000xg не проводили для одновременного осаждения больших и малых ЭВ. Каждый препарат астроцитов получен из ≥10 детенышей мыши P3. В частности, 80% конфлюэнтных монослоев дважды промывали PBS или KRH и инкубировали в бессывороточной среде в присутствии или в отсутствие липополисахарида (LPS, 1 мкг/мл) в течение 24 часов. CM собирали и добавляли ингибиторы протеазы перед центрифугированием. ЭВ ресуспендировали либо в неизмененном виде в PBS без частиц (для анализа отслеживания наночастиц, анализа активности TEM и TG2), либо в KRH (для визуализации Ca 2+ ), либо лизировали в буфере RIPA (для вестерн-блоттинга) или буфере для мягкого лизиса (0.25 М сахарозы, 2 мМ ЭДТА, 5 мМ Трис-HCl, рН 7,4) (для анализа активности TG2).

Анализ отслеживания наночастиц

Анализ отслеживания наночастиц (NTA) выполняли с использованием ZetaView PMX 120 (Particle Metrix, Meerbusch, Germany) и соответствующего программного обеспечения (ZetaView 8.04.02) для изучения распределения и концентрации электромобилей по размерам. Образцы ЭВ, ресуспендированные в PBS, не содержащем частиц, разбавляли до 50-200 частиц/кадр и анализировали с чувствительностью проточной кюветы 80% в течение двух циклов по 11 позиций/цикл.

Трансмиссионная электронная микроскопия

ЭВ, выделенные из необработанных астроцитов WT, анализировали с помощью трансмиссионной электронной микроскопии (ПЭМ), как описано ранее (Charrin, Palmulli et al., 2020), с некоторыми изменениями. Вкратце, ЭВ осаждали в течение 20 минут на никелевых ЭМ сетках с формваром/покрытием 200 меш (TAAB Laboratories Equipment Ltd, Беркс, Великобритания). Затем сетки фиксировали 2% параформальдегидным/фосфатным буфером с рН 7,4 и обрабатывали для негативного окрашивания или однократного мечения иммунозолотом. ЭВ окрашивали мышиным моноклональным антителом против CD63 (Abcam) или антителом против TG2 (IA12), а затем 6-нм коллоидным золотом против IgG мыши (Jackson Immunoresearch Europe, Эли, Великобритания). Негативное окрашивание проводили с использованием смеси уранилацетат/метилцеллюлоза, как описано ранее (Slot & Geuze, 2007). Просвечивающие электронные микрофотографии окрашенных электромобилей в светлом поле были сделаны при указанном увеличении в 40 000 раз с использованием ПЭМ JEM-2100Plus (JEOL, Herts, United Kingdom), работающего при ускоряющем напряжении 80 кВ, цифровые микрофотографии записаны с помощью КМОП-камеры Rio 16 с использованием ГМС 3.0 (Гатан, Плезантон, Калифорния, США).

Анализ общей активности TG2

Активность TG2 ЭВ в интактном (ресуспендированном в PBS) или лизированном (ресуспендированном в мягком лизирующем буфере) измеряли путем включения биотинового кадаверина (BTC, Sigma-Aldrich) в FN, как описано ранее (Jones, Николас и др., 1997). Образцы загружали в двух экземплярах (N=3 независимых эксперимента). Активность TG2 рассчитывали путем удаления значений поглощения, полученных из соответствующего буфера (либо PBS, либо буфера для лизиса), и выражали в мЕд/мкг белка.

Визуализация цитоплазматического кальция

Уровни внутриклеточного Ca 2+ оценивали в нейронах гиппокампа, загруженных красителем Fura-2/AM (Merck, Дармштадт, Германия), как описано ранее (Joshi, Turola et al., 2014) и объяснено в Приложение Расширенные методы. Нейроны отличали от астроцитов по морфологии и ответу на стимулы KCl (Bacci et al., 1999). Эксперименты проводили в растворе Кребса-Рингера HEPES (KRH) (125 мМ NaCl, 5 мМ KCl, 1,2 мМ MgSO 4 , 1.2 мМ KH 2 PO 4 , 2 мМ CaCl 2 , 6 мМ d-глюкозы и 25 мМ HEPES/NaOH, pH 7,4), тогда как в некоторых случаях Na + /K + не содержит Вместо этого использовался KRH, где и NaCl, и KCl изоосмотически заменяли хлорид холина. Концентрация Ca 2+ была выражена как отношение флуоресценции F340/380, как объяснено в Приложении Расширенные методы. Для каждого эксперимента N указывает общее количество проанализированных нейронов либо из нескольких слайдов одного и того же клеточного препарата, либо из разных препаратов.Каждый препарат нейронов получен из ≥10 эмбрионов крыс E18.

Визуализация кальция в срезах головного мозга

Срезы были получены от 10-дневных мышей CD1 и подготовлены, как описано в Приложении Расширенные методы. Протоколы сбора данных состояли из 1,2 кадра в секунду последовательностей флуоресценции Fura-2 с экспозицией 30 мс. Выбирали ROI по полю зрения и измеряли среднюю интенсивность пикселей в каждом кадре. После 3-минутной регистрации исходного уровня 30 мкг/мл TG2 (Zedira) в ACSF перфузировали до достижения плато ответа, затем отмывали.Анализ проводили с использованием программного обеспечения Metafluor (Molecular Devices, Сан-Хосе, Калифорния, США).

Транзиторная трансфекция

8 DIV (дней in vitro) нейроны трансфицировали 1,5 мкг вектора pEGFP-N1 (Clontech Laboratories, Takara Bio Inc. , Маунтин-Вью, Калифорния, США) или вектора pEGFP-N1-TG2 (Furini et al., 2018) с использованием 6 мкл Lipofectamine 2000 (Thermo Fisher Scientific) в общем объеме 100 мкл на предметное стекло (около 1,7×10 5 нейронов). После 45-минутной инкубации трансфицированные нейроны промывали нейробазальной средой и инкубировали в отфильтрованной кондиционированной среде для нейронов в течение 48 ч перед анализом.

Накладные клещи для цельных клеток

Эксперименты с накладными клещами проводились в конфигурациях с клещами по току и по напряжению, как описано в Приложении «Расширенные методы». Для текущих экспериментов по зажиму исследовали влияние TG2 (30 мкг/мл) на потенциал покоя нейронов. Были проведены эксперименты с зажимом напряжения, чтобы наблюдать за участием в этом явлении кальциевых каналов, управляемых напряжением (VOCC). В частности, VOCC L-типа выделяли с предварительным импульсом 40 мВ и ступенчатым протоколом Δ10 мВ от -30 до 0 мВ.

Выделение комплексов TG2 и сбор данных с помощью масс-спектрометрии

Белки, ассоциированные с TG2, выделяли из нейронов гиппокампа, инкубированных с 30 мкг/мл TG2 в буфере KRH в течение 5 мин, и из необработанных нейронов в качестве контроля (N=3). После инкубации супернатант удаляли и нейроны лизировали, используя IP-буфер (25 мМ трис-HCl, 150 мМ NaCl, 1 мМ ЭДТА, 1% [об./об.] раствор детергента NP40 и 5% [об./об.] глицерин, pH 7,4), содержащий коктейль ингибиторов протеазы (Sigma-Aldrich).Целоклеточный лизат центрифугировали при 13 000 g в течение 10 мин при 4°C для удаления более крупных частиц. TG2 со связанными белками иммунопреципитировали из клеточных лизатов и супернатантов, как описано ранее (Furini et al., 2018), с небольшими модификациями. Инкубацию образцов с гранулами, покрытыми антителами против TG2 (CUB7402; Thermo Fisher Scientific), проводили в течение 20 ч при 4°C при постоянном вращении. Белки восстанавливали, алкилировали и расщепляли трипсином непосредственно на гранулах, а пептиды анализировали с помощью RP-HPLC-ESI-MS/MS с использованием масс-спектрометра TripleTOF 6600 (SCIEX) в режиме сбора данных в зависимости от данных для построения спектральной библиотеки и в SWATH 2. .0 независимый от данных режим сбора данных с использованием 100 переменных окон сбора данных SWATH для количественной оценки, как описано в Приложении «Расширенные методы». Протеомные данные масс-спектрометрии были переданы в Консорциум ProteomeXchange через партнерский репозиторий PRIDE (Perez-Riverol, Csordas et al., 2019) с идентификатором набора данных «PXD022224». Анализ дифференциально экспрессируемых белков выполняли с использованием онлайн-платформы облачной обработки OneOmics (SCIEX), как описано в расширенных методах Приложения.

Анализ АТФазной активности

Na + /K + -АТФазную активность анализировали с использованием набора для высокопроизводительного колориметрического анализа АТФазы (Innova Biosciences, Кембридж, Великобритания) в соответствии с инструкциями производителя. АТФазу, выделенную из коры головного мозга свиньи (0,5 ед/лунку), анализировали в присутствии или в отсутствие gplTG2 (0,5 ед/лунку) и специфического ингибитора Na + /K + -АТФазы уабаина (1 мМ).

Статистический анализ

Все данные представлены как среднее значение ± SD из указанного количества независимых экспериментов (N=3) или клеток, как указано в подписях к соответствующим рисункам. Каждый препарат первичных клеток был получен из ≥10 эмбрионов крыс E18 (нейроны гиппокампа) или ≥10 детенышей P3 мыши (астроциты). Данные в каждом эксперименте сначала проверяли на нормальное распределение с помощью критерия нормальности Д’Агостино-Пирсона (программное обеспечение GraphPad Prism 7.05). В случае нормально распределенных данных статистический анализ проводили с помощью t-критерия Стьюдента (сравнения 2 групп) или однофакторного дисперсионного анализа (критерий множественных сравнений Тьюки). В случае ненормально распределенных данных статистический анализ проводили с помощью непараметрического критерия Манна-Уитни (сравнения 2 групп) или критерия Крускала-Уоллиса-Данна (множественные сравнения).Для парных нормализованных данных использовался знаковый ранговый критерий Уилкоксона для согласованных пар. Различия считаются достоверными при р<0,05.

Заявление о доступности данных

Наборы данных протеомики масс-спектрометрии были депонированы в Консорциум ProteomeXchange через партнерский репозиторий PRIDE (Perez-Riverol et al. , 2019) с идентификатором набора данных «PXD022224» (http://www.ebi. ac.uk/прайд). Остальные данные включены в эту опубликованную статью (и ее дополнительные информационные файлы).

Заявление об участии автора

E.T., M.M, C.V. и EAMV задумали и разработали исследование. Э.Т., И.В., М.Г., Г.Ф., К.К. и MPS провели исследование. И.Т., И.В., И.П., М.Г., Д.Дж.Б., Г.С., М.М., К.В. и E.A.M.V проанализировали и интерпретировали данные. Э.Т., И.В., К.В. и Э.А.М.В. написал бумагу. Все авторы прочитали и одобрили окончательную статью.

Заявление о конфликте интересов

Авторы заявляют об отсутствии конфликта интересов.

Расширенный вид Подписи к рисункам

Рисунок EV1.TG2 локализован на поверхности первичных астроцитов . Активность TG2 клеточной поверхности в первичных астроцитах (до 44 DIV) с использованием ингибитора TG2 ZDON (100 мкМ) для проверки специфической активности TG2. Данные представлены как среднее значение ± стандартное отклонение необработанных значений поглощения за вычетом фона, нормализованных к CTR в присутствии 0,1% ДМСО (носитель) (N=4, критерий Манна-Уитни: ***p<0,001).

Рисунок EV2. TG2 локализуется внеклеточно в первичных астроцитах и ​​локализуется совместно с фибронектином . Иммунофлуоресцентное окрашивание первичных астроцитов.Клетки фиксировали в 3% параформальдегиде (масса/объем) без пермеабилизации и окрашивали анти-TG2 IA12 (зеленый), DAPI (синий) и маркером ЕСМ фибронектином (FN, красный). Покровные стекла визуализировали с помощью лазерного сканирующего конфокального микроскопа Leica SP5 с масляным иммерсионным объективом 63X. Последовательные серийные оптические срезы (1 мкм) были записаны на плоскости 8 мкм. Масштабная линейка 20 мкм.

Рисунок EV3. TG2 в KRH имеет незначительную активность в отсутствие восстанавливающего агента (DTT) . Анализ общей активности TG, оценивающий уровни активности TG2 in vitro, выраженные в мЕд/мкг белка.TG2 инкубировали в буфере KRH с pH 7,4 (который содержит 2 мМ кальция) в присутствии или в отсутствие 10 мМ DTT. Данные выражены как среднее значение ± стандартное отклонение (N=3, каждая точка анализируется дважды. Критерий Манна-Уитни: **p<0,01).

Благодарности

Эта работа была поддержана стипендией Джона Терланда доктора философии (для ET и EAMV), исследовательской стипендией Американской ассоциации (для IP и CV) (AARF-588984), краткосрочным грантом IBRO/PERC InEurope для ET, стипендию AIRC для Италии И.V., Фонд Мармонта и Фонд исследования качества REF Ноттингемского Трентского университета (в EAMV). Мы благодарны профессору Джеффу Кейлору (Университет Оттавы, Канада) за критическое прочтение рукописи. Мы благодарим профессора Дэвида Абрахама (Университетский колледж Лондона/Медицинская школа, Великобритания) и профессора Тимоти Джонсона (Университет Шеффилда, Великобритания) за щедрое совместное использование помещений. Мы благодарны доктору Джулии Д’Арриго (Институт неврологии CNR, Италия) за ее помощь в поддержании первичных клеточных культур, а также выражаем признательность NTU Imaging Suite и доктору Грэму Дж.Хикману за помощь в получении данных ПЭМ.

Сноски

  • ↵* Элизабетта А. М. Вердерио, Школа науки и технологий, Университет Ноттингем-Трент, Клифтон-лейн, Ноттингем, NG11 8NS, Великобритания, тел.: +44 (0)115 848 6628; факс: +44 (0)115 848 6636, Электронная почта: elisabetta.verderio-edwards{at}ntu.ac.uk, Клаудия Вердерио, Институт неврологии CNR, via Vanvitelli 32, 20129 Milan, тел.: +33 02 50317011, Электронная почта: c.verderio{at}in.cnr.

  • Добавлены рисунки/таблицы в расширенном виде (рис. EV1, EV2, EV3; таблица EV1) и Приложение (расширенные методы и дополнительная таблица S1) Хост-мозг на JSTOR Абстрактный

    Активность внутригиппокампальных трансплантатов холинергических нейронов контролировали с помощью микродиализа у бодрствующих свободно движущихся крыс. Ткань фетальной септально-диагональной полосы имплантировали крысам с полным пересечением холинергического пути фимбрии-свода либо в виде клеточной суспензии, введенной в гиппокамп, либо в виде твердого трансплантата, имплантированного в полость поражения. Трансплантаты восстанавливали исходный уровень высвобождения ацетилхолина в реиннервированном трансплантатом гиппокампе до нормального или сверхнормального уровня. Высвобождение ацетилхолина из трансплантата зависело от интактного аксонального импульсного потока и было заметно увеличено во время поведенческой активации сенсорной стимуляцией или электрической стимуляцией латеральной уздечки. Результаты показывают, что септальные трансплантаты, несмотря на их эктопическое расположение, могут быть функционально интегрированы с мозгом хозяина и что активность трансплантированных холинергических нейронов может модулироваться мозгом хозяина во время текущего поведения.Анатомические наблюдения с использованием иммуногистохимии и ретроградного отслеживания показывают, что прямые или непрямые афференты ствола мозга к трансплантату могут опосредовать эту функциональную интеграцию. Таким образом, афферентный контроль хозяина над трансплантатом может играть роль в восстановлении функционального дефицита, вызванного поражением, наблюдаемого с этими типами трансплантатов.

    Информация о журнале

    PNAS — самый цитируемый в мире междисциплинарный научный сериал. Он публикует высокоэффективные исследовательские отчеты, комментарии, перспективы, обзоры, документы коллоквиума и действия Академии.В соответствии с руководством принципы, установленные Джорджем Эллери Хейлом в 1914 году, публикует PNAS краткие первые объявления членов Академии и иностранных партнеров подробнее важный вклад в исследования и работы, которые, по мнению члена, иметь особое значение.

    Информация об издателе

    Национальная академия наук (НАН) — частная некоммерческая организация ведущих исследователей страны. NAS признает и продвигает выдающуюся науку путем избрания в члены; публикация в своем журнале PNAS; и его награды, программы и специальные мероприятия.Через Национальные академии наук, инженерии и медицины NAS предоставляет объективные, научно обоснованные рекомендации по важнейшим вопросам, затрагивающим нацию.

    Серотониновый рецептор 3А контролирует миграцию интернейронов в неокортекс

    Мыши

    Эксперименты на животных проводились в соответствии со швейцарскими и международными рекомендациями и одобрены местным Женевским комитетом по уходу за животными. Взрослых беременных мышей с рассчитанным временем спаривания получали путем ночного (ON) спаривания, а следующее утро считали эмбриональным днем ​​(E) E0.5. Для изучения ИН, полученных из CGE, мы использовали трансгенных мышей, экспрессирующих GFP под контролем регуляторных последовательностей GAD65 ( GAD65- GFP) 25,30 , и трансгенных мышей, экспрессирующих усиленный GFP под контролем . Регуляторные последовательности Htr3a ( Htr3a- GFP), предоставленные Консорциумом GENSAT 16 . Оба штамма содержались на фоне C57Bl/6. Мышей C57Bl/6 дикого типа использовали в экспериментах с трансплантатами in vivo .Мыши Nkx2.1 -Cre были ранее описаны 32 , а репортерные мыши R26R- tdTOM fl/fl были получены из лаборатории Джексона. Мышей Htr3a- GFP скрещивали с мышами R26R- tdTOM fl/fl для получения мышей Htr3a- GFP; R26R- tdTOM fl/fl мышей. Мыши Htr3a -ko были ранее описаны 57 и скрещены с мышами GAD65- GFP для получения Htr3a -ko; GAD65- GFP животные.

    Обработка тканей и иммуногистохимия (IHC)

    Беременных самок подвергали эвтаназии путем летальной внутрибрюшинной (ip) инъекции пентобарбитала (50 мг кг -1 ), эмбрионы собирали путем кесарева сечения, мозг вырезали и фиксировали на холоде 4 % параформальдегида (PFA), растворенного в 0,1 M фосфатном буфере, pH 7,4. Для постнатального мозга животных глубоко анестезировали внутрибрюшинно. инъекция пентобарбитала, транскардиально перфузированная 0,9% физиологическим раствором с последующим введением холода 4% PFA и постфиксация (ON) в холоде 4% PFA.Мозг вырезали на Vibratome (Leica, VT1000S) для IHC и для свободно плавающей гибридизации in situ . Срезы хранили при 4 °C в 0,1 M фосфатно-солевом буфере и окрашивали с помощью ИГХ, как описано 31 , со следующими первичными антителами кролика анти-GFP (1:500; Millipore), козьего анти-GFP (1:1000; Chemicon ), мышиное антитело к фактору транскрипции 2 вышестоящего промотора овальбумина человека (COUP-TFII; 1:500; протеомика Perseus), козье анти-SP8 (1:50; Санта-Крус), кроличье анти-NKX2.1 (1:100; Santa-Cruz), анти-PV мыши (1:1000; Swant), анти-SST крысы (1:500; Millipore), анти-рилин мыши (1:500; Abcam), анти-VIP кролика (1:500; Abcam), кроличьи анти-NPY (1:1000; Immunostar), кроличьи анти-калретинин (1:1000; Swant).Вторичные козьи или ослиные антитела Alexa-488, -568 и -647 (Molecular Probes, Invitrogen), полученные против соответствующих видов, использовали в разведении 1:500–1000, а срезы контрастно окрашивали Hoechst 33258 (1:10000).

    Гибридизация in situ

    Срезы гибридизовали, как описано ранее 25 , с соответствующими РНК-зондами, меченными DIG. Плазмидный зонд Htr3a 16 был линеаризован с помощью HindIII-HF для синтеза РНК-зонда полимеразой Т7 (любезный подарок доктора Б.почётный). Плазмидный зонд Lhx6 58 (любезный подарок доктора М. Денакса) линеаризовали с Not 1 для синтеза зонда антисмысловой РНК полимеразой Т3. Несвязавшийся зонд промывали, а срезы инкубировали с антителами против DIG, конъюгированными со щелочной фосфатазой (1:2000; Roche) при 4 °C. Затем NBT/BCIP (Roche) использовали в качестве субстрата щелочной фосфатазы для выявления гибридизованного зонда. Fast Red (Roche) использовали в качестве флуоресцентного субстрата щелочной фосфатазы.

    Приготовление диссоциированных культур и острых срезов

    Для изучения миграции, E14.5 и E17.5 коры из GAD65 -GFP + корональных срезов выделяли под флуоресцентным микроскопом (Leica, M165 FC) посредством микродиссекции. Для записи кальция была выполнена микродиссекция CGE каудальных коронарных срезов E14. 5 Htr3a- GFP и коры коронарных срезов E14.5 дикого типа. Изолированную ткань собирали в сбалансированном солевом растворе Хэнкса (HBSS), растирали вручную и диссоциировали в трипсине при 37 °С в течение 15 минут и блокировали сывороткой плода теленка.Затем диссоциированные клетки центрифугировали в течение 5 мин при 1200 об/мин. и осадки ресуспендировали в нейробазальной среде (NBM; Invitrogen) с добавлением 2% B27 (Gibco), 2 мМ глутамина, 1 % пенициллина-стрептомицина, 2 мМ N -ацетилцистеина и 1 мМ пирувата натрия. Для анализа миграции клетки высевали в 96-луночные микропланшеты (Costar 3720), покрытые ламинином (10 мкг/мл -1 ; Invitrogen) и поли-D-лизином (0,1 мг/мл -1 ; Sigma). Острые срезы головного мозга готовили, как описано 24 , из Htr3a -GFP+, GAD65 -GFP+ и Htr3a -ko; GAD65 -GFP + эмбрионов.Вкратце, мозг извлекали, заливали в HBSS с 3% сверхчистой агарозы с низкой температурой плавления (Invitrogen или Roth) и нарезали срезы толщиной 250 мкм на вибратоме (VT1000S; Leica) в холодном кислороде (95% O ). 2 , 5% CO 2 ) искусственная спинномозговая жидкость (ИЦЖ), содержащая (в мМ): NaCl (125), KCl (3), CaCl 2 (1,6), MgCl 2 (1,5), NaH 2 PO 4 (1,25), NaHCO 3 (26), D-глюкоза (10) Na 2 HPO 4 , pH 7.6).

    FACS и микроматрицы

    Острые срезы коры получали, как описано выше, и под флуоресцентным диссекционным эндоскопом (Leica, M165 FC), паллиум E14.5, включая поток SVZ, и развивающиеся коры E18.5 и P2.5, исключая Поток SVZ выделяли из GAD65- GFP+ каудальных коронарных срезов. Каждая временная точка была получена в трех повторностях из трех разных пометов и состояла из объединенных эмбрионов или детенышей ( n = 4–5). После диссоциации ткани клетки GAD65 -GFP + выделяли с использованием FACS с FACS VantageSE и собирали в растворе RNA Later (Invitrogen).РНК из клеток выделяли с помощью набора RNeasy Mini (Qiagen) и проверяли качество на биоанализаторе Agilent 2100 (Agilent Technologies). Для воспроизводимой амплификации и мечения общей РНК использовали мелкомасштабный протокол от Affymetrix (High Wycombe). Вкратце, примерно 100 нг общей РНК превращали в двухцепочечную кДНК с использованием набора для синтеза кДНК (Superscript; Invitrogen) со специальным олиго(dT)_24 праймером, содержащим промоторный сайт Т7 РНК, добавленный к 5′-поли(Т) тракту. После первой амплификации кРНК с помощью транскрипции in vitro с использованием набора Ambion MEGAscript T7 (Ambion) 400 нг кРНК снова подвергли обратной транскрипции, а биотинилированные кРНК получили из двухцепочечной кДНК с использованием набора для мечения транскрипции in vitro от Аффиметрикс.Для каждого зонда 20 мкг биотинилированной кРНК второй амплификации фрагментировали и гибридизовали с массивом Mouse Genome 430 2.0 (Affymetrix) в соответствии со стандартными протоколами. GeneChips инкубировали при 45 °C в течение 16 h с меченными биотином кРНК-зондами, промывали и окрашивали конъюгатом стрептавидин-фикоэритрин с амплификации антител с использованием Affymetrix GeneChip Fluidis Station 450. GeneChips сканировали на сканере GC3000 (Affymetrix). Интенсивность сигналов анализировали с помощью пакетов Partek Genomics (версия 6.6 бета), и данные были нормализованы с использованием надежного среднего значения нескольких массивов (RMA) 59 . Уровни экспрессии генов матричной РНК (ProbeSet) сравнивали с использованием модели двустороннего дисперсионного анализа и сравнивали с нескорректированными значениями P , установленными на уровне <0,01 порога. Отбор генов-мишеней, специфически увеличивающих их экспрессию во время инвазии CP на E18.5, был основан на > 2-кратном увеличении интенсивности с E14.5 по сравнению с E18.5 и > 2-кратном снижении интенсивности с P2.5 по сравнению с E18.5.

    Количественная оценка экспрессии белка с помощью ELISA

    Микродиссекцию CGE проводили на E14.5, диссоциированные трипсином клетки высевали на 96-луночные планшеты и культивировали в NMB с добавлением м CPBG (10  мкМ; Tocris) и митотический ингибитор арабинофуранозилцитидин (1  мкМ). Количественную оценку уровней белка проводили с использованием набора ELISA (Thermo Scientific) и антитела 5-HT 3A R (1:1000, LSBio) на E14,5 день in vitro 1 (+DIV1) или E14.5 (+DIV4) ячеек. Уровни поглощения измеряли на многорежимном считывающем устройстве для микропланшетов SpectraMax Paradigm (Molecular Devices). Уровни поглощения для 5HT 3A R нормализовали к уровням поглощения, рассчитанным для общего количества клеток с помощью окрашивания целых клеток Янусом Грином.

    Фокальная электропорация на срезах

    Для фокальной электропорации на срезах острые корональные срезы E14.5 Htr3a -GFP + эмбрионов переносили на мембраны (nucleopore Track-Etch; размер пор 1  мкм, Whatman), плавающие на NBM в инкубаторе (37 ° C, 5% CO 2 ) в течение не менее 2 часов после срезов Vibratome.Плазмиду, кодирующую красный флуоресцентный белок (pUBI-tdTOM), фокально вводили в концентрации 1 мкг/мл -1 через микропипетку со скошенным стеклом в МГЭ с помощью наноинъектора (B203XVZ; WPI), и точность места инъекции определяли. контролировали добавлением 10% Fast Green (Sigma) к плазмиде. Срезы сохраняли увлажненными в HBSS и подвергали электропорации между платиновой чашкой Петри и платиновыми квадратными электродами (CUY701-P5E и CUY701-P5L; Nepa Gene) с двумя однополярными прямоугольными импульсами (Δ P : 100 В; продолжительность: 5 мс; интервал : 500  мс), созданный электропоратором CUY21-SQ (Nepa Gene).Затем срезы культивировали 3 дня in vitro (+DIV3) в инкубаторе (37 °C и 5% CO 2 ).

    Визуализация и анализ кальция

    Эксперименты с кальцием проводились в культурах, выделенных CGE (E14.5 +DIV1–3; см. выше; Получение диссоциированных культур и острых срезов). Культуры клеток загружали Fura-2AM (1 мкМ; Invitrogen) в NBM в течение 20 минут в инкубаторе (37 °C, 5% CO 2 ). Наблюдения проводились в ванне (RC-26; Warner Instruments) с непрерывной инфузией ACSF (95% O 2 , 5% CO 2 ) под инвертированным эпифлуоресцентным микроскопом (Observer Z1; Zeiss), оборудованным для визуализации в реальном времени ( Life Technologies) с масляным иммерсионным объективом × 40 (Zeiss, Fluar × 40/1. 3 масло Ph4) и камеру CoolSNAP-HQ. Температуру ACSF и камеры ванны микроскопа поддерживали на уровне 37 °C. Программное обеспечение MetaFluor (версия 7.7.0.0; Molecular Devices) использовалось для получения изображений каждую секунду и мониторинга изменений внутриклеточного кальция. События кальция анализировали в Clampfit (версия 9.2.0.11; Molecular Devices). Запись исходного уровня была получена перед заражением клеток м CPBG (1 мкМ) или гидрохлоридом SR57227 (1 мкМ). Для выделения специфических ответов на активацию 5-HT 3A R были проведены эксперименты с блокаторами потенциалзависимых натриевых каналов, рецепторов AMPA, рецепторов NMDA и рецепторов GABA A (соответственно, ТТХ, 200 нМ; NBQX, 2 мкМ; D-AP5, 20 мкМ и габазин, 4 мкМ; Tocris) суперфузировали за 5 мин до и вместе с м CPBG.Жизнеспособность клеток систематически оценивали с помощью конечной суперперфузии 100 мМ KCl в ACSF. Событие, связанное с кальцием, определяли как повышение уровня кальция в два раза, превышающее исходную активность, и продолжавшееся более 1 с. Htr3a -GFP + cIN были зарегистрированы на E14.5 (+DIV1) и E14.5 (+DIV3) в присутствии и в отсутствие блокаторов.

    Электрофизиологические записи

    Коронарные срезы мозга толщиной 300 мкм были получены на E14-E15, E18-E19, P2/P3 с использованием Vibratome (Leica, VT1000S).Во время записи срезы непрерывно суперфузировали ACSF, содержащим (в мМ): NaCl (120), KCl (3,5), CaCl 2 (2,5), MgSO 4 (1,3), NaH 2 PO 4 ( 1,25), NaHCO 3 (25), глюкоза (25), непрерывно барботировали 95% O 2 и 5% CO 2 , pH 7,4. Записи напряжения и тока в целых клетках были сделаны из визуально идентифицированных нейронов GFP + с использованием усилителя EPC9 (HEKA) и вертикального микроскопа (Zeiss Axioskop FS2), оснащенного инфракрасным дифференциальным интерференционным контрастом (IR-DIC) и стандартной эпифлуоресценцией.Патч-пипетки имели сопротивление 4–6 МОм при заполнении (в мМ): 105 K-глюконата, 30 KCl, 0,5 CaCl 2 , 5 EGTA, 2 Mg-ATP, 10 HEPES. Нанесение серотонина (5-НТ, 100 мкМ; Tocris) или гидрохлорида SR 57227 (100 мкМ; Tocris) осуществляли посредством выброса под давлением из второй пипетки, соединенной с пикосприцером. Чтобы выделить специфические ответы на активацию 5-HT 3A R, записи на E17-E18 проводили с блокаторами (ТТХ, 1 мкМ; NBQX, 10 мкМ; D-AP5, 100 мкМ и габазин, 20 мкМ; Tocris).Клетки зажимали по напряжению при -60 мВ, и токи вызывали серией деполяризующих импульсов напряжения длительностью 20 мс. Записи токовых клещей выполнялись в ответ на длительные (1 с) инъекции гиперполяризующего и деполяризующего тока. Сигналы фильтровались на частоте 1–5 кГц, дискретизировались на частоте 2–10 кГц, а автономный анализ выполнялся с помощью Igor Pro (Wavemetrics).

    Интервальная визуализация и анализ

    Интервальная визуализация мигрирующих клеток GAD65 -GFP + в культурах выполнялась с использованием автоматизированного микроскопа (ImageXpress Micro XL; Molecular Devices), оснащенного объективом × 10 (Plan Fluor × 10/0. 30 Ph2), что позволяет одновременно регистрировать мигрирующие клетки в нескольких лунках при 37 °C при 95% O 2 и 5% CO 2 . После контрольного периода визуализации в течение 360 минут в среду добавляли гидрохлорид SR57227 (100 нМ; Tocris), серотонин (5-HT, 100 нМ; Tocris) или носитель (NBM) и проводили регистрацию в течение дополнительных 360 мин. мин. Используя программное обеспечение Metamorph (версия 7.4; Molecular Devices), клетки отслеживали на E14.5 (+DIV1) и на E17.5 (+DIV1). Покадровую визуализацию инвазии cIN в кору выполняли на срезах коры на E17.5, помещенный на вставки из пористой нитроцеллюлозы (Millicell-CM, Millipore) во фторопластовые чашки (WPI), заполненные NBM, и с инвертированным конфокальным микроскопом (Nikon A1R), оборудованным для визуализации в реальном времени (Life Technologies) с объективом с большим рабочим расстоянием × 20 (CFI Plan Fluor ELWD C × 20/0,45, Nikon). Температуру в инкубационной камере микроскопа поддерживали на уровне 37°C при постоянном потоке (25 л ч -1 ) 5% CO 2 при влажности 96%. Стопки толщиной 50 мкм (с шагом 3 мкм) получали каждые 10 мин в течение 10–12 ч с резонансным лазерным сканированием для снижения токсичности и предотвращения обесцвечивания.Первые 90 минут фильмов были исключены из анализа, чтобы избежать систематической ошибки в измерениях из-за оседания срезов в камере микроскопа. Для количественной оценки кортикальной инвазии промежуточную зону (260–410 мкм от мягкой оболочки) и корковые (50–220 мкм от мягкой оболочки) компартменты рисовали вручную в Metamorph и GFP + IN из GAD65 -GFP + и Htr3a -ko ; Срезы GAD65 -GFP + , расположенные в отсеке IZ в начале, отслеживали в течение 8 часов.Рассчитывали процент GAD65 -GFP + IN, попавших в кору и не вернувшихся обратно в IZ или далее мигрировавших в MZ в течение 8-часового периода времени. Скорость миграции рассчитывали как общее расстояние, пройденное GAD65 -GFP + IN, деленное на общее время визуализации без учета времени паузы. Процентное время паузы рассчитывали как долю времени, в течение которого клеточное ядро ​​оставалось неподвижным в течение периода визуализации. Для одновременной визуализации конусов роста CGE INs и MGE INs, E14.5 (+DIV3) Htr3a -GFP + срезов, которые были подвергнуты фокальной электропорации в MGE (см. Фокальная электропорация на срезе), помещали в ванную камеру (RC-26; Warner Instruments) и иммобилизовали якорем. Визуализация была сделана в CP с непрерывной суперфузией оксигенированного ACSF (95% O 2 , 5% CO 2 ) под инвертированным конфокальным микроскопом (Nikon, A1R), оборудованным для визуализации в реальном времени с масляным иммерсионным объективом × 60. (Plan Apo VC H × 60/1.4, Nikon) с числовым увеличением × 3.Температуру ACSF и инкубационной камеры микроскопа поддерживали на уровне 37 °C. Стопки толщиной 10 мкм (с шагом 1 мкм) регистрировались каждые 2 мин с помощью резонансного лазерного сканирования. Двойное изображение было выполнено в режиме серии каналов, чтобы избежать перекрестных помех флуоресценции. Сеансы визуализации систематически начинались через 20–30 минут после погружения среза в ACSF, чтобы избежать осевого смещения, потери фокуса и смещения при измерении из-за оседания среза. Стандартный сеанс визуализации состоял из исходного периода в 14 минут, за которым следовали 14-минутные аппликации препарата ( м CPBG, 100 мкМ; Tocris) и 2 промывания по 14 минут.Стеки покадровой съемки были выровнены с помощью программного обеспечения Metamorph (версия 7.4). Для количественной оценки контуры конуса роста были нарисованы вручную с помощью Metamorph, и была измерена их скорость развития, а также их площадь. Скорость рассчитывали, отслеживая основание конуса роста. Ведущий отросток принимался за ось роста, так что все движения к конусу роста считались положительными, а к телу клетки — отрицательными.

    In vivo трансплантатов

    CGE E14.5 GAD65 -GFP + или Htr3a -ko; Мышей GAD65 -GFP + выделяли, клетки диссоциировали и ресуспендировали для получения клеточной суспензии примерно 100000 клеток на мкл. К суспензии клеток добавляли 10% Fast Green (Sigma) в качестве индикатора. С помощью наноинъектора (WPI, B203XVZ) примерно 1 мкл клеточной суспензии вводили в ХГЭ эмбрионов от беременных E14.5 WT с помощью стеклянных пипеток со скошенной кромкой диаметром 70–100 мкм. Эмбрионы от мыши-хозяина затем собирали на Е19 для обработки и анализа тканей.Для количественного определения использовали только эмбрионы с привитыми клетками, наблюдаемые в CGE на E19.

    Количественная оценка идентичности и распределения ИН

    Изображения были получены с использованием эпифлуоресцентного микроскопа (Nikon, Eclipse 90i), оснащенного объективом × 10 (Plan Apo × 10/1, Nikon), или конфокального (Nikon, A1R) микроскопа, оснащенного сухие объективы × 10 и × 20 (CFI Plan Apo × 10/0,45 и CFI Plan Apo VC; × 20/0,75, Nikon) и иммерсионные объективы × 40 и × 60 (CFI Plan Fluor × 40/1.3 и CFI Plan Apo VC H × 60/1.4, Nikon). Количественную оценку распределения подтипов ИН в коре проводили путем сопоставления 10-элементной сетки на уровне первичной соматосенсорной коры, и ячейки, соответствующие корковым слоям, объединяли.

Author:

Добавить комментарий

Ваш адрес email не будет опубликован.